QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: jpet.104.078469v1 313/1/46    most recent Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Latchoumycandane, C. Articles by Kanthasamy, A. G. Search for Related Content PubMed PubMed Citation Articles by Latchoumycandane, C. Articles by Kanthasamy, A. G.

TOXICOLOGY

Protein Kinase C Is a Key Downstream Mediator of Manganese-Induced Apoptosis in Dopaminergic Neuronal Cells

Parkinson's Disorder Research Laboratory, Department of Biomedical Sciences, Iowa State University, Ames, Iowa

Received September 28, 2004; accepted December 6, 2004.

	Abstract

Top Abstract Materials and Methods Results Discussion References

 
Manganese (Mn) exposure causes manganism, a neurological disorder similar to Parkinson's disease. However, the cellular mechanism by which Mn induces dopaminergic neuronal cell death remains unclear. In the present study, we sought to investigate the key downstream apoptotic cell signaling events that contribute to Mn-induced cell death in mesencephalic dopaminergic neuronal (N27) cells. Mn exposure induced a dose-dependent increase in neuronal cell death in N27 cells. The cell death was accompanied by sequential activation of mitochondrial-dependent proapoptotic events, including cytochrome c release, caspase-3 activation, and DNA fragmentation, but not caspase-8 activation, indicating that the mitochondrial-dependent apoptotic cascade primarily triggers Mn-induced apoptosis. Notably, Mn treatment proteolytically activated protein kinase C (PKC), a member of a novel class of protein kinase C. The caspase-3 specific inhibitor benzyloxycarbonyl-Asp-Glu-Val-Asp-fluoromethylketone (Z-DEVD-FMK) significantly blocked PKC cleavage and its kinase activity, indicating that caspase-3 mediates the proteolytic activation. Cotreatment with the PKC inhibitor rottlerin or the caspase-3 inhibitor Z-DEVD-FMK almost completely blocked Mn-induced DNA fragmentation. Additionally, N27 cells expressing a catalytically inactive PKC^K376R protein (PKC dominant negative mutant) or a caspase cleavage resistant PKC^D327A protein (PKC cleavage resistant mutant) were found to be resistant to Mn-induced apoptosis. To further establish the proapoptotic role of PKC, RNA interference-mediated gene knockdown was performed. Small interfering RNA suppression of PKC expression protected N27 cells from Mn-induced apoptotic cell death. Collectively, these results suggest that caspase-3-dependent proteolytic activation of PKC plays a key role in Mn-induced apoptotic cell death.

	Materials and Methods

Top Abstract Materials and Methods Results Discussion References

 
Materials. The immortalized rat mesencephalic dopaminergic neuronal cell line 1RB3AN₂₇, normally referred to as N27 cells, was a kind gift from Dr. Kedar N. Prasad (University of Colorado Health Sciences Center, Denver, CO). Manganese chloride (MnCl₂, 99%), ATP, protein A-Sepharose, phosphatidylserine, dioleoylglycerol, and -actin (mouse monoclonal) were obtained from Sigma-Aldrich (St. Louis, MO), rottlerin was purchased from Calbiochem (San Diego, CA), and Z-Asp-Glu-Val-Asp-fluoromethyl ketone (Z-DEVD-FMK) was obtained from Alexis Biochemicals (San Diego, CA). Acetyl-Asp-Glu-Val-Asp-7-amino-4-methylcoumarin (Ac-DEVD-AMC) was obtained from Bachem Biosciences (King of Prussia, PA). Antibodies to PKC, PKC, and PKC were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA), and the ECL chemiluminescence kit was purchased from Amersham Biosciences Inc. (Piscataway, NJ). Hoechst 33342 and the Sytox Green fluorescent probe were purchased from Molecular Probes (Eugene, OR). Cell Death Detection ELISA Plus assay kit was purchased from Roche Diagnostics (Indianapolis, IN). [³²P]-ATP was purchased from PerkinElmer Life and Analytical Sciences (Boston, MA). Bradford protein assay reagent was purchased from Bio-Rad (Hercules, CA). RPMI 1640 medium, horse serum, fetal bovine serum, L-glutamine, penicillin, and streptomycin were purchased from Invitrogen (Carlsbad, CA). Plasmids for pPKC^K376R-green fluorescent protein (GFP) and pEGFP-N1 were kind gifts from Dr. Stuart Yuspa (National Cancer Institute, Bethesda, MD). PKC^D327A-GFP (PKC-CRM) construct was a kind gift from Dr. Mary Reyland's laboratory at the University of Colorado (Boulder, CO).

Cell Culture. The immortalized rat mesencephalic cell line (N27 cells) was grown in RPMI 1640 medium containing 10% fetal bovine serum, 2 mM L-glutamine, 50 units penicillin, and 50 µg/ml streptomycin (Kaul et al., 2003; Yang et al., 2004). The cell line was incubated at 37°C in a humidified atmosphere containing 5% CO₂.

Cytotoxicity Assays. The N27 cells were incubated with 10 to 5000 µM MnCl₂ for 24 h, and cell death was determined by 3-(4,5-dimethylthiazol-3-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay, which is widely used to assess cell viability (Kitazawa et al., 2001). After treatment with MnCl₂, the cells were incubated in serum-free medium containing 0.25 mg/ml MTT for 3 h at 37°C. Formation of formazan from tetrazolium was measured at 570 nm with a reference wavelength at 630 nm using a SpectraMax microplate reader (Molecular Devices, Sunnyvale, CA). Cell death was also determined after exposing N27 cells to 100 or 300 µM MnCl₂ in the presence or absence of 50 µM Z-DEVD-FMK using the Sytox Green fluorescent-based nucleic acid probe (Kaul et al., 2003). Sytox Green is a cell-impermeable nucleic acid dye that enters dead cells and intercalates with DNA to produce green fluorescence, which was quantified using a fluorescence microplate reader (SpectraMax Gemini XS model; Molecular Devices) with excitation at 485 nm and emission at 538 nm.

Determination of Cytosolic Cytochrome c. Mn-induced cytochrome c release was measured using an ELISA kit as described previously (Kaul et al., 2003). Briefly, N27 cells (5 x 10⁶ cells) were exposed to 300 µM MnCl_2, cytoplasmic fractions were collected, and cytosolic cytochrome c levels were quantified colorimetrically by using a SpectraMax Gemini XS microplate reader.

Assay of Caspase-3 Activity. Caspase-3 activity was measured using a specific fluorescent substrate, Ac-DEVD-AMC, as described previously (Kaul et al., 2003). Briefly, cells (1–2 x 10⁵ cells/well) were subcultured in 24-well culture plates and treated with 100 or 300 µM MnCl₂ for 12 and 24 h. Cells were lysed with lysis buffer containing 50 mM Tris/HCl, pH 7.4, 1 mM EDTA, 10 mM EGTA, and 10 µM digitonin. Lysates were then centrifuged at 10,000g for 5 min, and cell-free supernatants were collected. Caspase-3 activity in the cell lysates was measured by incubating the caspase-3 specific fluorescent substrate Ac-DEVD-AMC (Kaul et al., 2003). Formation of 7-amino-4-methylcoumarine, resulting from caspase substrate cleavage, was measured using a SpectraMax Gemini XS microplate reader with excitation at 380 nm (slit width 10 nm) and emission at 460 nm (slit width 20 nm). Caspase activity was expressed as fluorescence units per milligram of protein per hour.

Determination of Proteolytic Cleavage of PKC Isoforms. N27 neuronal cells (1 x 10⁷) were exposed to 100 or 300 µM MnCl₂ with or without the caspase-3 inhibitor Z-DEVD-FMK at 37°C for 24 h, and cell lysates were prepared as described by Kaul et al. (2003). Briefly, N27 cells were washed with 1x phosphate-buffered saline, resuspended in homogenization buffer, and then sonicated for 10 to 15 s. The homogenates from treated and control cells were centrifuged at 16,000g for 60 min at 4°C, and the supernatants were collected as cell lysates. The lysates were mixed with 2x gel loading buffer containing 10% SDS and 200 mM dithiothreitol and placed in boiling water for 5 min. Proteins were resolved by 10 to 12% SDS-polyacrylamide gel electrophoresis (PAGE) and blotted onto nitrocellulose membrane (Bio-Rad). After blocking the nonspecific binding sites with 5% nonfat dry milk (Amersham Biosciences Inc.), the membrane was then treated with anti-PKC (1:2000 dilution), anti-PKC (1:1000), or anti-PKC (1:1000) antibodies, followed by secondary HRP-conjugated anti-rabbit (1:2000) antibody. Antibody-bound proteins were detected by an ECL system using a Kodak Imager (Kodak Image Station 2000R; Eastman Kodak, New Haven, CT). To confirm equal protein in each lane, membranes were reprobed with -actin (1:5000).

Assay of Protein Kinase C Activity. PKC enzymatic activity was determined using immunoprecipitation as described previously (Kitazawa et al., 2003). The cells were exposed to 300 µM MnCl₂ for 24 h, with or without a capase-3 inhibitor (Z-DEVD-FMK), and cell lysates were collected. After immunoprecipitation with anti-PKC antibody, 25-µl samples containing PKC bound to Sepharose A beads were incubated with 25 µl of reaction buffer containing 0.4 mg of histone H1 and 5 µCi of [-³²P]ATP (4500 Ci/mM) for 10 min at 30°C. The reaction was terminated by the addition of 2x SDS gel loading buffer and boiled for 5 min. The samples were separated on 12.5% SDS-PAGE and histone phosphorylated bands were detected using a PhosphorImager (Personal Molecular Imager FX, Bio-Rad) and quantified using Quantity One 4.2.0 Software (Bio-Rad).

Determination of DNA Fragmentation. DNA fragmentation was measured using a Cell Death Detection ELISA Plus assay kit (Roche Diagnostics), as described previously (Kitazawa et al., 2003). This highly sensitive assay for the detection of early apoptotic events measures the amount of histone-associated low molecular weight DNA in the cytoplasm of cells. Briefly, N27 cells were exposed to 300 µM MnCl₂ with or without 50 µM of the caspase-3 specific inhibitor Z-DEVD-FMK or 1 to 5 µM of the PKC specific inhibitor rottlerin for 24 h. After treatment, cells were spun down, washed with 1x phosphate-buffered saline, and incubated with cell lysis buffer (supplied with the kit) for 30 min at room temperature, and then centrifuged. The supernatants were then dispensed into streptavidin-coated 96-well microtiter plates containing 80 µl of HRP-conjugated antibody cocktail. After 2-h incubation at room temperature, the nucleosomes retained by the antibody cocktail in the immunocomplex were quantified spectrophotometrically with 2,2'-azino-di-(3-ethylbenzthiazoline sulfonate (6)) diammonium salt as an HRP substrate. Measurements were made at 405 and 490 nm using a SpectroMax 190 spectrophotometer (Molecular Devices). The difference of absorbance between OD₄₀₅ and OD₄₉₀ nm was used to measure the actual DNA fragmentation level.

Stable Transfection of PKC^K376R Gene. Plasmid pPKC^K376R-GFP encodes protein kinase C-green fusion protein; K376R refers to the mutation of the lysine residue at position 376 to arginine in the catalytic site, which inactivates the PKC (Anantharam et al., 2002). Plasmid pEGFP-N1 encodes the green fluorescent protein alone and is used as a vector control. N27 cells stably expressing PKC^K376R-GFP (herein referred to as PKC-DN cells) and GFP alone-expressing cells (vector control) were cultured as described previously (Anantharam et al., 2002). The cells were exposed to 300 µM MnCl₂ for 24 h, and DNA fragmentation was measured as described above.

Lentiviral-Mediated Transfection of Caspase Resistant PKC^D327A Mutant Gene. We used the ViraPower Lentiviral Expression system (Invitrogen) to establish stable transfections of a caspase resistant mutant of PKC^D327A (aspartate to alanine mutation at position 327) into N27 cells (herein referred to as PKC-CRM). The PKC-CRM PCR fragment from pEGFP-N1 vector was subcloned into the plenti6/V5-D-TOPO expression vector, herein named plenti/PKC-CRM. Primers were forward, 5'CACCATGGCACCCTTCCTGCTC3' and reverse, 5'AATGTCCAGGAATTGC TCAAAC3'. Standard cloning procedures were used. Lentiviral containing plenti6/PKC-CRM was produced by transfecting the plenti6/PKC-CRM construct into human 293FT cells using LipofectAMINE 2000 transfection reagent. The lentivirus in the medium was collected by centrifuging at 1500g for 15 min, 48 to 72 h post-transfection. Lentiviral plenti/lacZ was also produced to serve as a vector control. Lentivirus containing plenti/PKC-CRM and polybrene (6 µg/ml) were added into cultured N27 cells (5 x 10⁴). Stable cell lines were established by selection in 10 µg/ml blasticidin 48 h after transfection. Colonies were isolated and then replated and grown to confluence in T75 flasks. Subsequently, the stable cell lines were maintained in 5 µg/ml blasticidin. PKC-CRM or lacZ expressing N27 cells were identified by immunostaining of the C-terminal V5 epitope on expressed protein. After establishing a stable cell line, the cells were exposed to 300 µM MnCl₂ for 24 h, and DNA fragmentation was measured as described above.

PKC siRNA Experiments in N27 Cells. PKC-siRNA was prepared by an in vitro transcription method as described previously (Yang et al., 2004). For this study, we synthesized a siRNA target site specific to rat PKC mRNA (gi: 18959249) and a nonspecific siRNA (siRNA-NS). Template sequences of PKC-siRNA duplexes are 5'-AAAAGGCAAATTCACAAACAGCCTGTCTC-3' (forward) and 5'-AACTGTTTGTGAATTTGCCTTCCTGTCTC-3' (reverse) with the target site located at nucleotide 2142 to 2162 in rat PKC mRNA with a GC content of 47.6%. Template sequences of siRNA-NS duplexes are 5'-AAGTTCTCCGAAGTGTGAGAACCTGTCTC-3' (sense) and 5'-AATTCTCACACTTCGGAGAACCCTGTCTC-3' (antisense). Previously, we showed that PKC-siRNA effectively suppresses >80% of PKC protein expression levels within 24 h post-transfection (Yang et al., 2004). For siRNA, sense and antisense templates were chemically synthesized with a partial T7 promoter sequence. In vitro transcription, annealing, and purification of siRNA duplexes were performed as described previously (Yang et al., 2004). Synthesized and annealed siRNA duplexes were treated with DNase and RNase to remove the extra nucleotides of transcribed siRNA to meet the structural 3'UU overhang and 5'phosphate requirements before transfection experiments.

N27 cells (50–70% confluence) were transfected with siRNA duplexes using a commercially available TKO transfection reagent (Mirus Corporation, Madison, WI). Briefly, TKO reagent was diluted into RPMI 1640 medium for 15 min, and then the 25 nM siRNA duplex was added to form a lipid-siRNA complex. After an additional 15-min incubation, an siRNA-lipid transfection complex was added to the N27 cells cultured in six-well plates. At 24 to 48 h post-transfection, N27 cells were treated with 300 µM Mn for an additional 24 h and used for the DNA fragmentation assay.

Data Analysis and Statistics. All the data were analyzed using Prism 3.0 Software (GraphPad Software, Inc., San Diego, CA). Data were first analyzed using one-way analysis of variance, Dunnett's post hoc test or Newman-Keuls test were performed to compare the differences between treatment groups. p < 0.05 or less was considered significant.

	Results

Top Abstract Materials and Methods Results Discussion References

 
Chronic Mn Exposure Induces Dose-Dependent Increase in Cytotoxicity. To determine the optimal dose for a detailed mechanistic investigation, we first performed dose-response cytotoxicity analysis. A dose-dependent decrease in cell viability (Fig. 1A), as determined by MTT assay, was observed in N27 cells exposed to various concentrations of Mn. Exposure to 10, 30, 100, 300, 1000, 3000, and 5000 µM Mn for 24 h decreased the cell viability by 18, 24, 24, 41, 65, 95, and 97%, respectively, compared with the control. An EC₅₀ of 345 µM for Mn was deduced by three-parameter nonlinear regression. The dose-dependent effect of manganese on cell death was further quantified by Sytox Green fluorescence assay. A 24-h exposure to 100 µM and 300 µM Mn resulted in a 1- and 2-fold increase in Sytox Green fluorescence, respectively (Fig. 1B). Furthermore, cotreatment with 50 µM Z-DEVD-FMK, a caspase-3 specific inhibitor, blocked more than 70% of 100 µM and over 74% of 300 µM Mn-induced cytotoxicity (Fig. 1B), suggesting that caspase-3 mainly mediates the Mn-induced cell death process in dopaminergic neuronal cells. Based upon these results, subsequent measurement of various biochemical indices in key mechanistic studies was performed in N27 cells treated with 300 µM Mn.

View larger version (25K): [in this window] [in a new window]   Fig. 1. Caspase-3-mediated Mn-induced cytotoxicity in N27 mesencephalic neuronal cells. A, MTT cytotoxicity assay; N27 cells were treated with 10 µM to 5 mM MnCl2 for 24 h and assayed for cell death using MTT. Data represent results from six to eight individual measurements and are expressed as mean ± S.E.M. B, Sytox Green cytotoxicity assay; Mn-induced changes in cell death measured 24 h after exposure to 100 or 300 µM MnCl2 in the presence or absence of a caspase-3 inhibitor, Z-DEVD-FMK (50 µM). Data represent results from eight separate measurements and are expressed as mean ± S.E.M. *, p < 0.05 compared with control group.

Mn Exposure Promotes Mitochondrial Cytochrome c Release. Several lines of evidence have recently shown that exposure to dopaminergic neurotoxins alters mitochondrial function, which can result in the release of a number of proapoptotic factors including cytochrome c and Smac/DIA-BLO into the cytosol (Kitazawa et al., 2001; Anantharam et al., 2002; Kaul et al., 2003) to initiate the apoptotic cascade. In the present study, treatment of N27 cells with 300 µMMn resulted in a significant increase in cytosolic cytochrome c (Fig. 2) compared with the control. Mn treatment increased cytosolic cytochrome c levels by 140 and 75% at 12 and 24 h, respectively, compared with the control.

View larger version (16K): [in this window] [in a new window]   Fig. 2. Release of cytochrome c in Mn-treated N27 cells. Subconfluent cultures of N27 cells were treated with 300 µM MnCl2 for 6 and 12 h, cytosolic fractions were isolated, and cytochrome c was measured by ELISA. The values are expressed as mean ± S.E.M. from six individual measurements, and *, p < 0.05 was considered significant compared with control groups.

Mn Induces a Dose- and Time-Dependent Activation of Caspase-3. Cytosolic cytochrome c is known to activate multiple caspases, including caspase-9 and caspase-3 (Dawson and Dawson, 2003; Kanthasamy et al., 2003). Caspase-3 plays an important role in the execution of programmed cell death in both neuronal and non-neuronal cells. In the present study, we examined the effect of Mn on the activities of caspase-3 in N27 mesencephalic clonal cells. Exposure to Mn induced a time- and dose-dependent increase in caspase-3 activity with respect to the control. Mn treatment at the concentrations of 100 and 300 µM induced 20 and 50% increases at 12 h and 100 and 150% increases at 24 h, respectively, compared with the corresponding group of controls (Fig. 3).

View larger version (36K): [in this window] [in a new window]   Fig. 3. Activation of caspase-3 in Mn-treated N27 cells. Subconfluent cultures of N27 cells were treated with Mn (100 and 300 µM) for 12 and 24 h. The enzyme activity was assayed using a caspase-3 substrate. The values are expressed as mean ± S.E.M. from six individual measurements, and *, p < 0.05 was considered significant compared with the control.

Caspase-3 Mediates Proteolytic Activation of PKC in Mn-Exposed N27 Cells. PKC was recently shown to be one of the important endogenous substrates of caspase-3 (Kikkawa et al., 2002; Brodie and Blumberg, 2003; Kanthasamy et al., 2003). Activated caspase-3 cleaves PKC, yielding a 38-kDa regulatory fragment and a 41-kDa catalytic fragment, to persistently increase the kinase activity. Exposure to 300 µM Mn for 24 h resulted in a dramatic increase in the 41- and 38-kDa catalytic and regulatory PKC bands, suggesting that Mn induces PKC activation (Fig. 4A). A minimal but not significantly increased level of PKC cleavage was observed in untreated cells. Cotreatment with 50 µM Z-DEVD-FMK, a caspase-3 specific inhibitor, almost completely blocked the Mn-induced PKC cleavage (Fig. 4B). Densitometric analysis of the 41-kDa PKC cleaved bands in Fig. 4B revealed that cotreatment with Z-DEVD-FMK results in >90% reduction in PKC cleavage in Mn-treated cells. In addition, exposure to 300 µM Mn did not induce proteolytic cleavage of PKC (Fig. 4C) or PKC (Fig. 4D), suggesting that Mn-induced PKC cleavage is isoform-specific.

View larger version (40K): [in this window] [in a new window]   Fig. 4. Caspase-3-dependent proteolytic cleavage of PKC in Mn-induced neurotoxicity. A, PKC immunoblot after Mn treatment. N27 cells were treated with either 100 or 300 µM Mn for 24 h, and proteins were separated by 10% SDS-PAGE and probed with PKC antibody to observe both native (72–74 kDa) and cleaved (38–41 kDa) PKC bands. B, effect of caspase-3 inhibitor on Mn-induced PKC cleavage. N27 cells were treated with 300 µM Mn with or without the addition of 50 µM Z-DEVD-FMK for 24 h and then a PKC immunoblot was performed as described above. To confirm equal protein loading in each lane, the membranes were reprobed with -actin antibody. C and D, PKC and PKC1 immunoblot after Mn treatment. N27 cells were treated with 100 or 300 µMMn for 24 h and probed with either PKC or PKC1.

Furthermore, exposure to 300 µM Mn increased PKC enzymatic kinase activity in parallel with an increase in PKC-proteolytically cleaved products (Fig. 5). A 24-h treatment with 300 µM Mn induced a 100% increase in PKC kinase activity compared with the control. The kinase activity assay was performed in the absence of lipids to determine the activity due solely to the proteolytically cleaved PKC catalytic fragment. The Mn-induced PKC kinase activity was abolished in cells cotreated with 50 µM Z-DEVD-FMK (caspase-3 inhibitor) or 2 µM rottlerin (PKC inhibitor). These results suggest that proteolytic cleavage of PKC by caspase-3 increases the kinase activity. Blockade of Mn-induced increases in PKC kinase activity by rottlerin further confirms the specificity of PKC activation.

View larger version (24K): [in this window] [in a new window]   Fig. 5. Mn-induced PKC cleavage increases the kinase activity. Subconfluent cultures of N27 cells were harvested at 24 h after treatment with 300 µM Mn in the presence or absence of 50 µM Z-DEVD-FMK (caspase-3 inhibitor) or 2 µM rottlerin (PKC inhibitor). Cell lysates were isolated and PKC was immunoprecipitated from treated cell lysate and the enzyme activity was measured by 32P phosphorylation. The values are expressed as a percentage of control cells, and *, p < 0.05 was considered significant when comparing Mn-treated cells to other treatment groups.

Suppression of Mn-Induced DNA Fragmentation by Caspase-3 and PKC Inhibitors. We performed a series of experiments to determine whether caspase-3-dependent proteolytic activation of PKC contributes to Mn-induced apoptosis in dopaminergic cells. Chromatin condensation and DNA fragmentation are hallmarks of apoptosis (Kanthasamy et al., 2003). To quantitatively assess Mn-induced DNA fragmentation, we used an ELISA-based Cell Death Detection Plus kit (Roche Diagnostics), as described previously (Anantharam et al., 2002). Mn caused a time-dependent increase in DNA fragmentation (Fig. 6A) compared with the control. Exposure to 300 µM Mn resulted in a 72 and 209% increase in DNA fragmentation at 12 and 24 h, respectively, compared with the control. Cotreatment with 50 µM Z-DEVD-FMK blocked Mn-induced DNA fragmentation by 100 and 80% at 12 and 24 h, respectively (Fig. 6A). Furthermore, cotreatment with PKC-specific inhibitor rottlerin also blocked Mn-induced DNA fragmentation in a dose-dependent manner (Fig. 6B). Treatment with 1, 3, and 5 µM rottlerin inhibited Mn-induced DNA fragmentation by 7, 35, and 54%, respectively (Fig. 6B), compared with cells treated with Mn.

View larger version (23K): [in this window] [in a new window]   Fig. 6. Mn-induced apoptosis in N27 cells. A, effect of the caspase-3 inhibitor Z-DEVD-FMK on Mn-induced DNA fragmentation in N27 cells. Subconfluent cultures of N27 cells were harvested at 12 and 24 h after treatment with 300 µM Mn in the presence or absence of 50 µM Z-DEVD-FMK. DNA fragmentation was quantified using ELISA. The data are expressed as percentage of DNA fragmentation compared with untreated control cells, and asterisks (*, p < 0.05; **, p < 0.01) indicate significant differences compared with control cells. B, effect of rottlerin on Mn-induced DNA fragmentation in N27 cells. N27 cells were treated with 300 µM Mn for 24 h with or without 1, 3, or 5 µM rottlerin. DNA fragmentation was reduced by rottlerin in N27 cells in a dose-dependent manner. The data are expressed as percentage of DNA fragmentation observed in Mn-treated cells. The data represent the mean ± S.E.M. of six individual measurements. Asterisks (**, p < 0.01) indicate significant differences between Mn-treated cells and Mn plus rottlerin-treated cells.

Overexpression of Kinase Inactive PKC-DN Mutant Rescues Mesencephalic Neuronal Cells from Mn-Induced Apoptosis. In addition to inhibitor studies, we used a genetic approach involving overexpression of a catalytically inactive dominant negative PKC^K376R (PKC-DN) mutant to determine the proapoptotic role of PKC in Mn-induced neurotoxicity. We engineered a rat immortalized mesencephalic (N27) cell line to express a dominant negative PKC mutant by stably transfecting with plasmids pPKC^K376R-GFP (in which a lysine at position 376 is mutated to arginine) and pEGFP-N1 (Anantharam et al., 2002). The plasmid pPKC^K376R-GFP encodes a catalytically inactive PKC mutant fused to GFP, and the pEGFP-N1 plasmid encodes the green fluorescent protein alone, which was used as a vector control (Fig. 7A). N27 cells stably expressing the PKC-DN-GFP mutant as a fusion protein and vector cells expressing GFP alone are shown in Fig. 7B. Exposure to 300 µM Mn resulted in a 4.5-fold increase in DNA fragmentation in cells expressing GFP alone (Fig. 7C). However, the response to Mn treatment was significantly attenuated in N27 cells, which stably expressed the PKC-DN-GFP mutant. Mn induced 64% less DNA fragmentation in PKC-DN-GFP cells compared with cells expressing GFP alone (Fig. 7C). Furthermore, we determined whether manganese still induces cell death despite the blockade of apoptosis in these cells. Measurement of cytotoxicity by MTT assay revealed that Mn-induced cytotoxicity was significantly (p < 0.01) reduced in PKC-DN-GFP overexpressing cells compared with GFP alone-expressing N27 cells (Fig. 7D). Mn-exposure (300 µM) decreased the cell viability by 80% in GFP alone-expressing N27 cells, whereas the cell viability was decreased by only 30% in PKC-DN-GFP overexpressing cells. Together, these results suggest that PKC-DN overexpression rescues N27 cells from both Mn-induced cytotoxicity and apoptotic cell death.

View larger version (31K): [in this window] [in a new window]   Fig. 7. Overexpression of catalytically inactive PKCK376R protein (PKC-DN) attenuates Mn-induced apoptosis. A, schematic of plasmid constructs. pEGFP-NI construct encodes the GFP mRNA transcribed under the 5' human cytomegalovirus (CMV) immediate early promoter, and the mRNA is stabilized with the 3' SV40 mRNA polyadenylation signal (pA) and was used as a vector control. The PKCK376R-GFP (PKC-DN-GFP) construct encodes the kinase inactive PKC-GFP fusion transcript. B, fluorescent images showing the stable expression of both the GFP control vector (left) and PKC-DN-GFP fusion protein (right) in N27 cells (200x magnification). C, DNA fragmentation assay. D, cell viability assay. Subconfluent cultures of N27 cells stably expressing the vector or PKC-DN-GFP fusion protein were treated with 100 or 300 µM Mn for 24 h. Cell viability and DNA fragmentation was assayed using MTT and ELISA, respectively, as described under Materials and Methods. The data are expressed as percentage of apoptosis observed in control cells. The data represent mean ± S.E.M. of four to six individual measurements. Single asterisks (*, p < 0.05) indicate significant differences compared with untreated control, and double asterisks (**, p < 0.01) indicate a significant difference between the 300 µM Mn-treated PKC-DN-GFP mutant cells and the 300 µM Mn-treated vector cells expressing GFP alone.

Overexpression of Cleavage Resistant Kinase PKC^D327A-mutant (PKC^D327A-CRM) Protects Mesencephalic Neuronal Cells from Mn-Induced Apoptosis. To further demonstrate that the caspase-3-dependent PKC proteolytic cleavage contributes to Mn-induced apoptosis, we used the caspase cleavage site-resistant mutant PKC^D327A in which aspartate at position 327 is mutated to alanine. N27 cells stably expressing PKC^D327A-CRM-V5 were generated by using a lentiviral vector tagged with the V5 fusion protein (Fig. 8, A and B). Lac-expressing cells were used as a control. As shown Fig. 8C, Mn-induced proteolytic cleavage of endogenous PKC was almost completely blocked in PKC^D327A-CRM mutant-overexpressing cells (Fig. 8C). Furthermore, 300 µM Mn failed to induce DNA fragmentation in N27 cells stably overexpressing the PKC^D327A-CRM mutant, whereas 3- to 4-fold increases in DNA fragmentation were observed in LacZ-expressing cells compared with untreated cells (Fig. 8D). These results strongly suggest that the proteolytic activation of PKC mediates Mn-induced apoptosis.

View larger version (20K): [in this window] [in a new window]   Fig. 8. Overexpression of cleavage-resistant PKCD327A protein (PKC-CRM) attenuates Mn-induced apoptosis. A, schematic of plasmid constructs. PKC-CRM-V5 construct encodes cleavage resistant mutant of PKC-CRM-V5 tag transcript mRNA transcribed under the 5' human cytomegalovirus (CMV) immediate early promoter, and the mRNA is stabilized with the 3' SV40 mRNA polyadenylation signal (pA). B, fluorescent images showing the stable expression of V5 tag in N27 cells expressing the PKC-CRM-V5 tag (200x magnification). C, PKC-CRM prevents Mn-induced PKC cleavage. Subconfluent cultures of N27 cells stably expressing the vector or PKC-CRM-V5 protein were treated with 300 µM Mn for 24 h. LacZ-expressing cells were used as a vector control. PKC cleavage was determined by Western blot. D, DNA fragmentation assay. Subconfluent cultures of N27 cells stably expressing the vector or PKC-CRM-V5 protein were treated with 300 µM Mn for 24 h and then DNA fragmentation was measured by ELISA. The data represent mean ± S.E.M. of four to six individual measurements. Single asterisk (*, p < 0.01) indicates a significant difference between the 300 µM Mn-treated PKC-CRM-V5 mutant cells and the 300 µM Mn-treated LacZ vector control cells.

RNAi-Mediated Knockdown of PKC Rescues N27 Cells from Mn-Induced Apoptotic Cell Death. To further substantiate the functional role of PKC in Mn-induced apoptotic cell death, we examined the effect of PKC siRNA on Mn-induced DNA fragmentation. We recently developed PKC siRNAs that specifically suppress PKC expression without producing any cytotoxic effect in dopaminergic cells (Yang et al., 2004). In Fig. 9A, in situ immunostaining shows a dramatic suppression of PKC protein as determined by staining with Alexa 488 in Cy3-labeled PKC-siRNA transfected cells compared with siRNA-NS-transfected N27 cells. Furthermore, Western blot analysis revealed that the protein levels of PKC was suppressed by >60% in PKC-siRNA-transfected cells (Fig. 9B), whereas PKC expression levels were unaltered in siRNA-NS or untreated control cells. Exposure to 300 µM Mn for 24 h induced 2- to 3-fold increases in DNA fragmentation in siRNA-NS transfected N27 cells and native N27 cells compared with untreated controls. In contrast, Mn-induced DNA fragmentation was completely blocked in PKC-siRNA-transfected N27 cells (Fig. 9C). Together, these results strongly support a key proapoptotic function of PKC in Mn-induced dopaminergic cell death.

View larger version (32K): [in this window] [in a new window]   Fig. 9. Suppression of PKC by siRNA rescues N27 cells from Mn-induced apoptotic cell death. A, PKC-siRNA suppresses PKC protein expression. Cells were transfected with Cy3-labeled PKC-siRNA (25 nM) or Cy3-labeled NS-siRNA, and PKC expression was observed after immunostaining using anti-PKC antibody and Alexa-488 secondary antibody. The nuclei were visualized by Hoechst 33342 counterstaining. Merged images show expression of PKC (green), Cy-3-labeled PKC-siRNA or siRNA-NS (red), and nuclear staining (blue). Cells were observed under a Nikon inverted fluorescence microscope and pictures were captured with a SPOT digital camera (Diagnostic Instruments, Sterling Heights, MI). PKC-siRNA markedly reduced PKC expression, whereas cells transfected with cy3-labeled siRNA-NS (25 nM) show normal PKC expression. B, Western blot analysis of PKC expression at 24 h post-transfection with PKC-siRNA. Membranes were reprobed with -actin (43-kDa) antibody to confirm equal protein loading. C, PKC-siRNA completely protects N27 cells against Mn-induced DNA fragmentation. Subconfluent cultures of N27 cells were transfected with siRNA--4 (25 nM) or siRNA-NS for 24 h and then the cells were treated with 300 µM Mn for an additional 24 h. After exposure to Mn, DNA fragmentation was measured. Untransfected N27 cells not exposed to Mn were used as controls. The data represent the mean ± S.E.M. from six individual measurements.

	Discussion

Top Abstract Materials and Methods Results Discussion References

 
In the present study, we demonstrate that an inorganic form of Mn can induce apoptosis in mesencephalic dopamine-producing N27 cells through the activation of a series of specific cell death signaling events, including release of cytochrome c from the mitochondria into the cytosol, activation of caspase-3, proteolytic cleavage of PKC, and nuclear DNA breakdown. Using a kinase inactive PKC^K376R dominant negative mutant, a caspase resistant PKC^D327A mutant, and siRNA against rat PKC mRNA, we establish that PKC is a key downstream mediator of Mn-induced apoptosis in dopaminergic neuronal cells.

Mn has been shown to primarily target the nigrostriatal system, including the globus pallidus and substantia nigra (Baek et al., 2003). Mn exposure varies from moderate, as occurs via drinking water and food sources, to high level exposure from occupational and industrial settings such as mining, welding, and steel manufacturing (Woolf et al., 2002; Roth and Garrick, 2003; Dobson et al., 2004; Olanow, 2004). Mn can cross the blood-brain barrier via specific carriers such as transferrin and divalent metal transporter 1 and also by diffusion (Yokel and Crossgrove, 2004). The normal concentration of manganese in human adult tissues ranges from 3 to 20 µM (Roth and Garrick, 2003), and the human blood manganese level is 7.2 µg/l (Hauser et al., 1996). Markesbery et al. (1984) reported that the mean brain manganese level is 0.261 µg/g, and Zecca et al. (1994) reported Mn levels in putamen, substantia nigra, and neuromelanin of 6.31, 0.34, and 58.5 ng/mg wet weight, respectively. Depending on the level of exposure, blood manganese concentrations can increase from 10- to 200-fold (Hauser et al., 1996; Lucchini et al., 1999; Mergler et al., 1999; Woolf et al., 2002; McKinney et al., 2004). Normally, higher relative concentrations of manganese are required in cell culture studies, and the concentrations used in our studies are consistent with other studies (Hirata, 2002; Roth et al., 2002; Stredrick et al., 2004). Still, 300 µM Mn was sufficient to induce apoptotic cell death in N27 cells, compared with the 0.6-1 mM concentration of Mn used in other cell types (Hirata, 2002; Roth et al., 2002). Higher relative concentrations of test compounds are generally needed to elicit responses in cell cultures due to the acute nature of the treatment period in in vitro studies (hours to days) compared with chronic long-term studies in animal models (days to months). Importantly, the 300 µM manganese concentration used in this study approximates the concentration observed in the striatum of manganese treated rats (Chan et al., 1992; Erikson and Aschner, 2003; Dorman et al., 2004; Gunter et al., 2004). We observed activation of apoptotic signaling molecules, including PKC cleavage, at lower manganese concentrations (50 µM) when N27 cells were incubated over a longer time (72 h) (unpublished observations). Thus, the concentration of Mn used in the present study is consistent with the literature and relevant to Mn neurotoxicity.

Recently, we and others demonstrated that both Mn and MMT exposure leads to ROS generation as well as depolarization of the mitochondrial membrane potential in PC12 cells and cortical mitochondrial preparations (Anantharam et al., 2002; Kitazawa et al., 2002). Dopaminergic neurons are particularly vulnerable to oxidative damage (Cantuti-Castelvetri et al., 2003; Dauer and Przedborski, 2003; Dawson and Dawson, 2003). Previously, we observed that dopaminergic cells (PC12) are more vulnerable to MMT-induced ROS generation and apoptotic cell death than nondopaminergic cells (M212-20) (Kitazawa et al., 2002). We also observed that Trolox (an ROS scavenger), l-deprenyl (a monoamine oxidase-B inhibitor), or -methyl-p-tyrosine (a tyrosine hydroxylase inhibitor) can effectively attenuate the organic manganese toxicity. Based on these data and available literature, we concluded that excess dopamine in an ROS-rich environment may augment the oxidative insult by formation of highly cytotoxic radicals (Junn and Mouradian, 2001; Kitazawa et al., 2001), which may contribute to the enhanced susceptibility of dopaminergic neurons to MMT neurotoxicity. In agreement with our results, a recent study demonstrated that manganese is more toxic in catecholamine-producing cells than in noncatecholaminergic cells (Stredrick et al., 2004).

In terms of the neurotoxic effect of manganese on the nigrostriatal system, the effect of manganese on the globus pallidus must be considered since accumulation of manganese is high in this brain region, which is also considered an early target region of manganese neurotoxicity (Roth and Garrick, 2003; Dobson et al., 2004; Olanow, 2004). The prooxidant effect of dopamine may explain the sensitivity of the pallidal neurons to manganese toxicity because of the high dopaminergic innervation to this region from the substantia nigra. The relative sensitivity of nigral neurons compared with pallidal neurons cannot be explained by cell culture models, such as N27 cells, alone. Rather, a detailed temporal and regional analysis of the manganese toxicity response in both the striatum and substantia nigra in animal models is necessary.

Several studies using cell cultures as well as animal models indicate that caspase-3 plays a major role in the regulation and execution of apoptosis (Kanthasamy et al., 2003). Chronic exposure to inorganic Mn results in a time-dependent activation of caspase-3 in N27 cells. Our data are in agreement with recent reports showing Mn-induced caspase-3 activation in neuronal and non-neuronal cell culture models (Schrantz et al., 1999; Chun et al., 2001; Hirata, 2002). However, caspase-independent cell death has also been reported after manganese exposure (Roth et al., 2000; Oubrahim et al., 2001; Stredrick et al., 2004); the different cell types or methodologies used in these studies may explain the incongruent results. In our study, we did not observe complete protection against Mn-induced cell death with Z-DEVD-FMK and suspect that the concentration of Z-DEVD-FMK (50 µM) was insufficient to completely block Mn-induced cytotoxic cell death. Another possibility is that a minor cell death pathway may be independent of caspase-3. In terms of PD pathogenesis, caspase-3 activation is essential for apoptosis in dopaminergic neurons in human patients with PD as well as in animal models of PD (Hartmann et al., 2000).

We recently established that proteolytic activation of PKC by caspase-3 is an important event in the apoptotic cell death of dopaminergic cells (Kanthasamy et al., 2003). In this study, we showed that Mn treatment induces caspase-3-dependent proteolytic cleavage of PKC but not of other isoforms, including PKC or PKC, suggesting that the cleavage is isoform-specific. Cotreatment with the caspase-3-specific inhibitor Z-DEVD-FMK or overexpression of PKC^D327A-CRM completely blocked Mn-induced proteolytic cleavage of PKC in N27 cells. Recently, we and others have implicated the persistently active catalytic PKC fragment in apoptosis in neuronal and non-neuronal cells (Kikkawa et al., 2002; Brodie and Blumberg, 2003; Kanthasamy et al., 2003). Previously, Hirata (2002) showed that Mn treatment induces DNA fragmentation in PC12 cells. We found that Mn exposure induced DNA fragmentation in N27 cells whereas Z-DEVD-FMK and rottlerin suppressed Mn-induced DNA fragmentation, suggesting that both caspase-3 and PKC play a role in Mn-induced apoptosis. The proapoptotic role of PKC in Mn-induced neurotoxicity was also confirmed in N27 cells engineered to stably express the catalytically inactive PKC protein (PKC^K376R-DN). Mn treatment failed to induce DNA fragmentation in N27 cells stably expressing PKC-DN, confirming that PKC activation is essential for Mn-induced apoptosis. Furthermore, Mn did not induce apoptotic cell death in N27 cells stably expressing the caspase cleavage-resistant and catalytically active PKC^D327A-CRM mutant, confirming the proapoptotic role of cleaved PKC.

RNA interference-mediated gene suppression was recently shown to overcome many problems associated with pharmacological inhibitors and antisense oligos, including inherent nonspecificity and cytotoxicity (Yang et al., 2004). Because of the high specificity and low toxicity of siRNAs (Yang et al., 2004), we used an siRNA strategy to further confirm the proapoptotic role of PKC in Mn-induced apoptotic cell death. We recently demonstrated that siRNA inhibits PKC in an isoform-specific manner, which had not been possible with the use of pharmacological inhibitors (Yang et al., 2004). Blockade of Mn-induced DNA fragmentation by PKC-siRNA in the present study clearly establishes its proapoptotic role in dopaminergic neurodegeneration.

The events downstream of PKC activation that lead to apoptotic cell death are still unclear. Recent studies from our laboratory and others indicate that the catalytically active PKC fragment can regulate the activity of a variety of cell signaling molecules associated with apoptotic cell death, including scrambalase, DNA-PK, Radd, nuclear factor-B, Histone 2B, mitogen-activated protein kinases, Jak2, PKC-interacting protein kinase, Lamin B, Stat3, and others (Kikkawa et al., 2002; Brodie and Blumberg, 2003; Kanthasamy et al., 2003). However, the key downstream substrate of PKC responsible for the Mn-induced apoptotic cell death in dopaminergic neuronal cells has not yet been characterized.

In conclusion, the present study demonstrates that exposure to inorganic Mn induces dopaminergic degeneration by a novel apoptotic pathway mediated by caspase-3-dependent proteolytic activation of PKC (Fig. 10). This study not only establishes PKC as a key downstream mediator of Mn-induced apoptosis but also emphasizes that selective targeting of the proapoptotic kinase PKC by siRNA can rescue dopaminergic neurons from Mn-induced dopaminergic degeneration. These findings may also have therapeutic implications in Parkinson's-like diseases.

View larger version (20K): [in this window] [in a new window]   Fig. 10. Proposed model describing the sequence of cell death signaling events in Mn-induced apoptosis. 1) Mn treatment impairs mitochondrial function, resulting in cytochrome c release into the cytosol; 2) cytosolic cytochrome c activates caspase cascade (3) caspase-3 mediates proteolytic cleavage of PKC; proteolytically activated PKC mediates DNA fragmentation (4) and apoptosis (5). Effect of pharmacological inhibitors and genetic modulators on Mn-induced apoptosis. a, cotreatment with caspase-3-specific inhibitor Z-DEVD-FMK prevents proteolytic activation of PKC and Mn-induced DNA fragmentation. b, cotreatment with PKC specific inhibitor rottlerin attenuates Mn-induced DNA fragmentation. c, overexpression of PKCD327A-CRM mutant protein significantly attenuates caspase-3-mediated PKC cleavage and DNA fragmentation. d, overexpression of dominant negative mutant PKCK376R-DN almost completely suppresses Mn-induced DNA fragmentation. e, RNAi-mediated knockdown of PKC with siRNA-PKC rescues N27 cells from Mn-induced apoptotic cell death.

	Footnotes

 
This study was supported by the National Institutes of Health Grants ES 10586, NS 38644, and NS 45133.

doi:10.1124/jpet.104.078469.

ABBREVIATIONS: Mn, manganese; PD, Parkinson's disease; RNAi, RNA interference; PKC, protein kinase C; Z-DEVD-FMK, benzyloxycarbonyl-Asp-Glu-Val-Asp-fluoromethylketone; Z-VAD-FMK, benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone; ELISA, enzyme-linked immunosorbent assay; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazodium bromide; PAGE, polyacrylamide gel electrophoresis; GFP, green fluorescence protein; HRP, horseradish peroxidase; siRNA, small interfering RNA; siRNA-NS, siRNA-nonspecific; ROS, reactive oxygen species; MMT, methylcyclopentadienyl manganese tricarbonyl.

Address correspondence to: Dr. A. G. Kanthasamy, Parkinson's Disorder Research Laboratory, Department of Biomedical Sciences, 2008 Veterinary Medicine Bldg., Iowa State University, Ames, IA 50011-1250. E-mail: akanthas{at}iastate.edu

	References

Top Abstract Materials and Methods Results Discussion References

 

Anantharam V, Kitazawa M, Wagner J, Kaul S, and Kanthasamy AG (2002) Caspase-3-dependent proteolytic cleavage of protein kinase Cdelta is essential for oxidative stress-mediated dopaminergic cell death after exposure to methylcyclopentadienyl manganese tricarbonyl. J Neurosci 22: 1738–1751.[Abstract/Free Full Text]

Baek SY, Lee MJ, Jung HS, Kim HJ, Lee CR, Yoo C, Lee JH, Lee H, Yoon CS, Kim YH, et al. (2003) Effect of manganese exposure on MPTP neurotoxicities. Neurotoxicology 24: 657–665.[CrossRef][Medline]

Brodie C and Blumberg PM (2003) Regulation of cell apoptosis by protein kinase c delta. Apoptosis 8: 19–27.[CrossRef][Medline]

Cantuti-Castelvetri I, Shukitt-Hale B, and Joseph JA (2003) Dopamine neurotoxicity: age-dependent behavioral and histological effects. Neurobiol Aging 24: 697–706.[CrossRef][Medline]

Chan AW, Minski MJ, Lim L, and Lai JC (1992) Changes in brain regional manganese and magnesium levels during postnatal development: modulations by chronic manganese administration. Metab Brain Dis 7: 21–33.[CrossRef][Medline]

Chun HS, Lee H, and Son JH (2001) Manganese induces endoplasmic reticulum (ER) stress and activates multiple caspases in nigral dopaminergic neuronal cells, SN4741. Neurosci Lett 316: 5–8.[CrossRef][Medline]

Dauer W and Przedborski S (2003) Parkinson's disease: mechanisms and models. Neuron 39: 889–909.[CrossRef][Medline]

Dawson TM and Dawson VL (2003) Molecular pathways of neurodegeneration in Parkinson's disease. Science (Wash DC) 302: 819–822.[Abstract/Free Full Text]

Dobson AW, Erikson KM, and Aschner M (2004) Manganese neurotoxicity. Ann NY Acad Sci 1012: 115–128.[Abstract/Free Full Text]

Dorman DC, McManus BE, Parkinson CU, Manuel CA, McElveen AM, and Everitt JI (2004) Nasal toxicity of manganese sulfate and manganese phosphate in young male rats following subchronic (13-week) inhalation exposure. Inhal Toxicol 16: 481–488.[CrossRef][Medline]

Ensing JG (1985) Bazooka: cocaine-base and manganese carbonate [letter]. J Anal Toxicol 9: 45–46.[Medline]

Erikson KM and Aschner M (2003) Manganese neurotoxicity and glutamate-GABA interaction. Neurochem Int 43: 475–480.[CrossRef][Medline]

Gunter TE, Miller LM, Gavin CE, Eliseev R, Salter J, Buntinas L, Alexandrov A, Hammond S, and Gunter KK (2004) Determination of the oxidation states of manganese in brain, liver and heart mitochondria. J Neurochem 88: 266–280.[Medline]

Hartmann A, Hunot S, Michel PP, Muriel MP, Vyas S, Faucheux BA, Mouatt-Prigent A, Turmel H, Srinivasan A, Ruberg M, et al. (2000) Caspase-3: a vulnerability factor and final effector in apoptotic death of dopaminergic neurons in Parkinson's disease. Proc Natl Acad Sci USA 97: 2875–2880.[Abstract/Free Full Text]

Hauser RA, Zesiewicz TA, Martinez C, Rosemurgy AS, and Olanow CW (1996) Blood manganese correlates with brain magnetic resonance imaging changes in patients with liver disease. Can J Neurol Sci 23: 95–98.[Medline]

Hirata Y (2002) Manganese-induced apoptosis in PC12 cells. Neurotoxicol Teratol 24: 639.[CrossRef][Medline]

Jenner P (2003) Oxidative stress in Parkinson's disease. Ann Neurol 53 (Suppl 3): S26–S36; discussion, S36–S28.

Junn E and Mouradian MM (2001) Apoptotic signaling in dopamine-induced cell death: the role of oxidative stress, p38 mitogen-activated protein kinase, cytochrome c and caspases. J Neurochem 78: 374–383.[CrossRef][Medline]

Kanthasamy AG, Kitazawa M, Kanthasamy A, and Anantharam V (2003) Role of proteolytic activation of protein kinase Cdelta in oxidative stress-induced apoptosis. Antioxid Redox Signal 5: 609–620.[CrossRef][Medline]

Kaul S, Kanthasamy A, Kitazawa M, Anantharam V, and Kanthasamy AG (2003) Caspase-3 dependent proteolytic activation of protein kinase C delta mediates and regulates 1-methyl-4-phenylpyridinium (MPP+)-induced apoptotic cell death in dopaminergic cells: relevance to oxidative stress in dopaminergic degeneration. Eur J Neurosci 18: 1387–1401.[CrossRef][Medline]

Kikkawa U, Matsuzaki H, and Yamamoto T (2002) Protein kinase Cdelta (PKC-delta): activation mechanisms and functions. J Biochem 132: 831–839.[Abstract/Free Full Text]

Kitazawa M, Anantharam V, and Kanthasamy AG (2001) Dieldrin-induced oxidative stress and neurochemical changes contribute to apoptopic cell death in dopaminergic cells. Free Radic Biol Med 31: 1473–1485.[CrossRef][Medline]

Kitazawa M, Anantharam V, and Kanthasamy AG (2003) Dieldrin induces apoptosis by promoting caspase-3-dependent proteolytic cleavage of protein kinase Cdelta in dopaminergic cells: relevance to oxidative stress and dopaminergic degeneration. Neuroscience 119: 945–964.[CrossRef][Medline]

Kitazawa M, Wagner JR, Kirby ML, Anantharam V, and Kanthasamy AG (2002) Oxidative stress and mitochondrial-mediated apoptosis in dopaminergic cells exposed to methylcyclopentadienyl manganese tricarbonyl. J Pharmacol Exp Ther 302: 26–35.[Abstract/Free Full Text]

Lucchini R, Apostoli P, Perrone C, Placidi D, Albini E, Migliorati P, Mergler D, Sassine MP, Palmi S, and Alessio L (1999) Long-term exposure to "low levels" of manganese oxides and neurofunctional changes in ferroalloy workers. Neurotoxicology 20: 287–297.[Medline]

Markesbery WR, Ehmann WD, Hossain TI, and Alauddin M (1984) Brain manganese concentrations in human aging and Alzheimer's disease. Neurotoxicology 5: 49–57.[Medline]

McKinney AM, Filice RW, Teksam M, Casey S, Truwit C, Clark HB, Woon C, and Liu HY (2004) Diffusion abnormalities of the globi pallidi in manganese neurotoxicity. Neuroradiology 46: 291–295.[CrossRef][Medline]

Mergler D, Baldwin M, Belanger S, Larribe F, Beuter A, Bowler R, Panisset M, Edwards R, de Geoffroy A, Sassine MP, et al. (1999) Manganese neurotoxicity, a continuum of dysfunction: results from a community based study. Neurotoxicology 20: 327–342.[Medline]

Olanow CW (2004) Manganese-induced parkinsonism and Parkinson's disease. Ann NY Acad Sci 1012: 209–223.[Abstract/Free Full Text]

Oubrahim H, Stadtman ER, and Chock PB (2001) Mitochondria play no roles in Mn(II)-induced apoptosis in HeLa cells. Proc Natl Acad Sci USA 98: 9505–9510.[Abstract/Free Full Text]

Roth JA, Feng L, Walowitz J, and Browne RW (2000) Manganese-induced rat pheochromocytoma (PC12) cell death is independent of caspase activation. J Neurosci Res 61: 162–171.[CrossRef][Medline]

Roth JA and Garrick MD (2003) Iron interactions and other biological reactions mediating the physiological and toxic actions of manganese. Biochem Pharmacol 66: 1–13.[CrossRef][Medline]

Roth JA, Horbinski C, Higgins D, Lein P, and Garrick MD (2002) Mechanisms of manganese-induced rat pheochromocytoma (PC12) cell death and cell differentiation. Neurotoxicology 23: 147–157.[CrossRef][Medline]

Schrantz N, Blanchard DA, Mitenne F, Auffredou MT, Vazquez A, and Leca G (1999) Manganese induces apoptosis of human B cells: caspase-dependent cell death blocked by bcl-2. Cell Death Differ 6: 445–453.[CrossRef][Medline]

Stredrick DL, Stokes AH, Worst TJ, Freeman WM, Johnson EA, Lash LH, Aschner M, and Vrana KE (2004) Manganese-induced cytotoxicity in dopamine-producing cells. Neurotoxicology 25: 543–553.[CrossRef][Medline]

Woolf A, Wright R, Amarasiriwardena C, and Bellinger D (2002) A child with chronic manganese exposure from drinking water. Environ Health Perspect 110: 613–616.

Yang Y, Kaul S, Zhang D, Anantharam V, and Kanthasamy AG (2004) Suppression of caspase-3-dependent proteolytic activation of protein kinase C delta by small interfering RNA prevents MPP+-induced dopaminergic degeneration. Mol Cell Neurosci 25: 406–421.[CrossRef][Medline]

Yokel RA and Crossgrove JS (2004) Manganese toxicokinetics at the blood-brain barrier. Res Rep Health Eff Inst 119: 7–58; discussion, 59–73.

Zecca L, Pietra R, Goj C, Mecacci C, Radice D, and Sabbioni E (1994) Iron and other metals in neuromelanin, substantia nigra and putamen of human brain. J Neurochem 62: 1097–1101.[Medline]

This article has been cited by other articles: