JPET Assistant Professor of Medicine (Clinician-Educator)

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Journal of Pharmacology And Experimental Therapeutics Fast Forward
First published on November 3, 2004; DOI: 10.1124/jpet.104.078113


0022-3565/05/3123-1020-1026$20.00
JPET 312:1020-1026, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.104.078113v1
312/3/1020    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Semple, S. C.
Right arrow Articles by Hope, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Semple, S. C.
Right arrow Articles by Hope, M. J.

ABSORPTION, DISTRIBUTION, METABOLISM, AND EXCRETION

Immunogenicity and Rapid Blood Clearance of Liposomes Containing Polyethylene Glycol-Lipid Conjugates and Nucleic Acid

Sean C. Semple, Troy O. Harasym1, Kathy A. Clow2, Steven M. Ansell, Sandra K. Klimuk, and Michael J. Hope

Inex Pharmaceuticals Corporation, Burnaby, British Columbia, Canada

Received September 21, 2004; accepted October 29, 2004.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Polyethylene glycol (PEG) is used widely in the pharmaceutical industry to improve the pharmacokinetics and reduce the immunogenicity of therapeutic and diagnostic agents. The incorporation of lipid-conjugated PEG into liposomal drug delivery systems greatly enhances the circulation times of liposomes by providing a protective, steric barrier against interactions with plasma proteins and cells. Here we report that liposome compositions containing PEG-lipid derivatives and encapsulated antisense oligodeoxynucleotide (ODN) or plasmid DNA elicit a strong immune response that results in the rapid blood clearance of subsequent doses in mice. The magnitude of this response is sufficient to induce significant morbidity and, in some instances, mortality. This effect has been observed in several strains of mice and was independent of sequence motifs, such as immunostimulatory CpG motifs. The ODN-to-lipid ratio and ODN dose was also determined to be important, with abrogation of the response occurring at a ratio between 0.04 and 0.08 (w/w). Rapid elimination of liposome-encapsulated ODN from blood depends on the presence of PEG-lipid in the membrane because the use of nonpegylated liposomes or liposomes containing rapidly exchangeable PEG-lipid also abrogated the response. These studies have important implications for the evaluation and therapeutic use of liposomal formulations of nucleic acid, as well as the potential development of liposomal vaccines.


DNA- and RNA-based therapeutics have tremendous potential for exquisite selectivity in the management of disease, yet these agents have several properties that restrict their application as therapeutic agents, including nuclease sensitivity, rapid plasma elimination, poor intracellular delivery, and hemodynamic toxicities (Levin, 1999Go; Wang et al., 2003Go). This has prompted significant research into the development of delivery technologies for this class of drugs. Long-circulating, sterically stabilized liposomes (SSL) containing amphipathic polyethylene glycol (PEG) have been used extensively over the past decade to improve the circulation lifetime of lipid vesicles and entrapped therapeutic agents, provide a steric barrier against interactions with plasma proteins and opsonins, improve disease-site delivery of therapeutic and diagnostic agents, and reduce liposome uptake by mononuclear cells of the reticuloendothelial system (Allen and Hansen, 1991Go; Senior et al., 1991Go; Boerman et al., 1997Go; Lasic et al., 1999Go). In this regard, SSL have been used in oncology (Goren and Gabizon, 1998Go; Lasic et al., 1999Go), antimicrobial (Bakker-Woudenberg and van Etten, 1998Go), and radiodiagnostic applications (Boerman et al., 1997Go; Goins et al., 1998Go). As such, this type of delivery system is a natural candidate to enhance the pharmacokinetic and pharmacodynamic properties of DNA- and RNA-based therapeutics (Lasic et al., 1999Go).

In the absence of encapsulated or surface-coupled proteins, SSL and other nonviral lipid delivery systems are generally considered to be nonimmunogenic (van Rooijen and van Nieuwmegen, 1980Go; Alving, 1992Go; Harding et al., 1997Go). The immunogenicity and rapid plasma elimination of protein-coupled liposomal systems after repeat injections have been well documented (Aragnol and Leserman, 1986Go; Phillips and Emili, 1991Go; Phillips and Dahman, 1995Go; Harding et al., 1997Go; Tardi et al., 1997Go) and typically result from antibody-mediated recognition of protein. T cell-independent antibody responses to liposomal glycolipid antigens such as ganglioside GM1 have also been described (Freimer et al., 1993Go). These responses were characterized by elevations in antibody production primarily of the IgM class, with antibody recognition directed against the carbohydrate portion of the ganglioside.

Nonmethylated bacterial DNA and synthetic oligodeoxynucleotides (ODN) can stimulate mononuclear cells and lymphocytes in vitro and in vivo, resulting in the secretion of interleukin-6, interleukin-12, interferon-{gamma}, and IgM (Krieg, 2002Go). This effect has been primarily attributed to CpG and palindromic sequence motifs, but phosphorothioate ODN all exhibit some degree of immune stimulation in vivo (Monteith et al., 1997Go). Given the relative inefficiency of nucleic acid-based therapeutics and the likely requirement for frequent administration, we evaluated the potential immunogenicity and circulation properties of SSL containing synthetic ODN, plasmid DNA, or ribozyme on repeated injections. Liposome elimination from the circulation was used as a convenient indicator of immunogenicity in vivo. The results presented in this study indicate that the presence of encapsulated nucleic acid in lipid vesicles containing surface-associated PEG stimulates an immune response against the carrier, irrespective of sequence motifs or DNA chemistry, and induces morbidity and rapid plasma elimination of subsequent administrations. The data further demonstrate that this response is directed specifically against the PEG-lipid.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Mice. Female 7- to 8-week-old ICR, C57BL/6, and BALB/c mice were obtained from Harlan (Indianapolis, IN). BALB/c nu/nu and BALB/c SCID-Rag2 mice were obtained from The Jackson Laboratory (Bar Harbor, ME) and maintained under pathogen-free conditions. All animals were quarantined for at least 1 week prior to use. All procedures involving animals were performed in accordance with the guidelines established by the Canadian Council on Animal Care.

Chemicals and Lipids. Distearoylphosphatidylcholine (DSPC), polyethylene glycol-conjugated distearoylphosphatidylethanolamine (PEG2000-DSPE) and 1,2-dioleoyl-3-N,N-dimethylammoniumpropane (DODAP) were purchased from Avanti Polar Lipids (Alabaster, AL). Cholesterol (CH) was purchased from Sigma-Aldrich (St. Louis, MO). Biotin-X-DSPE and biotin-PEG2000-DSPE were purchased from Northern Lipids (Vancouver, BC, Canada). PEG-CerC14 and PEG-CerC20 were synthesized and purified as described previously (Wheeler et al., 1999Go). [3H]Cholesteryl hexadecyl ether (CHE) was obtained from PerkinElmer Life and Analytical Sciences (Boston, MA).

ODN and Plasmid DNA. The designations and 5' to 3' sequences of the ODN used in these studies were as follows: hICAM, GCCCAAGCTGGCATCCGTCA (3'-untranslated region of human ICAM-1 mRNA); mICAM, TGCATCCCCCAGGCCACCAT (3'-untranslated region of murine ICAM-1 mRNA); EGFR, CCGTGGTCATGCTCC (human epidermal growth factor mRNA, receptor-translation termination codon region); c-myc, TAACGTTGAGGGGCAT (initiation codon region of human/mouse c-myc proto-oncogene mRNA; and c-mycC, TAAGCATACGGGGTGT (c-myc scrambled control). Phosphodiester (PO) and phosphorothioate (PS) ODN were purchased from Hybridon Specialty Products (Milford, MA). The backbone composition was confirmed by 31P NMR. All ODN were analyzed for endotoxin by the manufacturer and contained less than 0.05 endotoxin units/mg. Plasmid DNA (pCM-VLuc) was produced in Escherichia coli, isolated, and purified as described previously (Wheeler et al., 1999Go).

Encapsulation of ODN. Stabilized antisense-lipid particles (SALP) composed of DSPC/CH/DODAP/PEG-CerC14 or PEG-CerC20 (molar ratio, 25:45:20:10) and encapsulated PS ODN were prepared as described previously (Semple et al., 2000Go). For PS ODN, 300 mM citrate buffer was used to dissolve the antisense, whereas 20 mM citrate, pH 4.0 was used for PO ODN and plasmid formulations. The lower citrate concentration was required to facilitate efficient charge interactions between DODAP and the PO ODN or plasmid, resulting in optimal encapsulation efficiencies (Stuart et al., 2004Go). At higher citrate concentrations, these charge interactions are presumably shielded, and significant reductions in encapsulation efficiencies are observed. Phosphorothioate-modified ODN bind strongly to cationic molecules, and encapsulation efficiencies are much less sensitive to differences in buffer and salt concentrations (Stuart et al., 2004Go). Plasmid formulations were not extruded, resulting in ~200-nm particles. DSPC/CH (molar ratio, 55:45) and DSPC/CH/PEG2000-DSPE (molar ratio, 50:45:5) vesicles were prepared from dry lipid films by aqueous hydration in HBS (20 mM Hepes and 145 mM NaCl, pH 7.4). Similarly, ODN encapsulation was achieved by hydration of 100 mg of lipid with 100 mg of ODN in 1.0 ml HBS, followed by five cycles of freeze-thawing and extrusion through two stacked 100-nm filters (Semple et al., 2000Go). The resulting particles were approximately 110 to 140 nm in diameter, as judged by quasi-elastic light scattering using a model 370 NICOMP submicron particle sizer (Particle Sizing Systems, Santa Barbara, CA). [3H]CHE, a nonexchangeable, nonmetabolizable lipid marker, was incorporated into all vesicle compositions to monitor lipid levels in the blood (Stein et al., 1980Go).

Liposome Elimination from the Circulation. Mice received a single intravenous (lateral tail vein) dose of empty liposomes (50 mg/kg lipid) or liposome-encapsulated ODN (50 mg/kg lipid and 10 mg/kg ODN, unless otherwise specified) containing [3H]CHE (~1 µCi/mouse). Dosing occurred weekly unless otherwise noted. Blood (25 µl) was collected 1 h postinjection by tail nicking unanesthetized mice, using a sterile scalpel (tails were wiped with 70% ethanol prior to nicking), and placed in 200 µl of 5% EDTA. The blood was then digested (SOLVABLE, PerkinElmer Life and Analytical Sciences), decolorized and analyzed for radioactivity according to the manufacturer's instructions. The tail nicking procedure allowed all repeat-injection data to be collected from the same group of animals. A comparison of this procedure with blood (~0.5 ml) collected weekly by terminal cardiac puncture on anesthetized (ketamine/xylazine) mice produced equivalent results.

ELISA. Groups of mice (n = 20 initially) were injected weekly (i.v.) with SALP (PEG-CerC20) containing c-myc ODN or empty liposomes of the same lipid composition. One week after each injection, a subgroup of animals (n = 5) was anesthetized (ketamine/xylazine), blood was collected from each animal by cardiac puncture (~0.5 ml), and the animals were subsequently euthanized. Plasma was collected for each animal after centrifuging the blood for 15 min at 1200g in a refrigerated centrifuge (4°C). Individual plasma samples were pooled (n = 5), and serial dilutions were analyzed by ELISA as described below. The results are expressed for the 1:800 plasma dilution, which was the lowest dilution that exhibited minimal nonspecific binding to control wells.

The presence of liposome-reactive antibody was evaluated by ELISA using biotinylated liposomes bound to streptavidin-coated microplates. Liposome formulations bound to microtiter plates included: DSPC/CH/DODAP/PEG-CerC20/biotin-PEG2000-DSPE (molar ratio, 24.5:45:25:5:0.5), DSPC/CH/biotin-X-DSPE (molar ratio, 54.5:45:0.5), and DSPC/CH/PEG2000-DSPE/biotin-PEG2000-DSPE (molar ratio, 49.5:45:5:0.5). Biotinylated liposomes (10 nmol of total lipid/well) were incubated overnight at 4°C in clear SILENUS streptavidin-coated microwell plates (Chemicon International, Temecula, CA). Plates were washed, blocked with phosphate-buffered saline containing 3% bovine serum albumin and 0.1% Tween 20, and subsequently incubated with serial dilutions of plasma from PEG-liposome (containing entrapped ODN)-treated animals for 1 h at room temperature. Following multiple washes with phosphate-buffered saline/0.1% Tween 20, IgM binding was evaluated by incubation with horseradish peroxidase-conjugated rat anti-mouse IgM monoclonal antibody (1:1000 dilution; BD Biosciences PharMingen, San Diego, CA). The plates were washed and subsequently incubated with 3,3',5,5'-tetramethylbenzidine substrate (Sigma-Aldrich) and read at 450 nm.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Blood Levels of PEG Liposomes Containing Encapsulated ODN. We have recently developed and characterized a novel lipid formulation that can encapsulate antisense ODN in the aqueous space of lipid vesicles with high encapsulation efficiency and ODN-to-lipid ratios (Semple et al., 2000Go). This formulation contains a PEG-ceramide lipid coating that is required for the formulation step, and we have therefore called these vesicles SALP. Previous studies have shown that liposomes containing PEG covalently coupled to ceramide derivatives with 20 carbon acyl chains, a relatively nonexchangeable lipid anchor, have circulation profiles indistinguishable from the same liposome compositions containing PEG2000-DSPE, the most commonly used PEG-lipid anchor (Harding et al., 1997Go; Woodle, 1998Go; Semple et al., 2000Go). Typically, these formulations are long-circulating, with 75 to 95% and 30 to 40% of the administered dose expected to remain in the circulation at 1 and 24 h, respectively. Thus, we initially compared the repeat dosing pharmacokinetics (PK) of SALP to various lipid formulations of antisense ODN, including traditional long-circulating, SSL, and DSPC/CH liposomes.

For liposomes and lipid-based delivery systems, monitoring the circulation properties of repeated injections is a convenient surrogate measure of carrier immunogenicity since this parameter is invariably altered by an immune response (Aragnol and Leserman, 1986Go; Phillips and Emili, 1991Go; Harding et al., 1997Go; Tardi et al., 1997Go; Goins et al., 1998Go). To evaluate the impact of repeated administrations on the circulation times of PEG liposomes containing hICAM ODN, the blood levels of DSPC/CH/PEG2000-DSPE liposomes or SALP (PEG-CerC20) were evaluated 1 h postinjection after weekly intravenous administrations. As expected, no differences in elimination were observed for empty vesicles over several administrations (Fig. 1a). Surprisingly, rapid elimination (<20% of the injected dose remained in the blood at 1 h) of ODN-containing vesicles was observed following the second and subsequent injections. This effect was accompanied by pronounced morbidity and, in some instances, resulted in death of the animal within 30 min postinjection. This rapid elimination phenomenon with PEG liposomes and ODN was observed in several strains of mice, including outbred ICR mice and inbred BALB/c and C57BL/6 strains (results not shown). To determine whether an immune component was involved in this response, these same studies were performed in T cell-deficient BALB/c nude mice and B and T cell-deficient BALB/c SCID-Rag2 mice. A rapid elimination response was observed in BALB/c nude mice (Fig. 1b) but not in BALB/c SCID-Rag2 mice (Fig. 1c), suggesting that the response depends on the presence of B cells and immunoglobulin.



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 1. Circulation levels of PEG liposomes on repeat administrations in immune-competent BALB/c mice (a), and immune-compromised BALB/c nude (b) and BALB/c SCID-Rag2 mice (c). Mice were injected i.v. with empty DSPC/CH/PEG2000-DSPE liposomes, DSPC/CH/PEG2000-DSPE liposomes containing hICAM PS ODN, empty SALP (PEG-CerC20), or SALP (PEG-CerC20) containing hICAM ODN. Lipid doses were 50 mg/kg. The ODN/lipid ratios for the DSPC/CH/PEG2000-DSPE and SALP (PEG-CerC20) were 0.058 and 0.20, respectively. Injections were administered weekly, and the circulation levels at 1 h postinjection were monitored by the lipid label [3H]CHE. The bars represent the first (open bars), second (back slash), third (forward slash), and fourth (cross-hatched) injection. All bars represent the mean and standard deviation of eight mice.

 

Influence of Nucleic Acid Composition on Clearance of PEG Liposomes. Since it has been shown that PS ODN containing CpG or G-quartet sequence motifs can exhibit immunostimulatory and/or nonantisense effects (Stein and Krieg, 1997Go), the influence of oligonucleotide sequence was evaluated by encapsulating a variety of PS ODN in SALP (PEG-CerC20). Interestingly, all PS ODN encapsulated in SALP (PEG-CerC20) induced morbidity in mice and were rapidly removed from the circulation on repeat administrations (Fig. 2a). This was also observed for ODN that did not contain CpG or G-quartet motifs (mICAM) or contained CpG only (hICAM and EGFR), CpG and G-quartet (c-myc), or G-quartet only (c-mycC).



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2. Influence of nucleic acid sequence (a) and structure (b) on blood clearance of SALP (PEG-CerC20). ICR mice were injected i.v. with SALP (PEG-CerC20) containing PS ODN of various nucleotide sequences (a). PO hICAM ODN and bacterial plasmid DNA were also evaluated (b). The lipid dose was adjusted to 50 mg/kg, and the ODN/lipid ratio for each formulation was ~0.20. Injections were administered weekly, and the circulation levels at 1 h postinjection were monitored by the lipid label [3H]CHE. The bars and numbers of animals are indicated in the legend to Fig. 1.

 

Having demonstrated sequence independence of the rapid elimination phenomenon, the dependence on nucleic acid chemistry and structure was evaluated. PS or PO ODN, ribozyme, or plasmid DNA was encapsulated in the SALP (PEG-CerC20) lipid formulation, and the circulation levels at 1 h postinjection were monitored after weekly injections (Fig. 2b). Rapid elimination of the carrier was observed on the second and subsequent injections, indicating that closed circular, double-stranded DNA was as effective at inducing the rapid elimination as ODN with free 5' and 3' ends. Similarly, the more nuclease-sensitive PO ODN also induced an immunogenic response, as did ribozyme (results not shown).

Impact of Antisense/Lipid Ratio and Dose Schedules. In Fig. 1, the magnitude of blood clearance for DSPC/CH/PEG2000-DSPE vesicles containing encapsulated ODN was less pronounced than for SALP (PEG-CerC20). The major difference between these two formulations was the encapsulation procedure and the resulting ODN-to-lipid ratio. To test whether the amount of encapsulated ODN influences the generation of the immune response, ODN was encapsulated in SALP (PEG-CerC20) at different ODN/lipid ratios, and the circulating level of vesicles was monitored after weekly injections of 50 mg/kg lipid. Interestingly, at ODN/lipid ratios less than 0.04 (w/w), no apparent changes in elimination were observed, whereas marked decreases in circulation levels were observed at ratios greater than 0.08 (w/w) (Fig. 3a). Since the lipid dose was constant in these studies, the ODN-to-lipid ratio and/or the total ODN dose administered significantly impact the initiation of this response.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 3. Factors influencing the onset of rapid clearance of PEG liposomes containing nucleic acid. The influence of the DNA-to-lipid ratio (a) and dosing schedule (b) were evaluated in ICR mice. For the DNA-to-lipid ratio study, mice were injected weekly (i.v.) with SALP (PEG-CerC20) containing hICAM PS ODN at various ODN/lipid ratios. The bars and numbers of animals are indicated in the legend to Fig. 1. In the dose schedule study, mice were injected i.v. with SALP (PEG-CerC20) containing hICAM PS ODN at various dosing schedules: daily ({circ}), every 2 days ({bullet}), every 3 days ({square}), and weekly ({blacksquare}). In both studies, the lipid dose was adjusted to 50 mg/kg/dose, and circulation levels at 1 h postinjection were monitored by the lipid label [3H]CHE.

 

Standard dosing schedules for antisense ODN therapies typically involve repeated injections or infusions. The relevance of the dosing schedule on circulating levels of SALP (PEG-CerC20) was examined by injecting mice daily or every 2, 3, or 7 days. Liposome levels in the blood were evaluated 1 h after each injection (Fig. 3b). For daily injections, the plasma levels of circulating carrier increased over the first three injections, which was not surprising given that 30 to 40% of a given dose of PEG-coated liposomes remains in the circulation 24 h postinjection (Allen and Hansen, 1991Go; Harding et al., 1997Go; Woodle, 1998Go; Semple et al., 2000Go); however, this increase was followed by a dramatic decline in the circulation levels of subsequent doses. In all dosing schedules, rapid elimination of subsequent doses was observed beginning 4 to 6 days after the initial dose and was maintained for at least 50 days.

PEG-Lipid Involvement in the Response. To evaluate the importance of PEG-lipid on the generation of the immune response observed in Fig. 1, PS ODN was encapsulated in 100-nm DSPC/CH vesicles or in SALP containing PEG-CerC14. The CerC14 lipid anchor has shorter acyl chains than PEG-CerC20 and exchanges more rapidly out of the lipid bilayer (t1/2, ~1.1 h in vitro) (Wheeler et al., 1999Go). No differences in the circulation levels of these vesicles, whether empty or containing encapsulated ODN, were observed on repeated administrations (Fig. 4a). This was in striking contrast to SALP (PEG-CerC20), which was rapidly eliminated after a second injection. PEG-CerC14 exchanged out of the carrier immediately after injection, with greater than 50% loss of PEG-lipid in approximately 3 min (Fig. 4b). This same level was not achieved for PEG-CerC20 until 24 h. Since neither empty DSPC/CH vesicles nor SALP containing rapidly exchangeable PEG-lipid exhibited any differences in circulation levels on repeat administrations, we conclude that the presence of PEG-lipid in the external monolayer of the vesicles was critical for the rapid elimination of the carrier from the circulation.



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 4. Role of PEG-lipid in the rapid elimination of liposomes containing ODN. Panel a, mice injected i.v. with empty SALP (PEG-CerC20) (a), SALP (PEG-CerC20) (b), empty SALP (PEG-CerC14) (c), SALP (PEG-CerC14) (d), empty DSPC/CH liposomes (e), or DSPC/CH containing hI-CAM PS ODN [ODN-to-lipid ratio, 0.081, (w/w)] (f). The lipid dose was adjusted to 50 mg/kg/dose, and the circulation levels at 1 h postinjection were monitored by the lipid label [3H]CHE. The bars and numbers of animals are indicated in the legend to Fig. 1. Panel b, time course for exchange of PEG-CerC20 ({bullet}) and PEG-CerC14 ({circ}) evaluated by monitoring the ratio of [3H]PEG-ceramide to [14C]CHE in the plasma of mice over 24 h. The symbols represent the mean and standard deviation of six mice.

 

The role of PEG-lipid was further examined in crossover studies in which mice were sensitized with weekly injections (total of four) of SALP containing PEG-CerC20 and encapsulated ODN. This was followed with a fifth injection of empty vesicles of varying compositions. Crossover injections of empty DSPC/CH/PEG-CerC20 or DSPC/CH/PEG2000-DSPE vesicles were rapidly eliminated from the circulation, whereas crossover injections of DSPC/CH vesicles or SALP containing PEG-CerC14 exhibited prolonged circulation times (Fig. 5). The rapid clearance of DSPC/CH/PEG2000-DSPE vesicles from the circulation indicates that the PEG moiety, and not the lipid anchor, was the critical component recognized in this response. Similarly, the use of empty vesicles that had never been exposed to ODN indicates that potential residual surface-associated ODN was not responsible for mediating elimination. Similar results were observed in crossover studies in which, instead of SALP (PEG-CerC20), mice were pretreated with DSPC/CH/PEG2000-DSPE liposomes containing encapsulated ODN (results not shown).



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 5. Crossover studies in presensitized mice. Mice were injected i.v. with SALP (PEG-CerC20) for a total of four weekly injections. In a subsequent, final injection, mice received either SALP (PEG-CerC20), empty SALP (PEG-CerC20), empty SALP (PEG-CerC14), empty DSPC/CH/PEG2000-DSPE vesicles, or empty DSPC/CH liposomes. In each instance, the lipid dose was 50 mg/kg/dose, and the circulation levels at 1 h postinjection were monitored by the lipid label [3H]CHE. Each bar represents the mean and standard deviation of eight mice.

 

In a final set of studies designed to evaluate the presence of liposome-reactive antibody in the blood, mice were treated four times (weekly injections) with SALP (PEG-CerC20) or empty DSPC/CH/DODAP/PEG-CerC20 liposomes, and the pooled plasma of these animals was examined by ELISA using various biotinylated liposomes bound to streptavidin-coated microplates. When the pooled plasma from each group of mice was incubated with plates containing DSPC/CH/DODAP/PEG-CerC20 or DSPC/CH/PEG2000-DSPE, increases in liposome-reactive IgM were observed 1 week following the first injection and generally increased over the four injections (Fig. 6). However, when the same plasma was incubated in plates containing DSPC/CH (i.e., no PEG-lipid), very minimal IgM binding was observed, indicating the involvement of antibody in the clearance of PEG-liposomes containing ODN, as well as providing additional confirmation that the response is directed against PEG and not the other lipids comprising the formulation. The plasma from mice treated with empty PEG liposomes showed negligible reactivity in any of the plates.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 6. IgM binding to pegylated liposomes. Groups of mice (n = 5) were injected weekly (i.v.) with SALP (PEG-CerC20) containing c-myc ODN or empty liposomes of the same lipid composition. One week after each injection, mice were bled, plasma was collected and pooled, and serial dilutions were subsequently analyzed on different microtiter plates as described under Materials and Methods. Each plate contained a different liposome formulation (indicated in each panel) bound to the wells through biotin-streptavidin interactions. The results are expressed for the 1:800 plasma dilution. The results for mice injected with empty liposomes are presented for the fourth and final injection.

 


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The majority of efficacy studies that use antisense oligonucleotides have required repeated dosing to observe biological activity in animal models. This is principally necessitated by the rapid plasma elimination of polyanionic DNA and minimal antisense ODN delivery to the disease site. To increase the disease site delivery of antisense ODN, we chose to evaluate pegylated lipid-based formulations of antisense ODN. Interestingly, we found that repeated injections of PEG liposomes containing ODN, plasmid DNA, or ribozyme induced a potent immunogenic response that resulted in both the removal of the carrier from the circulation and pronounced morbidity in mice.

An immune component of this response was verified using immune-compromised BALB/c nude mice, where rapid blood clearance was observed, and in BALB/c SCID-Rag2 mice, in which normal blood clearance was observed on repeat dosing. The rapid elimination phenomenon and adverse clinical signs in mice were not observed when ODN was encapsulated in PEG-free liposomes or in liposomes containing rapidly exchangeable PEG-CerC14. Several previous studies have demonstrated an apparent absence of immunogenicity or altered PK upon repeated administration of empty PEG liposomes (Harding et al., 1997Go; Woodle, 1998Go; Oussoren and Storm, 1999Go), PEG liposomes containing technetium-99m (Goins et al., 1998Go), or encapsulated doxorubicin (Tardi et al., 1997Go). Although humoral immune responses against liposomes have been described for protein-coupled PEG liposomes, these responses are directed against the surface-bound protein (Phillips and Emili, 1991Go; Phillips and Dahman, 1995Go; Harding et al., 1997Go; Tardi et al., 1997Go).

Recently, a limited number of studies have demonstrated changes in the PK of repeated injections of PEG liposomes under certain time and dosing conditions in rats and a rhesus monkey (Dams et al., 2000Go; Laverman et al., 2001Go). Enhanced blood clearance of repeated doses of technetium-99m-PEG liposomes occurred when the second injection was administered between 5 days and 4 weeks after the initial injection (Goins et al., 1998Go; Oussoren and Storm, 1999Go; Dams et al., 2000Go). Moreover, PK changes were only observed when the doses were relatively low (<15 µmol/kg) (Laverman et al., 2001Go). Ishida et al. (2003Go) have demonstrated the changes in the PK behavior of SSL in mice when a second dose (25 µmol/kg phospholipid) was given between 7 and 14 days after the initial dose. Our results differ from that study in that our injected lipid doses were much higher (~65–72 µmol/kg) and the magnitude of the clearance response was much greater; moreover, pronounced morbidity was observed on repeat injections of SSL containing high levels of DNA, which has not been reported previously. Dams et al. (2000Go) have suggested that a 150-kDa nonantibody-soluble serum factor mediates the rapid clearance phenomenon in rats and monkeys, whereas our data in immunocompromised mice, as well as the IgM studies, strongly suggest an antibody response.

Whereas the mechanism of the immune response and the cell populations that facilitate it have not yet been fully elucidated, the studies involving nude and SCID-Rag2 mice suggest that B cells and immunoglobulin, and not T cells, are critical. Immunecompetent and nude mice that were injected repeatedly with PEG liposomes containing ODN showed signs of morbidity and difficulty bleeding and, in extreme cases, exhibited rapid breathing and seizures. These symptoms are typical of a shock response and could be generated through a number of mechanisms. The delivery of bacterial DNA and synthetic oligonucleotides to macrophages and monocytes can result in acute cytokine release and tumor necrosis factor-{alpha}-mediated lethal shock in mice (Sparwasser et al., 1997Go). In our study, clinical signs only developed with repeat injections and were associated with rapid removal of the carrier from the blood, suggesting a humoral response. IgM responses typically occur 3 to 7 days after antigen exposure, which was consistent with the onset of the immunogenic response observed here (Fig. 3b). In this regard, increases in PEG-reactive plasma IgM were observed in mice treated repeatedly with PEG liposomes containing ODN. IgM-antibodies against the glycolipid ganglioside GM1 are common in patients with neuropathy and have been shown to result in strong complement-mediated lysis of GM1-containing liposomes (Mitzutamari et al., 1998Go). The generation of antibody and putative complement activation are a likely explanation for the rapid elimination of the vesicles from the blood. IgG, IgM, and iC3b are prominent opsonins associated with liposome formulations that exhibit rapid plasma clearance (Chonn et al., 1992Go).

That the presence of encapsulated ODN in PEG liposomes could potentially stimulate the production of antibodies is perhaps not surprising. Some phosphorothioate antisense ODN and bacterial DNA have been shown to have strong mitogenic properties in vitro, resulting in lymphocyte proliferation and production of IgM (Krieg, 2002Go). These same ODN produced splenomegaly and increased cellularity/activation in vivo (Monteith et al., 1997Go). That the presence of encapsulated DNA could stimulate the production of antibody to the PEG-lipid is of considerable interest in this study. As evidenced by a lack of detectable elimination or IgM directed against empty PEG liposomes in mice upon repeated administration, PEG-lipid itself is a very weak antigen (Harding et al., 1997Go) and is used widely in the pharmaceutical industry to improve the PK and reduce the immunogenicity of various therapeutic or diagnostic agents (Harris et al., 2001Go). Antibody responses against PEG have been described in mice and rabbits when PEG was coupled to certain protein antigens; however, the responses were relatively minor unless the PEG or PEG-protein conjugate was coadministered with a strong adjuvant such as Freund's complete adjuvant (Richter and Akerblom, 1983Go; Richter and Akerblom, 1984Go; Cheng et al., 1999Go). ODN containing CpG motifs have been shown to act as potent adjuvants for the production of antibody to coadministered T cell-dependent protein antigens (Weiner et al., 1997Go). We did not observe any sequence or chemistry dependence when DNA or RNA was encapsulated in the carrier, suggesting that the adjuvant effect is a general phenomenon of nucleic acid encapsulation in lipid vesicles. Thus, the presence of liposome encapsulated ODN or DNA may function as a novel adjuvant system for the generation of immune responses to weak T cell-independent antigens, such as carbohydrates and glycolipids.

The studies reported herein have significant implications for the use of SSL in the therapeutic evaluation of DNA-based drugs. Nonviral, lipid-based delivery systems are generally thought to be nonimmunogenic with respect to the components of the carrier, but to our knowledge, no studies have actually addressed this with DNA-based delivery systems. Several recent studies have demonstrated that innate and adaptive immune responses can be enhanced through encapsulation of immunostimulatory DNA in lipid-based delivery vehicles (Li et al., 2001Go; Mui et al., 2001Go; Whitmore et al., 2001Go), increasing the importance of evaluating carrier-directed effects. SSL are known to have an enhanced ability to accumulate at sites of infection, inflammation, and tumors (Boerman et al., 1997Go; Woodle, 1998Go; Lasic et al., 1999Go; Semple et al., 2000Go). However, based on the results observed in Fig. 3b, the accumulation of later injections in sites of disease will be significantly impaired within days. Finally, we have demonstrated that the removal of PEG-lipid from liposomes containing encapsulated DNA abrogates the immunogenic response, thereby indicating that SSL need to be used with caution for applications involving DNA- and RNA-based therapeutics.


    Footnotes
 
doi:10.1124/jpet.104.078113.

ABBREVIATIONS: SSL, sterically stabilized liposomes; PEG, polyethylene glycol; ODN, oligodeoxynucleotide(s); SCID, severe-combined immunodeficient; DSPC, distearoylphosphatidylcholine; DSPE, distearoylphosphatidylethanolamine; DODAP, 1,2-dioleoyl-3-N,N-dimethylammonium-propane; CH, cholesterol; biotin X-DSPE, N-[((6-biotinoyl)amino)hexanoyl]-1,2-distearoyl-sn-glycero-3-phosphoethanolamine; biotin-PEG2000-DSPE, N-[{omega}-biotinoylamino (polyethylene glycol)2000]-1,2-distearoyl-sn-glycero-3-phosphoethanolamine; PEG-CerC14, 1-O-(2'-({omega}-methoxypolyethyleneglycol)succinoyl)-2-N-myristoylsphingosine; PEG-CerC20, 1-O-[2'-({omega}-methoxypolyethyleneglycol)succinoyl]-2-N-arachidoylsphingosine; CHE, cholesteryl hexadecyl ether; ICAM, intercellular adhesion molecule; PO, phosphodiester; PS, phosphorothioate; SALP, stabilized antisense-lipid particle(s); ELISA, enzyme-linked immunosorbent assay; PK, pharmacokinetic(s).

1 Current address: Celator Technologies Inc., Vancouver, BC, Canada. Back

2 Current address: Memorial University of Newfoundland, St John's, NF, Canada. Back

Address correspondence to: Sean C. Semple, Inex Pharmaceuticals Corporation, 100-8900 Glenlyon Parkway, Burnaby, BC, Canada, V5J 5J8. E-mail: ssemple{at}inexpharm.com


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

Allen TM and Hansen C (1991) Pharmacokinetics of stealth versus conventional liposomes: effect of dose. Biochim Biophys Acta 1068: 133–141.[Medline]

Alving CR (1992) Immunologic aspects of liposomes: presentation and processing of liposomal protein and phospholipid antigens. Biochim Biophys Acta 1113: 307–322.[Medline]

Aragnol D and Leserman LD (1986) Immune clearance of liposomes inhibited by an anti-Fc receptor antibody in vivo. Proc Natl Acad Sci USA 83: 2699–2703.[Abstract/Free Full Text]

Bakker-Woudenberg IAJM and van Etten EWM (1998) Medical Applications of Liposomes (Lasic DD and Papahadjopoulos D eds) pp 181–188, Elsevier Science B.V., Amsterdam.

Boerman OC, Oyen WJ, van Bloois L, Koenders EB, van der Meer JW, Corstens FH, and Storm G (1997) Optimization of technetium-99m-labeled PEG liposomes to image focal infection: effects of particle size and circulation time. J Nucl Med 38: 489–493.[Abstract/Free Full Text]

Cheng TL, Wu PY, Wu MF, Chern JW, and Roffler SR (1999) Accelerated clearance of polyethylene glycol-modified proteins by anti-polyethylene glycol IgM. Bioconjug Chem 10: 520–528.[CrossRef][Medline]

Chonn A, Semple SC, and Cullis PR (1992) Association of blood proteins with large unilamellar liposomes in vivo. Relation to circulation lifetimes. J Biol Chem 267: 18759–18765.[Abstract/Free Full Text]

Dams ET, Laverman P, Oyen WJ, Storm G, Scherphof GL, van Der Meer JW, Corstens FH, and Boerman OC (2000) Accelerated blood clearance and altered biodistribution of repeated injections of sterically stabilized liposomes. J Pharmacol Exp Ther 292: 1071–1079.[Abstract/Free Full Text]

Freimer ML, McIntosh K, Adams RA, Alving CR, and Drachman DB (1993) Gangliosides elicit a T-cell independent antibody response. J Autoimmun 6: 281–289.[CrossRef][Medline]

Goins B, Phillips WT, and Klipper R (1998) Repeat injection studies of technetium-99m-labeled PEG-liposomes in the same animal. J Liposome Res 8: 265–281.

Goren D and Gabizon A (1998) Medical Applications of Liposomes (Lasic DD and Papahadjopoulos D eds) pp 259–274, Elsevier Science B.V., Amsterdam.

Harding JA, Engbers CM, Newman MS, Goldstein NI, and Zalipsky S (1997) Immunogenicity and pharmacokinetic attributes of poly(ethylene glycol)-grafted immunoliposomes. Biochim Biophys Acta 1327: 181–192.[Medline]

Harris JM, Martin NE, and Modi M (2001) Pegylation: a novel process for modifying pharmacokinetics. Clin Pharmacokinet 40: 539–551.[CrossRef][Medline]

Ishida T, Masuda K, Ichikawa T, Ichihara M, Irimura K, and Kiwada H (2003) Accelerated clearance of a second injection of PEGylated liposomes in mice. Int J Pharm 255: 167–174.[CrossRef][Medline]

Krieg AM (2002) CpG motifs in bacterial DNA and their immune effects. Annu Rev Immunol 20: 709–760.[CrossRef][Medline]

Lasic DD, Vallner JJ, and Working PK (1999) Sterically stabilized liposomes in cancer therapy and gene delivery. Curr Opin Mol Ther 1: 177–185.[Medline]

Laverman P, Carstens MG, Boerman OC, Dams ET, Oyen WJ, van Rooijen N, Corstens FH, and Storm G (2001) Factors affecting the accelerated blood clearance of polyethylene glycol-liposomes upon repeated injection. J Pharmacol Exp Ther 298: 607–612.[Abstract/Free Full Text]

Levin AA (1999) A review of the issues in the pharmacokinetics and toxicology of phosphorothioate antisense oligonucleotides. Biochim Biophys Acta 1489: 69–84.[Medline]

Li WM, Bally MB, and Schutze-Redelmeier MP (2001) Enhanced immune response to T-independent antigen by using CpG oligodeoxynucleotides encapsulated in liposomes. Vaccine 20: 148–157.[CrossRef][Medline]

Mitzutamari RK, Kremer LJ, Basile EA, and Nores GA (1998) Anti-GM1 ganglioside IgM-antibodies present in human plasma: affinity and biological activity changes in a patient with neuropathy. J Neurosci Res 51: 237–242.[CrossRef][Medline]

Monteith DK, Henry SP, Howard RB, Flournoy S, Levin AA, Bennett CF, and Crooke ST (1997) Immune stimulation–a class effect of phosphorothioate oligodeoxynucleotides in rodents. Anticancer Drug Des 12: 421–432.[Medline]

Mui B, Raney SG, Semple SC, and Hope MJ (2001) Immune stimulation by a CpG-containing oligodeoxynucleotide is enhanced when encapsulated and delivered in lipid particles. J Pharmacol Exp Ther 298: 1185–1192.[Abstract/Free Full Text]

Oussoren C and Storm G (1999) Effect of repeated intravenous administration on the circulation kinetics of poly(ethyleneglycol)-liposomes in rats. J Liposome Res 9: 349–355.

Phillips NC and Dahman J (1995) Immunogenicity of immunoliposomes: reactivity against species-specific IgG and liposomal phospholipids. Immunol Lett 45: 149–152.[CrossRef][Medline]

Phillips NC and Emili A (1991) Immunogenicity of immunoliposomes. Immunol Lett 30: 291–296.[CrossRef][Medline]

Richter AW and Akerblom E (1983) Antibodies against polyethylene glycol produced in animals by immunization with monomethoxy polyethylene glycol modified proteins. Int Arch Allergy Appl Immunol 70: 124–131.[Medline]

Richter AW and Akerblom E (1984) Polyethylene glycol reactive antibodies in man: titer distribution in allergic patients treated with monomethoxy polyethylene glycol modified allergens or placebo and in healthy blood donors. Int Arch Allergy Appl Immunol 74: 36–39.[Medline]

Semple SC, Klimuk SK, Harasym TO, and Hope MJ (2000) Lipid-based formulations of antisense oligonucleotides for systemic delivery applications. Methods Enzymol 313: 322–341.[Medline]

Senior J, Delgado C, Fisher D, Tilcock C, and Gregoriadis G (1991) Influence of surface hydrophilicity of liposomes on their interaction with plasma protein and clearance from the circulation: studies with poly(ethylene glycol)-coated vesicles. Biochim Biophys Acta 1062: 77–82.[Medline]

Sparwasser T, Miethke T, Lipford G, Erdmann A, Hacker H, Heeg K, and Wagner H (1997) Macrophages sense pathogens via DNA motifs: induction of tumor necrosis factor-alpha-mediated shock. Eur J Immunol 27: 1671–1679.[Medline]

Stein CA and Krieg AM (1997) Antisense Technology: A Practical Approach (Lichtenstein C and Nellen W eds) pp 241–264, Oxford University Press, New York.

Stein Y, Halperin G, and Stein O (1980) Biological stability of [3H]cholesteryl oleyl ether in cultured fibroblasts and intact rat. FEBS Lett 111: 104–106.[CrossRef][Medline]

Stuart DD, Semple SC, and Allen TM (2004) High efficiency entrapment of antisense oligonucleotides in liposomes. Methods Enzymol 387: 171–188.[CrossRef][Medline]

Tardi PG, Swartz EN, Harasym TO, Cullis PR, and Bally MB (1997) An immune response to ovalbumin covalently coupled to liposomes is prevented when the liposomes used contain doxorubicin. J Immunol Methods 210: 137–148.[CrossRef][Medline]

van Rooijen N and van Nieuwmegen R (1980) Liposomes in immunology: multilamellar phosphatidylcholine liposomes as a simple, biodegradable and harmless adjuvant without any immunogenic activity of its own. Immunol Commun 9: 243–256.[Medline]

Wang L, Prakash RK, Stein CA, Koehn RK, and Ruffner DE (2003) Progress in the delivery of therapeutic oligonucleotides: organ/cellular distribution and targeted delivery of oligonucleotides in vivo. Antisense Nucleic Acid Drug Dev 13: 169–189.[CrossRef][Medline]

Weiner GJ, Liu HM, Wooldridge JE, Dahle CE, and Krieg AM (1997) Immunostimulatory oligodeoxynucleotides containing the CpG motif are effective as immune adjuvants in tumor antigen immunization. Proc Natl Acad Sci USA 94: 10833–10837.[Abstract/Free Full Text]

Wheeler JJ, Palmer L, Ossanlou M, MacLachlan I, Graham RW, Zhang YP, Hope MJ, Scherrer P, and Cullis PR (1999) Stabilized plasmid-lipid particles: construction and characterization. Gene Ther 6: 271–281.[CrossRef][Medline]

Whitmore MM, Li S, Falo L Jr, and Huang L (2001) Systemic administration of LPD prepared with CpG oligonucleotides inhibits the growth of established pulmonary metastases by stimulating innate and acquired antitumor immune responses. Cancer Immunol Immunother 50: 503–514.[CrossRef][Medline]

Woodle MC (1998) Controlling liposome blood clearance by surface-grafted polymers. Adv Drug Deliv Rev 32: 139–152.[CrossRef][Medline]


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
J. D. Heidel, Z. Yu, J. Y.-C. Liu, S. M. Rele, Y. Liang, R. K. Zeidan, D. J. Kornbrust, and M. E. Davis
Inaugural Article: Administration in non-human primates of escalating intravenous doses of targeted nanoparticles containing ribonucleotide reductase subunit M2 siRNA
PNAS, April 3, 2007; 104(14): 5715 - 5721.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.104.078113v1
312/3/1020    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Semple, S. C.
Right arrow Articles by Hope, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Semple, S. C.
Right arrow Articles by Hope, M. J.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition