JPET

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Journal of Pharmacology And Experimental Therapeutics Fast Forward
First published on November 3, 2004; DOI: 10.1124/jpet.104.077800


0022-3565/05/3123-1007-1019$20.00
JPET 312:1007-1019, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.104.077800v1
312/3/1007    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, L. H.
Right arrow Articles by Johnson, E. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, L. H.
Right arrow Articles by Johnson, E. M., Jr.

NEUROPHARMACOLOGY

Mixed-Lineage Kinase Inhibitors Require the Activation of Trk Receptors to Maintain Long-Term Neuronal Trophism and Survival

Leo H. Wang, Andrew J. Paden, and Eugene M. Johnson, Jr.

Departments of Neurology and Molecular Biology & Pharmacology, Washington University School of Medicine, St. Louis, Missouri

Received for publication September 13, 2004
Accepted November 1, 2004.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Small-molecule mixed-lineage kinase (MLK) inhibitors, such as CEP-1347 [3,9-bis[(ethylthio)methyl]-(8R*,9S*,11S*)-(–)-9-hydroxy-9-methoxycarbonyl-8-methyl-2,3,9,10-tetrahydro-8,11-epoxy-1H,8H, 11H-2,7b,11a-triazadibenzo(a,g)cycloocta(cde)trinden-1-one] and CEP-11004 [3,9-bis-[(isopropylthio)methyl]-(8R*,9S*,11S*)-(–)-9-hydroxy-9-methoxycarbonyl-8-methyl-2,3,9,10-tetrahydro-8,11-epoxy-1H,8H,11H-2,7b,11a-triazadibenzo(a,g)cycloocta(cde)trinden-1-one], prevent c-Jun NH2-terminal kinase (JNK) pathway activation as well as the consequent neuronal cell death in many cell culture and animal models. In the cell culture model of nerve growth factor (NGF)-deprived sympathetic neurons, we find that CEP-11004 induced a ~3-fold increase in the mRNA and protein levels of TrkA, the NGF receptor. This resulted in ligand-independent activation of the TrkA receptor and the downstream phosphatidylinositol 3-kinase (PI3-kinase) pathway. Addition of the Trk inhibitor K252a [(8R*,9S*,11S*)-(–)-9-hydroxy-9-methoxycarbonyl-8-methyl-2,3,9,10-tetrahydro-8,11-epoxy-1H,8H,11H-2,7b,11a-triazadibenzo(a,g)cycloocta(cde)-trinden-1-one] or the PI3-kinase inhibitor LY294002 [2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one] significantly decreased the protein synthesis rates, mitochondrial function, and neuronal survival maintained by CEP-11004. In contrast to sympathetic neurons, MLK inhibitors maintain only short-term survival of potassium- and serum-deprived rat cerebellar granule neurons (CGNs), despite continuous inhibition of the JNK pathway. We found that similar to sympathetic neurons, CEP-11004 increased the levels of the Trk receptor expressed in CGNs, TrkB. However, CGNs required the addition of the exogenous ligand brain-derived neurotrophic factor (BDNF) to activate the PI3-kinase pathway and to maintain long-term survival. BDNF activated TrkB, but caused rapid down-regulation of activated receptors and maintained only minimal survival. Therefore, increase in TrkB levels by CEP-11004 mediated a synergism with BDNF resulting in long-term survival in response to the combined treatment of CEP-11004 and BDNF. Taken together, our studies suggest that in addition to the direct inhibition of the JNK pathway, the indirect activation of the PI3-kinase pathway via Trk activation is important for MLK inhibitor-mediated neuronal survival and trophism.


The activation of the c-Jun NH2-terminal kinase (JNK) pathway is critical for the naturally occurring neuronal cell death in development and may be important in the pathological neuronal cell death of neurodegenerative diseases. CEP-1347 [3,9-bis[(ethylthio)methyl]-(8R*,9S*,11S*)-(–)-9-hydroxy-9-methoxycarbonyl-8-methyl-2,3,9,10-tetrahydro-8,11-epoxy-1H,8H,11H-2,7b,11a-triazadibenzo(a,g)cycloocta(cde)trinden-1-one] and CEP-11004 [3,9-bis-[(isopropylthio)methyl]-(8R*,9S*, 11S*)-(–)-9-hydroxy-9-methoxycarbonyl-8-methyl-2,3,9,10-tetrahydro-8,11-epoxy-1H,8H,11H-2,7b,11a-triazadibenzo(a,g) cycloocta(cde)trinden-1-one] are small-molecule mixed-lineage kinase (MLK) inhibitors. CEP-1347 and CEP-11004 prevent the activation of the JNK pathway and, consequently, the neuronal cell death in many cell culture and animal models (for review, see Wang et al., 2004Go). The possible importance of the JNK pathway in neurodegenerative diseases provides the rationale for the current phase II/III clinical trials of MLK inhibitors for the treatment of Parkinson's disease.

Sympathetic neurons from the postnatal rat superior cervical ganglion are a population of the peripheral nervous system that undergoes naturally occurring cell death during development. In dissociated cultures of sympathetic neurons, the withdrawal of nerve growth factor (NGF) recapitulates the cell death in vitro. The cell death is dependent on JNK pathway activation. Activation of this signaling pathway initiates the phosphorylation and induction of the transcription factor c-Jun, the induction of BH3-only proteins, the translocation of Bax from the cytosol to the mitochondria, the release of cytochrome c into the cytosol, and the activation of caspases (for review, see Chang et al., 2002Go). In addition to these biochemical changes, the withdrawal of NGF also decreases neuronal metabolism such as glucose uptake rates, mRNA and protein synthesis rates, and mitochondrial function [measured by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reduction rates]. Ultimately, the neurons die a classical apoptotic death characterized by nuclear condensation, DNA fragmentation, and loss of Nissl staining.

The cell death program in NGF-deprived sympathetic neurons is inhibited by MLK inhibitors as a direct consequence of inhibiting downstream kinases of the JNK pathway members such as MKK4, JNK, and subsequently transcription factors, such as c-Jun (Maroney et al., 1999Go; Harris et al., 2002bGo). MLK inhibitors maintain long-term neuronal survival, as well as neuronal metabolism in this model (Harris et al., 2002bGo). This maintenance of trophism is impressive, especially compared with the atrophic state of trophic factor-deprived neurons maintained by caspase inhibition or bax deletion (Deshmukh et al., 1996Go; Deckwerth et al., 1998Go).

In this current work, we show that treatment of sympathetic neurons with the MLK inhibitor CEP-11004 led to the activation of the PI3-kinase pathway, confirming previous work of Roux et al. (2002Go). We find that this activation is caused by the novel phenomenon wherein CEP-11004 increased TrkA mRNA and protein expression and instigated ligand-independent receptor activation. The use of selective pharmacological inhibitors indicated that the activation of TrkA and PI3-kinase is important in CEP-1347/CEP-11004-maintained neuronal trophism and survival.

In contrast to the maintenance of the long-term survival of dissociated sympathetic neurons deprived of trophic factors, MLK inhibitors can only maintain transient survival of trophic-deprived rat cerebellar granule neurons (CGNs), despite continued suppression of JNK pathway activation (Harris et al., 2002aGo). CGNs are a population of the central nervous system neurons that undergo naturally occurring cell death during development. In dissociated cultures, the withdrawal of serum and depolarizing concentrations of potassium causes a cell death similar to the death seen in vivo (Gallo et al., 1987Go). This cell death has classical apoptotic features and involves activation of the JNK pathway (Harris et al., 2002aGo), macromolecular synthesis (D'Mello et al., 1993Go), and the proapoptotic Bcl-2 molecule, Bax (Miller et al., 1997aGo).

We report that similar to the effect of MLK inhibition on TrkA in sympathetic neurons, MLK inhibition increased TrkB levels in CGNs; however, the induction of TrkB in the absence of ligand only weakly maintained PI3-kinase activity. The long-term survival of CEP-11004-maintained CGNs required the addition of exogenous BDNF to maintain PI3-kinase activity—revealing a synergism between CEP-11004 and BDNF. Taken together, our studies in two separate neuronal populations in the central nervous system and the peripheral nervous system, suggest that in addition to the direct inhibition of the JNK pathway, the indirect activation of the PI3-kinase pathway via Trk activation is important for MLK inhibitor-mediated neuronal survival and trophism.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Reagents. All reagents, unless specified, were purchased from Sigma-Aldrich (St. Louis, MO). CEP-11004 and CEP-1347 were gifts of Cephalon, Inc. (West Chester, PA), LY294002 [2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one] and K252a [(8R*,9S*,11S*)-(–)-9-hydroxy-9-methoxycarbonyl-8-methyl-2,3,9,10-tetrahydro-8,11-epoxy-1H,8H,11H-2,7b,11a-triazadibenzo(a,g)cycloocta(cde)trinden-1-one] were purchased from BIOMOL Research Laboratories (Plymouth Meeting, PA), and boc-aspartyl fluoromethyl ketone (BAF) was purchased from Enzyme Systems Products (Livermore, CA). All were dissolved in dimethyl sulfoxide and kept in the dark. CEP-11004 and BDNF were all prepared in 1% bovine serum albumin/Dulbecco's modified Eagle's medium (DMEM) before diluting them to their final concentrations.

CEP-11004 is now the only CEP-1347 analog provided to the research community (Murakata et al., 2002Go). For experiments in sympathetic neurons, CEP-11004 was found to be a slightly less potent inhibitor of JNK activation than CEP-1347, although both CEP-1347 and CEP-11004 inhibited c-Jun phosphorylation at 200 nM (Fig. 1). Since most experiments in sympathetic neurons were previously carried out at 400 nM CEP-1347 (Harris et al., 2002bGo) and the fact that CEP-11004 is a slightly less potent inhibitor, sympathetic neuronal experiments were carried out with 800 nM CEP-11004. For experiments in CGN cultures, concentrations above 400 nM CEP-11004 did not further increase viability (data not shown), and therefore that was the concentration used, the same concentration used in experiments with CEP-1347 (Harris et al., 2002aGo).



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 1. CEP-1347 and its analog CEP-11004 inhibit the JNK pathway. NGF-deprived sympathetic neurons were treated with increasing concentrations of CEP-11004 (labeled C4) and CEP-1347 for 24 h, then probed by Western blots with the monoclonal phospho-JNK (Thr183/Tyr185), phospho-c-Jun (Ser63), and Akt antibodies (Cell Signaling Technology Inc.).

 

Animal Care and Use. The animal protocols are approved by the Washington University Animal Studies Committee and are in compliance with the National Institutes of Health Guide.

Neuronal Culture and Treatment. Cultures of sympathetic neurons from the superior cervical ganglia (SCG) were prepared based on the protocol described in Johnson and Argiro (1983Go). Briefly, SCG were dissected from postnatal day (P)-1 Sprague-Dawley rats (Harlan, Indianapolis, IN) into L15 medium. The ganglia were dissociated by successive 30-min treatments in 1 mg/ml type-IV collagenase and 2.5 mg/ml trypsin (Worthington Biochemicals, Freehold, NJ) at 37°C and then by mechanical trituration. The cells were plated onto collagen-coated dishes. The neurons were maintained in AM50 [minimum essential medium (MEM), 10% fetal calf serum, 20 µM 5-fluoro-2-deoxyuridine, 20 µM uridine, 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mM glutamine, and 50 ng/ml 2.5 S NGF (Harlan Bioproducts for Science, Indianapolis, IN)] with 3.3 µg/ml aphidicolin (A. G. Scientific, Inc., San Diego, CA) for 3 days and then 3 days in AM50 alone. The cells were treated at 6 days in vitro (DIV). The cells were washed three times with MEM and then switched to a modified serum-free N2 medium without insulin [Dulbecco's modified Eagle's medium/F-12 (Invitrogen, Carlsbad, CA), 40 nM progesterone, 30 nM sodium selenite, 100 µM putrescine, and 10 µg/ml ChromoPure rat transferrin (Jackson ImmunoResearch Laboratories Inc., West Grove, PA), and 0.05% bovine serum albumin]. In cultures that were deprived of NGF, goat anti-NGF neutralizing antibodies were added to the medium.

The cerebellar granule cell culture protocol was modified from Levi et al. (1984Go). In brief, P7 Sprague-Dawley rat cerebella were dissected and dissociated by 1 mg/ml trypsin for 15 min and prior to mechanical trituration. Approximately 400,000 cells were plated into each well of poly-L-lysine-coated, 24-well dishes (NUNC A/S, Roskilde, Denmark). The cells were maintained in 0.5 ml of K25+S medium containing Eagle's basal medium with 25 mM potassium chloride, 10% dialyzed fetal bovine serum, 2 mM glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. Aphidicolin (3.3 µg/ml) was added 1 day later to reduce the number of non-neuronal cells. At 7 DIV, the cells were washed twice with DMEM (containing neither serum nor added potassium) and treated.

Sympathetic Neuron Survival Assay. Sympathetic neurons were plated at ~2000 to 3000 neurons/well in 24-well plates. After the indicated times, the cells were fixed with 4% paraformaldehyde in phosphate-buffered saline, stained with toluidine blue, and then counted on an inverted Nikon scope by a naive observer. Each condition was counted in triplicate or quadruplicate in three to four independent experiments.

Cerebellar Granule Neuron Cell Viability Assay. To measure the percentage of viable cerebellar granule cells, a fluorometric calcein-AM assay was used as described in Harris et al. (2002aGo). After the specified treatment periods, the cultures were washed once with magnesium-free Locke's solution (154 mM sodium chloride, 5.6 mM potassium chloride, 3.6 mM sodium bicarbonate, 2.7 mM calcium chloride, 5.6 mM glucose, 2.5 mM HEPES, and 2.5 mM sodium HEPES) and incubated for 30 min in the 37°C incubator with Locke's solution containing 5 µM calcein-AM (Molecular Probes, Eugene, OR). The cell-permeable nonfluorescent calcein-AM esters are cleaved by intracellular esterases into fluorescent products that are retained within the plasma membrane. The cultures were lysed with 400 µl of Locke's solution supplemented with 0.1% Triton X-100; the fluorescence of 200 µl of lysate was measured on a Titertek Fluoroskan II plate reader (Labsystem, Helsinki, Finland) at emission 485 nm and excitation 538 nm.

Protein Synthesis Assay. Sympathetic neurons were plated at ~5000 neurons/well in 24-well plates for 6 DIV. The cells were treated for 24 h and then were incubated with Tran35S-label methionine and cysteine (ICN Radiochemicals, Irvine, CA) in cysteine- and methionine-free MEM medium (Washington University Tissue Culture Support Center, St. Louis, MO) for 2 h at 37°C. The cells were lysed in 10 mM Tris-HCl (pH 7.5), 0.5% sodium dodecyl sulfate (SDS), and 1 mM EDTA; the protein contents of the cells were precipitated with 10% trichloroacetic acid overnight on ice and filtered through a nitrocellulose filter (BA-85; Schleicher & Schuell, Keene, NH). The amount of radioactivity on the filters was counted in a scintillation counter (Beckman LS 600SC; Beckman Coulter, Fullerton, CA). Protein synthesis contributed by non-neuronal cells in the cultures was subtracted by measuring the amount of 35S-incorporation in cultures of cells plated originally in anti-NGF containing AM0 medium (AM50 without NGF). Each condition was performed in triplicate or quadruplicate.

MTT Assays. About 10,000 sympathetic neurons/well were plated in 24-well plates. The cells at 6 DIV were incubated in L15 containing 10% fetal bovine serum and 0.4 mg/ml MTT for 15 min at 37°C. The cultures were washed once with phosphate-buffered saline and the tetrazolium crystals were solubilized with 200 µl of dimethyl sulfoxide. This solution (100 µl) was transferred into a translucent 96-well plate and read at 550 nm in a plate reader (Molecular Devices, Sunnyvale, CA). The background level of MTT reduction provided by non-neuronal cells was subtracted by measuring the contribution of MTT reduction of cells plated in the presence of AM0 with anti-NGF.

Western Blotting. Cell lysates were harvested with 300 µl of 2x SDS lysis buffer (125 mM Tris base, 4% SDS, 20% glycerol, 10% {beta}-mercaptoethanol, and 0.005% bromophenol blue). The denatured extracts were boiled for 5 to 10 min; then 30 or 45 µlofthe extracts were loaded and resolved on 8 or 10% gels (Invitrogen). The samples were transferred onto polyvinylidene difluoride membranes (Millipore Corporation, Bedford, MA). The blots were blocked in 5% milk in Tris-buffered saline containing 0.1% Tween 20 (TBST) for 1 h and then probed with primary antibody in TBST containing 5% bovine serum albumin. The blots were probed with antibodies against phospho-JNK (monoclonal), phospho-c-Jun (Ser63), phospho-GSK-3{beta} (Ser9), phospho-Akt (Ser473), total Akt, phospho-p44/42 MAP kinase, total p44/42 MAP kinase, phospho-Trk (Tyr490) (all at 1:1000; Cell Signaling Technology Inc., Beverly, MA), tubulin (1:10,000; Sigma-Aldrich), total GSK-3{beta} (1:1000; BD Biosciences PharMingen, San Diego, CA), Trk (1:50, C-14; Santa Cruz Biotechnology, Inc., Santa Cruz, CA), phospho-1062 Ret (1:1000; Tsui-Pierchala et al., 2002Go) and Ret (1:1000, C-20; Santa Cruz Biotechnology, Inc.). The blots were washed three times in TBST and then incubated in the appropriate horseradish peroxidase-conjugated secondary antibody. Blots were quantified with the ChemiDoc system (Bio-Rad, Hercules, CA). Trk levels from four independent 3-day experiments were quantified and normalized to the tubulin levels with the QuantityOne software (Bio-Rad).

Real-Time Quantitative Reverse Transcription-PCR Analysis. Messenger RNAs were isolated from sympathetic neuronal cultures maintained in NGF for 3 days or treated with CEP-11004 each day over 3 days with the QuickPrep micro mRNA purification kit (Amersham Biosciences Inc., Piscataway, NJ). First-strand cDNA templates were prepared with SuperScript II reverse transcriptase (Invitrogen). Quantitative reverse transcription-PCR was performed by monitoring in real-time the increase in fluorescence of the SYBR Green dye on a TaqMan 7700 Sequence Detection System (Applied Biosystems, Foster City, CA). TrkA cDNA was amplified with the primers ATCTGCAACGCCTGGAGTTTGAG and CTGAGCCGAGGGGTGAAATGGAA. TrkA cDNA levels were normalized to GAPDH cDNA levels (amplified with the primers TGCCCCCATGTTTGTGATG and TGTGGTCATGAGCCCTTCC) in each treatment condition. The measurement of TrkA or GAPDH cDNA levels of each treatment condition was done in quadruplicate. One set of PCR samples was run by gel electrophoresis to ensure that only one amplicon occurred in both reactions. Three independent experiments were combined.

Data Analysis. One-way analysis of variance (ANOVA) was mostly used to check statistical tendencies. Differences between groups were analyzed by indicated post hoc test. p values under 0.05 were considered significant. Statistical analysis was performed with SigmaStat (SPSS Inc., Chicago, IL).


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
CEP-11004 Activates the PI3-Kinase Pathway but Not the ERK Pathway in Sympathetic Neurons. The ERK pathway and the PI3-kinase pathway are two signaling pathways that NGF activates to regulate sympathetic neuronal metabolism (Tsui-Pierchala et al., 2000Go; Xue et al., 2000Go). We examined the activation state of these two pathways in CEP-11004-treated neurons by assessing the phosphorylation state of both Akt (on serine 473), a major downstream effector of PI3-kinase, and ERK. NGF-maintained sympathetic neuronal cultures were treated on day 6 by being maintained in 50 ng/ml NGF or deprived of NGF with or without CEP-11004. After 1 day of NGF withdrawal, both the phosphorylation of Akt and ERK fell to basal levels (Fig. 2, lane 2). The addition of CEP-11004 maintained a significant amount of Akt phosphorylation, but had no effect on ERK phosphorylation (lane 3). The inability of CEP-11004 to maintain ERK phosphorylation is similar to findings in motoneurons that CEP-1347 does not lead to an increase in ERK1 kinase activity (Maroney et al., 1998Go). CEP-11004 also maintained Akt phosphorylation when assessed after 7 days of NGF deprivation, suggesting that CEP-11004 was able to maintain phosphorylation of Akt long term (data not shown).



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 2. CEP-11004 activates the PI3-kinase pathway. CEP-11004 maintains the phosphorylation of Akt long term and in a PI3-kinase-dependent manner. NGF-maintained SCG cultures were switched to serum-free, insulin-free N2 medium after 6 DIV. Cultures were either maintained in NGF (50 ng/ml NGF, lane 1) or deprived of NGF (with neutralizing antibody to NGF, lane 2). NGF-deprived cultures were also treated with 800 nM CEP-11004 alone (lane 3) or with 12.5 µM LY294002 (labeled as LY, lane 4). These cultures were maintained for 1 day before lysates were collected for immunoblotting. The cultures were probed for phospho-Akt (Ser473), Akt, phospho-p44/42 ERK/MAPK (Thr202/Tyr204), and ERK antibodies (Cell Signaling Technology Inc.).

 

We confirmed that the phosphorylation of Akt was caused by activation of PI3-kinase. The addition of the PI3-kinase inhibitor LY294002 (12.5 µM, labeled LY in all figures) to CEP-11004-maintained cultures markedly decreased Akt phosphorylation (lane 4). The minimum concentration of LY294002 needed was 12.5 µM to abolish completely Akt phosphorylation maintained by CEP-11004 under these serum-free conditions (data not shown).

To rule out the possibility that CEP-11004 was only maintaining residual PI3-kinase activity that was caused by the activation of TrkA receptors before NGF was withdrawn, the phosphorylation state of Akt was assessed in neuronal cultures that were deprived of NGF in the presence of the broad-spectrum caspase inhibitor BAF for 24 h before being rescued with CEP-11004. The rescue of parallel BAF-maintained cultures with CEP-11004 for 24 h increased Akt phosphorylation (data not shown). The data show that CEP-11004 was able to activate PI3-kinase de novo and not simply maintain PI3-kinase activity subsequent to NGF removal. We were better able to determine the status of Akt phosphorylation by assessing at time points beyond those reported in Harris et al. (2002bGo). These results confirm the data presented by Roux et al. (2002Go) that MLK inhibitors increase PI3-kinase activity.

Inhibiting the PI3-Kinase Pathway Decreases the Trophic and Survival Effects of CEP-11004. Although the levels of activation of the PI3-kinase pathway by CEP-11004 were less than that seen in the presence of supraphysiological levels of NGF (50 ng/ml, ~2 nM), the activation was clearly significant. This suggests that the PI3-kinase pathway may contribute to the maintenance of neuronal metabolism and survival promoted by CEP-11004. To address this question, we measured the protein synthesis rates, MTT reduction rates, and viability of CEP-11004-maintained neurons treated with the PI3-kinase inhibitor LY294002. The MTT reduction rate measures the oxidative-reductive capacity of the neuronal cultures. Most of the oxidative-reductive capacity is contributed by the mitochondria and, therefore, the MTT reduction rate acts as a surrogate marker of mitochondrial function.

Protein synthesis and MTT reduction rates of neurons in the presence or absence of NGF were determined after 24 h. Similar to previous reports with CEP-1347 (Harris et al., 2002bGo), CEP-11004 maintained those two measures of the trophic state of neurons that decrease subsequent to NGF withdrawal (Fig. 3, A and B), albeit at a lower level when compared with supraphysiological concentrations of NGF (50 ng/ml, ~ 2 nM). The addition of LY294002 (12.5 µM) significantly decreased protein synthesis and MTT reduction rates. Kruskal-Wallis one-way ANOVA on ranks demonstrated statistically significant differences between treatments, p < 0.004 and subsequent comparison with Student-Newman-Keuls post hoc test demonstrated statistical differences when LY294002 is added to CEP-11004-treated cultures (p < 0.05). However, LY294002 only decreased the MTT reduction rate of CEP-11004-maintained cultures to a minimum similar to NGF-maintained cultures treated with LY294002. This suggests that for MTT reduction rates, the PI3-kinase pathway only partially accounts for the cellular oxidative-reductive capacity in both NGF- and CEP-11004-maintained cultures.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3. PI3-kinase inhibition of CEP-11004-maintained sympathetic neurons reduces neuronal trophism and survival. NGF-maintained sympathetic cultures at 6 DIV were maintained in 50 ng/ml NGF, deprived of NGF, deprived of NGF in the presence of 800 nM CEP-11004 alone or with 12.5 µM LY294002, or treated with NGF and LY294002 (at 50 µM, the concentration at which phospho-Akt is completely abolished, see Tsui-Pierchala et al., 2000Go). Protein synthesis rates (A) and MTT reduction rates (B) were determined after 1 day as described under Materials and Methods. Neuronal viability (C) was determined over 3 days by counting the number of toluidine blue-stained neurons in fixed cultures. Each condition was performed in triplicate or quadruplicate in three to four independent experiments. *, statistically significant difference between CEP-11004-treated cultures with or without LY294002 (p < 0.05, Student-Newman-Keuls post hoc test following Kruskal-Wallis one-way ANOVA on ranks). Error bars represent S.E.M.

 

To determine the effect of PI3-kinase inhibition on the survival of CEP-11004-maintained neurons, we counted the number of toluidine blue-positive neurons that survived over 3 days. Although CEP-11004 prevented the neuronal death over the 3 days of NGF deprivation, concurrent treatments of CEP-11004 and LY294002 significantly decreased the percentage of surviving neurons (Fig. 3C, Kruskal-Wallis oneway ANOVA on ranks, p < 0.03, Student-Newman-Keuls post hoc test, p < 0.05). The time course of this cell death was indistinguishable from that of NGF-deprived cultures. In these serum-free conditions, NGF-maintained neurons treated with LY294002 also die in a time course indistinguishable from NGF-deprived neurons; this is consistent with the observation that LY294002 kills NGF-maintained neurons in serum-free conditions, but not in serum-containing conditions (Pierchala et al., 2004Go). Our analyses of the protein synthesis rates, MTT reduction rates, and viability of CEP-11004-maintained neurons treated with the PI3-kinase inhibitor suggest that the activation of PI3-kinase pathway was an important mediator of the trophic and survival effects promoted by CEP-11004 under these conditions.

CEP-11004 Up-Regulates TrkA Activation. Studies by Lee and Chao (2001Go) found that adenosine activates the PI3-kinase pathway, but not the ERK pathway in PC12 cells and hippocampal neurons. This is similar to the actions of CEP-11004 (Fig. 4). Furthermore, they found that the activation of the PI3-kinase pathway is the result of neurotrophin-independent activation of Trk receptors. This led us to hypothesize that TrkA receptors may be activated in CEP-11004-treated sympathetic neurons.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 4. CEP-11004 treatment up-regulates TrkA expression and activity. A, CEP-11004 up-regulates TrkA protein levels and activation. NGF-maintained SCG cultures on 6 DIV were deprived of NGF in the presence of 800 nM CEP-11004 or 50 µM BAF or maintained in 50 ng/ml NGF. The lysates, collected at indicated times, were probed with phospho-Trk (Tyr490; Cell Signaling Technology Inc.) and total Trk (C-14; Santa Cruz Biotechnology, Inc.) as well as phospho-1062 Ret (see Tsui-Pierchala et al., 2002Go) and total Ret (C-20; Santa Cruz Biotechnology, Inc.). B, CEP-11004 increases TrkA mRNA levels. NGF-maintained SCG cultures on 6 DIV were deprived of NGF in the presence of 800 nM CEP-11004 or maintained in 50 ng/ml NGF over 3 days. The amount of TrkA cDNAs collected at indicated times were quantified as described under Materials and Methods. The amount of TrkA cDNAs were normalized to the amount of GAPDH cDNA in each condition and then normalized to the amount of TrkA mRNA in cultures maintained in NGF for 3 days. Data were combined from three independent experiments. *, statistically significant difference between CEP-11004- and NGF-maintained cultures on day 3 (p < 0.05, Tukey test following one-way ANOVA). Error bars represent S.E.M. C, CEP-11004 increases TrkA and PI3-kinase activity that is inhibited by K252a. Sympathetic cultures were maintained for 2 days in NGF (lane 1), BAF (lane 2), or CEP-11004 (lane 3). CEP-11004- and NGF-maintained cultures were treated with 100 nM K252a (lanes 4 and 5, respectively). In addition to phospho-Trk and total Trk levels, the lysates were probed for phospho-Ser473 and total Akt (Cell Signaling Technology Inc.) and phospho-Ser9 and total GSK-3{beta} (Cell Signaling Technology Inc. and BD Biosciences Transduction Laboratories, Lexington, KY, respectively).

 

To test the hypothesis, we probed for phosphotyrosine 490 TrkA, a residue the phosphorylation of which reflects Trk kinase activity (Obermeier et al., 1994Go). The level of TrkA phosphorylation increased over 3 days in CEP-11004-treated NGF-deprived neurons (Fig. 4A, lanes 1–3). The immature (110 kDa) form of TrkA was not phosphorylated (data not shown). Unexpectedly, total TrkA levels also increased over 3 days to a level greater than that seen in NGF-maintained neurons. Quantification of four experiments found that neurons maintained in CEP-11004 expressed ~3-fold (mean ± S.E.M., 2.8 ± 0.4, n = 4) more TrkA than those in NGF alone. As a control, NGF-deprived neurons treated with BAF do not have increased TrkA levels compared with CEP-11004-treated neurons (compare lane 4 to lanes 1–3). The broad-spectrum caspase inhibitor BAF was used to prolong the survival of NGF-deprived neurons; however, BAF has no effect on maintaining the trophic status of NGF-deprived neurons (Deshmukh et al., 1996Go).

To determine that the increase in protein level was selective for the TrkA tyrosine kinases, we examined the levels of the receptor tyrosine kinase Ret, the activation of which by glial-derived neurotrophic factor family of ligands can also maintain sympathetic neuronal survival (Creedon et al., 1997Go). CEP-11004 treatment did not increase Ret protein levels over time (Fig. 4A), nor did it increase Ret activation as assessed by the phosphorylation state of tyrosine 1062, a signaling residue important for signaling (Besset et al., 2000Go).

The increase in TrkA expression might be accounted for by decreases in degradation and/or increases in synthesis. To establish whether treatment with CEP-11004 increased mRNA levels, mRNA levels were determined by quantitative reverse transcription-PCR on CEP-11004-treated cultures. mRNAs were isolated and reverse-transcribed from neuronal cultures maintained in CEP-11004 or NGF over 3 days. The amount of TrkA cDNA was determined and normalized to the amount of GAPDH cDNA in each condition. The amount of TrkA cDNA in CEP-11004 treatment increased over 3 days (Fig. 4B). Three-day treatment of CEP-11004 induced a ~3-fold (3.3 ± 0.1, n = 3 experiments) increase in TrkA cDNA compared with NGF alone. One-way ANOVA demonstrated significant main effects (p < 0.001). Subsequent multiple comparisons using Tukey's honestly significant difference post hoc test revealed significant increases at 2 and 3 days compared with the control (p < 0.05). Thus, CEP-11004 selectively increased the level and activation of the TrkA receptor in sympathetic neurons.

The transactivation of Trk by adenosine is mediated by the adenosine 2A (A2A) receptor (Lee and Chao, 2001Go). To rule out the possibility that CEP-11004 is acting as an adenosine analog, we utilized the A2A-specific inhibitor ZM 241385 to determine whether the survival effects of CEP-11004 were inhibited. We found that the addition of ZM 241385 did not decrease CEP-11004-maintained survival (data not shown). Furthermore, adenosine transactivation of Trk is mediated through Src activation. We found that the Src kinase inhibitors PP2 and SU6656 did not interfere with CEP-11004 up-regulation of Trk (data not shown). Additionally, the more specific inhibitor SU6656 did not decrease CEP-11004-mediated survival and trophism (data not shown). Therefore, the effects of CEP-11004 on SCG neurons are not because of the activation of the A2A receptor or Src family kinases. Since CEP-11004-mediated activation of TrkA occurred in the presence of a neutralizing antibody to NGF, we concluded that the activation of TrkA was caused by ligand-independent activation and was correlated with an increase in TrkA receptor mRNA and protein levels.

CEP-11004-Mediated Increases in TrkA and PI3-Kinase Pathway Activity Are Inhibited by K252a. To determine whether TrkA receptor activity was required for CEP-11004-mediated phosphorylation of tyrosine 490, the Trk inhibitor K252a (Koizumi et al., 1988Go) was used. At 100 nM, the compound selectively inhibits the tyrosine kinase activity of Trk receptors and not other tyrosine kinases such as the platelet-derived growth factor receptor, the epidermal growth factor receptor, or the Src kinase (Nye et al., 1992Go; Tapley et al., 1992Go).

After a 2-day treatment, CEP-11004 maintained a significant level of TrkA phosphorylation (Fig. 4C, lane 3), albeit at a lower level than that seen with continued NGF (50 ng/ml) exposure. Concurrent treatment with 100 nM K252a completely blocked TrkA phosphorylation caused by treatment with CEP-11004 or NGF (lanes 4 and 5, respectively), thus indicating that the phosphorylation of TrkA upon exposure to CEP-11004 was caused by autophosphorylation. The addition of the Trk inhibitor did not affect the accumulation of TrkA protein.

This phosphorylation of TrkA was correlated with the activation of the downstream PI3-kinase pathway. The addition of K252a decreased the phosphorylation of Akt caused by CEP-11004 treatment. Further evidence was obtained by assessing the phosphorylation state of serine 9 of GSK-3{beta}, a substrate of Akt. GSK-3 is an important regulator of many cellular processes, such as cell metabolism and survival. Through phosphorylation, GSK-3 regulates the activity of many metabolic enzymes, including glycogen synthase and eukaryotic initiation factor-2B{epsilon}, enzymes important in regulating glycogen metabolism and protein translation (for review, see Grimes and Jope, 2001Go). GSK-3{beta} activity is negatively regulated by Akt phosphorylation. Therefore, decreased phosphorylation is correlated with decreased Akt activity subsequent to decreased PI3-kinase activity. As shown in Fig. 4C, CEP-11004 partially maintained GSK-3{beta} phosphorylation subsequent to NGF deprivation. The addition of K252a blocked CEP-11004-induced GSK-3{beta} phosphorylation.

The Activation of TrkA Is Important for Maintaining Metabolism and Survival in CEP-11004-Maintained Neurons. If TrkA activation contributes to the maintenance of PI3-kinase activity as a result of CEP-11004 treatment, then K252a treatment should decrease trophism and survival in a manner similar to LY294002 as shown in Fig. 3. To that end, the protein synthesis and MTT reduction rates as well as viability of CEP-11004-maintained neurons treated with the Trk inhibitor were measured.

K252a decreased the protein synthesis rates of CEP-11004-maintained neurons after 1-day treatments (Fig. 5A, Kruskal-Wallis one-way ANOVA on ranks, p = 0.001, Student-Newman-Keuls post hoc test, p < 0.05). K252a also decreased the MTT reduction rates after 1- and 2-day treatments (data not shown). Neuronal viability was also assessed after 3 days. The addition of K252a decreased CEP-11004-maintained survival (Fig. 5B, one-way ANOVA, p < 0.001, Student-Newman-Keuls post hoc test, p < 0.05). Consistent with the LY294002 data (Fig. 3), these data suggest that the loss of PI3-kinase activity subsequent to inhibiting TrkA activity decreased metabolism and long-term survival in CEP-11004-maintained neurons.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 5. TrkA inhibition in CEP-11004-treated neurons decreases trophism and survival. NGF-maintained SCG cultures at 6 DIV were maintained with 50 ng/ml NGF or deprived of NGF. NGF-deprived cultures were treated with media in which 800 nM CEP-11004 was added with or without 100 nM K252a. Protein synthesis rates (A) were determined after 1 day as described under Materials and Methods. Neuronal viability (B) was determined over 3 days by counting the number of toluidine blue-stained neurons in fixed cultures. Each condition was done in quadruplicate in three to four independent experiments. *, statistically significant differences of p < 0.05 by Student-Newman-Keuls test following appropriate one-way ANOVA. Error bars represent S.E.M.

 

CEP-11004-Induced TrkA Is Responsive to Extracellular NGF. The above experiments examined the consequences of ligand-independent activation of TrkA seen after CEP-11004 treatment in NGF-deprived neurons. We next determined whether the accumulated TrkA receptor seen after CEP-11004 treatment was present on the cell surface or completely sequestered intracellularly. Neurons were deprived of NGF in the presence of CEP-11004 or BAF for 3 days and then exposed acutely to different concentrations of NGF for 15 min. As shown in Fig. 6, the readdition of NGF to CEP-11004-saved neurons dramatically increased phospho-TrkA and Akt levels in a dose-dependent manner (Fig. 6, lanes 4–6). The readdition of 50 ng/ml NGF increased the phospho-TrkA and phospho-Akt to levels well above those of cultures maintained in 50 ng/ml NGF for 3 days (lane 1). Phospho-TrkA and phospho-Akt levels were much lower when NGF was readded to BAF-saved cultures (lanes 7–9). This is consistent with the marked increase in TrkA levels in CEP-11004-treated neurons. Therefore, at least some of the accumulated TrkA receptor was present on the plasma membrane and able to respond to extracellular trophic factors.



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 6. CEP-11004 up-regulation of TrkA expression increases sensitivity to acute reapplication of NGF. Six-day in vitro SCG cultures were treated for 3 days in modified N2 medium containing NGF (50 ng/ml), deprived of NGF with BAF (50 µM), or CEP-11004 (800 nM). After 3 days, the medium of BAF- or CEP-11004-saved cultures was changed to media containing 50, 10, or 5 ng/ml NGF for 15 min before the cells were lysed and probed for phospho-Trk (Tyr490; Cell Signaling Technology Inc.), total Trk (C-14; Santa Cruz Biotechnology, Inc.), phospho-Akt, and total Akt levels (Cell Signaling Technology Inc.). The level of phospho-Akt in CEP-11004-treated cultures would be similar to that seen in previous figures if the exposure is increased.

 

Inhibition of Basal JNK Activity in NGF-Maintained Cultures Is Correlated with Increased TrkA Expression and Activation. Sympathetic neurons, like cerebellar granule neurons and other neurons, maintain high basal levels of JNK activity. This pool of activated JNK presumably regulates normal cellular activity and is distinct from the stress-sensitive pool of JNK proteins that phosphorylate c-Jun upon trophic factor withdrawal (Coffey et al., 2000Go). The activation of this stress-sensitive pool of JNK protein in sympathetic neurons is suppressed by NGF signaling as c-Jun is not phosphorylated in the presence of NGF. Whether the inhibition of the constitutively active JNK pool is correlated with the up-regulation of TrkA was determined.

First, we confirmed that sympathetic neurons maintained in NGF possessed high basal JNK activity as assessed by phospho-JNK levels (Fig. 7, lanes 1 and 3). This high basal JNK activity was present in neuronal cultures maintained in 5 or 50 ng/ml NGF. However, higher concentrations of NGF maintained lower phospho-JNK levels [compare 50 ng/ml NGF (lane 1) to 5 ng/ml NGF (lane 3)] consistent with the ability of NGF to suppress JNK activity in a dose-dependent manner. CEP-11004 treatment decreased phospho-JNK at both NGF concentrations (lanes 2 and 4).



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 7. CEP-11004 up-regulates TrkA expression in the presence of NGF. Six-day in vitro SCG cultures were switched to medium containing 5 or 50 ng/ml NGF, with or without the addition of 800 nM CEP-11004. The different treatments were probed for phospho-JNK levels (Cell Signaling Technology Inc.) at 12 h or probed for phospho-Trk (Tyr490; Cell Signaling Technology Inc.), total Trk (C-14; Santa Cruz Biotechnology, Inc.), phospho-Akt, and total Akt levels (Cell Signaling Technology Inc.) after 3 days.

 

To determine whether suppression of basal JNK activity was correlated with increased levels of TrkA expression, the effect of CEP-11004 in NGF-maintained neuronal cultures was examined. Addition of CEP-11004 increased TrkA phosphorylation and expression compared with cultures maintained in NGF at either 5 or 50 ng/ml NGF alone (compare lanes 1 to 2 and 3 to 4). The 110-kDa immature form of the TrkA receptor was not phosphorylated (data not shown). CEP-11004 appeared not to inhibit NGF-induced receptor down-regulation, as cultures maintained in CEP-11004 and higher NGF concentrations (50 ng/ml, lane 2) had lower total TrkA levels compared with cultures maintained in CEP-11004 and lower NGF concentrations (5 ng/ml, lane 4). Thus, CEP-11004 is able to increase TrkA levels whether the neurons are maintained in, or deprived of, trophic factor.

CEP-11004 and BDNF Synergistically Maintain Long-Term Cerebellar Granule Neuronal Survival. As a consequence of the prior findings, we hypothesized that the inability of CEP-1347 and CEP-11004 to maintain long-term CGNs survival after transfer to nondepolarizing concentrations of potassium (Harris et al., 2002aGo) may be because of the lack of Trk receptor tyrosine-kinase activation. To test this hypothesis, we measured the long-term neuronal viability of CGN cultures treated with CEP-11004 with or without the neurotrophin BDNF, the ligand for TrkB receptors that are expressed on these neurons. CGNs were treated on 7 DIV, and neuronal viability was measured by calcein fluorescence after 3 or 5 days (Fig. 8A). One-way ANOVA demonstrated statistically significant differences between the treatments (p < 0.001) after 3 or 5 days. After 3 days, CGNs deprived of potassium and serum (K5-S) maintained only 22 ± 3% of neuronal viability compared with neurons maintained in potassium and serum (K25+S). CEP-11004 treatment only transiently increased neuronal survival, 39 ± 3% neuronal viability at day 3 and 25 ± 5% after five days (p < 0.05 versus K5-S on day 3 by the Student-Newman-Keuls post hoc test), similar to its MLK inhibitor analog CEP-1347 (Harris et al., 2002aGo). BDNF treatment also increased the neuronal viability, albeit minimally, 28 ± 1% after 3 days (not statistically significant, p > 0.05, versus K5-S by the Student-Newman-Keuls post hoc test). However, CEP-11004 and BDNF sustained neuronal viability, maintaining 67 ± 2% after 3 days (Student-Newman-Keuls post hoc test, p < 0.01, compared with CEP-11004 or BDNF alone). The synergistic effect of CEP-11004 and BDNF can be seen most prominently after 5 days of treatment (Fig. 8A). Compared with K5-S, the neuronal viability maintained by CEP-11004 and BDNF separately is minimal and decreasing compared with the neuronal viability stably maintained by the two agents together (p < 0.05). As expected, this enhanced survival was blocked by the inhibition of PI3-kinase with LY294002 (data not shown). The synergistic effect was impressive when examined microscopically. Neurons maintained in CEP-11004 and BDNF looked healthy even after 4 days, in contrast to neurons treated with either agent alone (Fig. 8B). The addition of other neurotrophins (such as NGF or neurotrophin-3) was not able to synergistically enhance neuronal viability with CEP-11004 (data not shown). We thus concluded that CEP-11004-treated CGNs required BDNF signaling for long-term survival or, stated another way, the effects of CEP-11004 and BDNF were synergistic in maintaining this population of neurons.



View larger version (88K):
[in this window]
[in a new window]
 
Fig. 8. CEP-11004 and BDNF synergistically save cerebellar granule neurons. Potassium- and serum-maintained cerebellar granule neurons were treated on 7 DIV. The cultures were either maintained in potassium and serum (K25+S) or deprived (K5-S). Deprived cultures were treated with 400 nM CEP-11004, 100 ng/ml BDNF, or CEP-11004 and BDNF together. Neuronal viability was measured on days 3 and 5 by the calcein-AM assay detailed under Materials and Methods (A). Data represent mean + S.E.M. and compiled from three to five independent experiments. Photomicrographs were taken on day 4 (B). Scale bar = 50 µm. *, statistically significant differences (p < 0.05, post hoc test following ANOVA) compared with deprived cultures or deprived cultures treated with CEP-11004 or BDNF alone.

 

The Activation of the PI3-Kinase Pathway Is Correlated with CEP-11004- and BDNF-Maintained Survival. Potassium-maintained CGNs require sustained activation of the PI3-kinase pathway for survival (Miller et al., 1997bGo). Therefore, the activation of the PI3-kinase pathway was assessed in CEP-11004- and BDNF-maintained CGNs by examining the phosphorylation states of Akt and GSK-3{beta}, two sequential downstream effectors of PI3-kinase. After 1 day of potassium and serum deprivation, phospho-Akt levels in K5-S-maintained neurons decreased to basal levels well below those observed in K25+S cultures. This is consistent with decreasing PI3-kinase activation that occurs after trophic withdrawal (compare lanes 1 and 2, Fig. 9). CEP-11004 treatment of potassium- and serum-deprived cultures maintained only very low phospho-Akt levels (lane 3), suggesting that CEP-11004 alone minimally activated the PI3-kinase pathway.



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 9. CEP maintains TrkB levels to allow for continuous BDNF activation of the PI3-kinase pathway. Potassium- and serum-maintained cerebellar granule neurons were treated on 7 DIV. The cultures were either maintained in potassium and serum (K25+S) or deprived (K5-S). Deprived cultures were treated with 400 nM CEP-11004, 100 ng/ml BDNF, or CEP-11004 and BDNF together. Cultures were treated for 1 day before being probed by Western blot with total Trk (Santa Cruz Biotechnology, Inc.), phospho-Akt, total Akt, phospho-GSK-3{beta} (previous three from Cell Signaling Technology Inc.), or total GSK-3{beta} (BD Biosciences Transduction Laboratories).

 

Similarly, BDNF alone (lane 4) did not maintain phospho-Akt levels after 1 day of treatment; however, addition of the neurotrophin to CEP-11004-treated cultures sustained the phosphorylation of Akt as well as the phosphorylation of the downstream Akt substrate GSK-3{beta} (lane 5). As BDNF does not act through any other receptors except TrkB, this activation of the PI3-kinase pathway is presumably due to TrkB activation. We see BDNF activation of TrkB receptors in CEP-11004-maintained cultures at earlier time points (see below). These data suggest that combined treatment of BDNF and CEP-11004, in contrast to either agent alone, produced sustained activation of the TrkB receptor and the PI3-kinase pathway—resulting in the long-term maintenance of neuronal survival.

CEP-11004 Increases Trk Levels in Cerebellar Granule Cells and Requires BDNF to Activate the PI3-Kinase Pathway. To determine whether CEP-11004 and BDNF sustain PI3-kinase pathway activation because CEP-11004 maintains increased expression of TrkB, the neurotrophin receptor specific for BDNF, in CGNs, TrkB levels were assessed after 24 h of potassium and serum deprivation. The treatment of potassium- and serum-deprived neurons with CEP-11004 increased TrkB expression compared with neurons maintained in potassium and serum (Fig. 9, compare lane 3 to lane 1). TrkB levels were dramatically reduced in cultures treated with BDNF (lane 4, Fig. 9) after 24 h, consistent with BDNF causing a rapid down-regulation of TrkB receptors. The addition of CEP-11004 to BDNF-treated cultures also resulted in decreased Trk levels compared with the K25+S condition; however, the decrease was much less than cultures treated with BDNF alone (lane 5, Fig. 9).

These findings are consistent with previous observations that TrkB is a short-lived receptor. In CGNs, BDNF rapidly reduces the TrkB levels to 50% by 1 to 2 h and to less than 20% by 3 h as reported by Sommerfeld et al. (2000Go). The down-regulation of the TrkB in response to BDNF is a property intrinsic to the TrkB receptor. In HN10 cell lines transfected with TrkA or TrkB receptors, NGF does not reduce TrkA levels, whereas BDNF treatment reduces TrkB levels. Furthermore, Sommerfeld et al. (2000Go) found that the replacement of the cytoplasmic domain of TrkA into TrkB decreases BDNF-induced down-regulation of the receptor.

To confirm that TrkB levels fall precipitously in response to BDNF under conditions used in our experiments and that CEP-11004 retards the fall in TrkB levels, the changes in TrkB levels were tracked over periods shorter than 24 h. K25+S-maintained cultures were washed twice after 7 DIV and treated immediately with CEP-11004 and/or BDNF in K5-S. Total and activated TrkB levels and PI3-kinase pathway activation were assessed after 15 min and 4 h. After 15 min, TrkB was activated as assessed by phospho-490 tyrosine Trk immunoblotting in cultures treated with neurotrophin, in cultures treated with BDNF alone, or BDNF with CEP-11004 (Fig. 10A, lanes 4–5). Furthermore, the downstream PI3-kinase pathway was activated as assessed by phospho-Akt levels. Total Trk levels were equivalent at this time. Surprisingly, returning the cultures washed twice with DMEM medium to K25+S required a longer time than the direct stimulation of the receptor for phospho-Akt levels to recover fully (see lane 1 at 15 min compared with 4 h, Fig. 10B).



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 10. BDNF rapidly degrades TrkB receptors. Potassium- and serum-maintained cerebellar granule neurons were treated on 7 DIV. The cultures were either maintained in potassium and serum (K25+S) or deprived (K5-S). Deprived cultures were treated with 400 nM CEP-11004, 100 ng/ml BDNF, or CEP-11004 and BDNF together. Cultures were treated for 15 min (A) or 4 h (B) before being probed by Western blot with phosphotyrosine490 Trk (Cell Signaling Technology Inc.), total Trk (Santa Cruz Biotechnology, Inc.), phospho-Akt, total Akt, phospho-GSK-3{beta} (previous three from Cell Signaling Technology Inc.), or total GSK-3{beta} (BD Biosciences Transduction Laboratories).

 

Trk and PI3-kinase activation were also assessed after 4 h, a time point at which the difference in numbers of surviving neurons in each treatment is minimal. Once again, no phosphorylation of Trk was detected in cultures without neurotrophin (Fig. 10B, lanes 1–3). Phospho-Trk levels were barely distinguishable in BDNF-treated cultures with or without CEP-11004 (lanes 4 and 5). Total Trk levels were decreased in cultures treated with neurotrophin. After 4 h of potassium and serum deprivation (K5-S), the activation of the PI3-kinase pathway (phospho-Akt levels) decreased to basal levels compared with K25+S-maintained cultures (compare lane 1 to lane 2). Phospho-Akt levels were barely above basal levels in CEP-11004- or BDNF-treated cultures (lanes 3 and 4, respectively). However, phospho-Akt levels remained sustained in cultures treated with both the neurotrophin and MLK inhibitor (lane 5).

As discussed above, by 24 h TrkB levels were undetectable in cultures treated with BDNF, consistent with the marginal saving effect of BDNF on CGNs since the receptor was activated, degraded, and not replaced. The addition of BDNF to CEP-11004-treated cultures also decreased Trk levels, but to a lesser extent than cultures treated with BDNF alone. Therefore, these results indicate that the levels of TrkB are regulated in CEP-11004 and BDNF-treated cultures by 1) the increase synthesis induced by CEP-11004 and 2) BDNF-induced TrkB down-regulation. CEP-11004 maintained Trk levels in potassium- and serum-deprived neurons and partially prevented BDNF-induced decreases in Trk protein levels in CEP-11004- and BDNF-treated cultures. CEP-11004 maintained a level of TrkB expression sufficient to allow for continuous receptor signaling in the presence but not the absence of BDNF.


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
CEP-1347 and CEP-11004 are selective MLK inhibitors that promote inhibition of the JNK pathway in neurons. In this study, signaling events downstream of CEP-11004 inhibition of the JNK pathway were analyzed. In two neuronal populations one central and one peripheral each expressing a different Trk receptor, we find two important properties of MLK inhibitors: 1) CEP-11004 increases Trk levels, and 2) activation of the Trk receptor is required for activation of the PI3-kinase pathway, which in addition to inhibition of the JNK pathway, is required for long-term survival (Fig. 11).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 11. CEP-11004 increases Trk expression. In addition to (1) the inhibition of the JNK pathway, the pharmacological sustenance of neuronal survival and trophism requires (2) the activation of the PI3-kinase pathway. This activation of the PI3-kinase pathway is a consequence of the increase in Trk expression caused by MLK inhibitors, resulting in ligand-independent autoactivation of TrkA receptors in sympathetic neurons (A) and BDNF-dependent activation of TrkB receptors in CGNs (B).

 

However, requirements for activation of Trk and PI3-kinase were different in each neuronal population. In sympathetic neurons, CEP-11004 increased TrkA receptor mRNA and protein levels to greater than that in the presence of NGF. This increased TrkA level produced ligand-independent receptor activation. Inhibition of the JNK pathway in conjunction with ligand-independent activation of the PI3-kinase pathway maintained sympathetic neuronal survival and trophism (Fig. 11A). In cerebellar granule neurons, CEP-11004 also increased TrkB receptor levels. However, increase in TrkB alone was insufficient to yield sustained ligand-independent activation (Fig. 11B). This explains why CEP-11004 alone only transiently promotes survival in potassium- and serum-deprived CGNs, as previously reported (Harris et al., 2002aGo). Although CEP-11004 inhibits the JNK pathway and increases TrkB levels, the addition of BDNF to activate TrkB and the PI3-kinase pathway was required for long-term survival. In two neuronal populations that express two distinct Trk receptors, we find that both JNK pathway inhibition and PI3-kinase pathway activation contributed to the long-term neuronal survival promoted by CEP-11004.

CEP-11004 Increases TrkA mRNA and Protein Levels as Well as TrkA Activation in Sympathetic Neurons. CEP-11004 treatment of NGF-deprived sympathetic neurons for 3 days gradually increased TrkA mRNA and protein levels ~3-fold compared with NGF-maintained neurons (Fig. 4, A and B). TrkA up-regulation also occurred when NGF-maintained neurons were treated with CEP-11004 (Fig. 7). Thus, TrkA levels appeared correlated not with the inhibition of the stress-sensitive JNK pool in NGF-deprived neurons but with the inhibition of basal JNK activity also present in NGF-maintained neurons. However, we cannot rigorously exclude the possibility that CEP-11004 increased TrkA mRNA and protein through a novel mechanism that did not involve inhibition of MLKs and the JNK pathway. To our knowledge, our results are one of the first reports of a small molecule that increases levels of a tyrosine receptor kinase such as Trk; potential benefits of this novel phenomenon are discussed below.

CEP-11004 Induces Ligand-Independent Activation of TrkA Tyrosine Kinase Receptor. CEP-11004 up-regulation of TrkA levels correlated with increased TrkA activation as assessed by increased phosphorylation of tyrosine 490 on the TrkA receptor in NGF-deprived neurons (Fig. 4C). This activation in the absence of NGF is most likely a consequence of increased expression of TrkA receptors resulting in autoactivation seen also when TrkA is ectopically overexpressed in PC12 cells (Hempstead et al., 1992Go). This is a commonly observed phenomenon in which expressing receptor tyrosine kinases at a high level causes ligand-independent autophosphorylation and activation. The activation of TrkA observed was independent of the NGF ligand since NGF-neutralizing antibodies were always present in NGF-deprived cultures. Addition of anti-NT-3 also had no effect (data not shown).

This work supports the concept that Trk receptors can be activated independent of ligands. The neurotrophic factor pituitary adenylate cyclase-activating peptide (PACAP) increases TrkA expression (Lazarovici and Fink, 1999Go) and activation (Lee et al., 2002Go) in PC12 cells. Similarly, the small-molecule adenosine can also increase TrkA activation in PC12 cells (Lee and Chao, 2001Go). PACAP and adenosine are ligands for G-protein-coupled receptors (Lee and Chao, 2001Go; Lee et al., 2002Go). Similar to CEP-11004, both PACAP and adenosine slowly activate Trks in the presence of neutralizing antibodies to NGF. Both also induce PI3-kinase activity with little or no effect on ERK activity. Interestingly, cyclic AMP, the product of PACAP signaling, also suppresses JNK activity in sympathetic neurons (Putcha et al., 2001Go). Therefore, these molecules might all be acting by similar mechanisms.

The activation of TrkA is important for activation of the PI3-kinase pathway since inhibition of Trk activity with the pharmacological inhibitor K252a decreased both Akt and GSK-3 phosphorylation (Fig. 4C) and, consequently, decreased neuronal trophism and survival (Fig. 5). Importantly, K252a did not inhibit CEP-11004 up-regulation of TrkA levels but only the activation of TrkA. Most impressively, CEP-11004 up-regulation of TrkA levels still occurs in the presence of K252a and the global depression in protein synthesis rate. However, our studies with pharmacological inhibitors need to be interpreted cautiously. CEP-11004 and K252a are analogs that inhibit the MLK family of kinases (Roux et al., 2002Go). The counteracting effects of K252a on CEP-11004 actions should not be at the levels of MLKs. Addition of K252a to CEP-11004 actually increased inhibition of JNK phosphorylation when assessed at 12 h (data not shown). Furthermore, addition of K252a only inhibited activation of the Trk receptor and did not inhibit the accumulation of the receptor. The most parsimonious interpretation of our data is that CEP-11004 treatment caused the induction and activation of the Trk receptor.

CEP-11004-Treated CGNs Require TrkB Activation. Our findings in CGN cultures are consistent with previous studies that BDNF cannot promote the long-term survival of dissociated CGNs (Skaper et al., 1998Go; Shalizi et al., 2003Go). Prepared under similar conditions used here, BDNF does not save "mature" CGNs, neurons dissected from P6 rats and maintained for 7 DIV before treatment; in mature CGNs, TrkB is rapidly down-regulated (Sommerfeld et al., 2000Go; Figs. 9 and 10).

CEP-11004-induced increases in TrkB levels allowed for continuous BDNF signaling. The synergistic survival promotion of BDNF and CEP-11004 is the most impressive saving paradigm for potassium- and serum-deprived mature CGNs that we have observed, other than bax deletion (Miller et al., 1997aGo). The combined treatment regimen of BDNF and CEP-11004 maintains more neuronal viability and sustains neuronal viability for a longer time than potassium- and serum-deprived mature CGNs treated with cyclic AMP, insulin-like growth factor-1, BDNF, or CEP-11004 alone.

Rapid down-regulation of TrkB probably explains why CEP-11004 treatment of CGNs did not activate, in ligand-independent fashion, the Trk receptor and PI3-kinase as in CEP-11004-treated sympathetic neurons. The few receptors that might be autoactivated in CEP-11004 treatment alone were degraded rapidly, and downstream signals were not sufficiently amplified. The very few receptors that were activated in CEP-11004-treated CGNs minimally activated downstream pathways as assessed by phospho-Akt levels at 24 h (Fig. 9). The CEP-11004-induced levels of TrkB, insufficient to induce ligand-independent phosphorylation, were able to produce sufficient signaling in the presence of the ligand BDNF to maintain downstream signaling and survival (Figs. 9 and 10).

Interestingly, the rapidity of TrkB activation-induced down-regulation compared with TrkA could explain why patients with TrkB-expressing neuroblastomas have a less favorable prognosis compared with TrkA-expressing neuroblastomas. TrkA-expressing neuroblastomas have a higher propensity to differentiate into ganglion cells, even though NGF is not expressed. This may be explained by the stability of the TrkA autoactivation signaling similar to our observations. In contrast, TrkB-expressing neuroblastomas rapidly down-regulate and cannot sustain downstream signal activation, even though BDNF is expressed (for review, see Brodeur, 2003Go). As a consequence, these tumors do not differentiate and further progress.

CEP-11004-Induced Up-Regulation of Trk Expression "Primes" the Neurons to Exogenous Neurotrophins. The increase in TrkA receptors "primed" CEP-11004-treated sympathetic neurons to be more responsive to extracellular neurotrophins (Fig. 7). Acute reapplication of NGF stimulated TrkA and Akt phosphorylation well above levels of NGF-maintained or BAF-saved neurons. Hence, a biologically significant proportion of the TrkA receptor pool was expressed on the cell surface. Similarly, the increase in TrkB receptors primed CEP-11004-treated CGNs to be more responsive to extracellular neurotrophin. In fact, TrkB receptor activation was required for long-term survival. If MLK inhibitors produce similar increases in Trk levels in vivo, responsiveness of neurons to endogenous trophic factor would be expected to be augmented. Therefore, treatment with CEP-11004 or CEP-1347 may not only inhibit cell death directly, but may also increase levels of Trk receptors. This receptor augmentation may make the diseased neurons more responsive to physiological levels of trophic factors. Thus, CEP-11004 or CEP-1347 not only inhibit the apoptotic pathway but may also increase sensitivity to trophic factors. Increase in Trk receptor levels may be an important mechanism by which MLK inhibitors are protective in models of neuronal injury and neurodegeneration; for instance, one of the affected populations of neurons in Alzheimer's disease, the basal forebrain cholinergic neurons, down-regulate TrkA expression in aged rats (Boissiere et al., 1997Go). Whether CEP-11004 inhibition of the JNK pathway will lead to increased Trk levels in vivo is currently under investigation.

MLK inhibitors prevent cell death in cell-culture models of motoneurons deprived of trophic factors as well as neuronal cell death in in vivo models of midbrain dopaminergic, basal forebrain, and motor neuronal cell death (for review, see Saporito et al., 2002Go; Wang et al., 2004Go). Each of these neuronal populations expresses at least one member of the Trk family. Our data suggest that up-regulation of Trk activity is an important signaling event downstream of MLK inhibitors and contributes to the survival and trophic-promoting effects of the drugs on these neuronal populations.


    Acknowledgements
 
We are especially grateful to Patricia Osborne for help with the experiments and manuscripts. We also thank Cagri Besirli, Mary Bloomgren, Louis Chang, Mario Encinas, Judy Golden, David Holtzman, and Brian Tsui-Pierchala for thoughtful suggestions and support.


    Footnotes
 
This work was supported by National Institutes of Health Grants R37AG12947 and R01NS38651 (E.M.J.).

doi:10.1124/jpet.104.077800.

ABBREVIATIONS: JNK, c-Jun NH2-terminal kinase; K252a, (8R*,9S*,11S*)-(–)-9-hydroxy-9-methoxycarbonyl-8-methyl-2,3,9,10-tetrahydro-8,11-epoxy-1H,8H,11H-2,7b,11a-triazadibenzo(a,g)cycloocta(cde)trinden-1-one; CEP-1347, 3,9-bis[(ethylthio)methyl]-K252a; CEP-11004, 3,9-bis-[(isopropylthio)methyl]-K252a; MLK, mixed-lineage kinase; NGF, nerve growth factor; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; PI3-kinase, phosphatidylinositol 3-kinase; CGNs, cerebellar granule neurons; BDNF, brain-derived neurotrophic factor; LY294002, 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one; BAF, boc-aspartyl fluoromethyl ketone; DMEM, Dulbecco's modified Eagle's medium; SCG, superior cervical ganglia; MEM, minimum essential medium; DIV, days in vitro; AM, acetoxymethyl ester; TBST, Tris-buffered saline/Tween 20; MAP, mitogen-activated protein; PCR, polymerase chain reaction; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; ANOVA, analysis of variance; ERK, extracellular signal-regulated kinase; ZM 241385, 4-(2-[7-amino-2-(2-furyl)[1,2,4]triazolo[2,3-a][1,3,5] triazin-5-yl-amino]ethyl)phenol; PP2, 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4-d]-pyrimidine; SU6656, 2-oxo-3-(4,5,6,7-tetrahydro-1H-indol-2-ylmethylene)-2,3-dihydro-1H-indole-5-sulfonic acid dimethylamide; K25+S, high potassium and 10% serum; K5-S, low potassium and no serum; PACAP, pituitary adenylate cyclase-activating peptide.

Address correspondence to: Eugene M. Johnson, Jr., 660 South Euclid Avenue, Campus Box 8103, St. Louis, MO 63110. E-mail: eugene.johnson{at}wustl.edu


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

Besset V, Scott RP, and Ibanez CF (2000) Signaling complexes and protein-protein interactions involved in the activation of the Ras and phosphatidylinositol 3-kinase pathways by the c-Ret receptor tyrosine kinase. J Biol Chem 275: 39159–39166.[Abstract/Free Full Text]
Boissiere F, Hunot S, Faucheux B, Hersh LB, Agid Y, and Hirsch EC (1997) Trk neurotrophin receptors in cholinergic neurons of patients with Alzheimer's disease. Dement Geriatr Cogn Disord 8: 1–8.[Medline]
Brodeur GM (2003) Neuroblastoma: biological insights into a clinical enigma. Nat Rev Cancer 3: 203–216.[CrossRef][Medline]
Chang LK, Putcha GV, Deshmukh M, and Johnson EM Jr (2002) Mitochondrial involvement in the point of no return in neuronal apoptosis. Biochimie (Paris) 84: 223–231.
Coffey ET, Hongisto V, Dickens M, Davis RJ, and Courtney MJ (2000) Dual roles for c-Jun N-terminal kinase in developmental and stress responses in cerebellar granule neurons. J Neurosci 20: 7602–7613.[Abstract/Free Full Text]
Creedon DJ, Tansey MG, Baloh RH, Osborne PA, Lampe PA, Fahrner TJ, Heuckeroth RO, Milbrandt J, and Johnson EM Jr (1997) Neurturin shares receptors and signal transduction pathways with glial cell line-derived neurotrophic factor in sympathetic neurons. Proc Natl Acad Sci USA 94: 7018–7023.[Abstract/Free Full Text]
Deckwerth TL, Easton RM, Knudson CM, Korsmeyer SJ, and Johnson EM Jr (1998) Placement of the Bcl-2 family member bax in the death pathway of sympathetic neurons activated by trophic factor deprivation. Exp Neurol 152: 150–162.[CrossRef][Medline]
D'Mello SR, Galli C, Ciotti T, and Calissano P (1993) Induction of apoptosis in cerebellar granule neurons by low potassium: inhibition of death by insulin-like growth factor I and cAMP. Proc Natl Acad Sci USA 90: 10989–10993.[Abstract/Free Full Text]
Deshmukh M, Vasilakos J, Deckwerth TL, Lampe PA, Shivers BD, and Johnson EM Jr (1996) Genetic and metabolic status of NGF-deprived sympathetic neurons saved by an inhibitor of ICE family proteases. J Cell Biol 135: 1341–1354.[Abstract/Free Full Text]
Gallo V, Kingsbury A, Balazs R, and Jorgensen OS (1987) The role of depolarization in the survival and differentiation of cerebellar granule cells in culture. J Neurosci 7: 2203–2213.[Abstract]
Grimes CA and Jope RS (2001) The multifaceted roles of glycogen synthase kinase-3{beta} in cellular signaling. Prog Neurobiol 65: 391–426.[CrossRef][Medline]
Harris C, Maroney AC, and Johnson EM Jr (2002a) Identification of JNK-dependent and -independent components of cerebellar granule neuron apoptosis. J Neurochem 83: 992–1001.[CrossRef][Medline]
Harris CA, Deshmukh M, Tsui-Pierchala B, Maroney AC, and Johnson EM Jr (2002b) Inhibition of the c-Jun N-terminal kinase signaling pathway by the mixed lineage kinase inhibitor CEP-1347 (KT7515) preserves metabolism and growth of trophic factor-deprived neurons. J Neurosci 22: 103–113.[Abstract/Free Full Text]
Hempstead BL, Rabin SJ, Kaplan L, Reid S, Parada LF, and Kaplan DR (1992) Overexpression of the Trk tyrosine kinase rapidly accelerates nerve growth factor-induced differentiation. Neuron 9: 883–896.[CrossRef][Medline]
Johnson MI and Argiro V (1983) Techniques in the tissue culture of rat sympathetic neurons. Methods Enzymol 103: 334–347.[Medline]
Koizumi S, Contreras ML, Matsuda Y, Hama T, Lazarovici P, and Guroff G (1988) K-252a: a specific inhibitor of the action of nerve growth factor on PC12 cells. J Neurosci 8: 715–721.[Abstract]
Lazarovici P and Fink D Jr (1999) Heterologous upregulation of nerve growth factor-TrkA receptors in PC12 cells by pituitary adenylate cyclase-activating polypeptide (PACAP). Mol Cell Biol Res Commun 2: 97–102.[CrossRef][Medline]
Lee FS and Chao MV (2001) Activation of Trk neurotrophin receptors in the absence of neurotrophins. Proc Natl Acad Sci USA 98: 3555–3560.[Abstract/Free Full Text]
Lee FS, Rajagopal R, Kim AH, Chang PC, and Chao MV (2002) Activation of Trk neurotrophin receptor signaling by pituitary adenylate cyclase-activating polypeptides. J Biol Chem 277: 9096–9102.[Abstract/Free Full Text]
Levi G, Aloisi F, Ciotti MT, and Gallo V (1984) Autoradiographic localization and depolarization-induced release of acidic amino acids in differentiating cerebellar granule cell cultures. Brain Res 290: 77–86.[CrossRef][Medline]
Maroney AC, Finn JP, Bozyczko-Coyne D, O'Kane TM, Neff NT, Tolkovsky AM, Park DS, Yan CY, Troy CM, and Greene LA (1999) CEP-1347 (KT7515), an inhibitor of JNK activation, rescues sympathetic neurons and neuronally differentiated PC12 cells from death evoked by three distinct insults. J Neurochem 73: 1901–1912.[Medline]
Maroney AC, Glicksman MA, Basma AN, Walton KM, Knight E Jr, Murphy CA, Bartlett BA, Finn JP, Angeles T, Matsuda Y, et al. (1998) Motoneuron apoptosis is blocked by CEP-1347 (KT 7515), a novel inhibitor of the JNK signaling pathway. J Neurosci 18: 104–111.[Abstract/Free Full Text]
Miller TM, Moulder KL, Knudson CM, Creedon DJ, Deshmukh M, Korsmeyer SJ, and Johnson EM Jr (1997a) Bax deletion further orders the cell death pathway in cerebellar granule cells and suggests a caspase-independent pathway to cell death. J Cell Biol 139: 205–217.[Abstract/Free Full Text]
Miller TM, Tansey MG, Johnson EM Jr, and Creedon DJ (1997b) Inhibition of phosphatidylinositol 3-kinase activity blocks depolarization- and insulin-like growth factor I-mediated survival of cerebellar granule cells. J Biol Chem 272: 9847–9853.[Abstract/Free Full Text]
Murakata C, Kaneko M, Gessner G, Angeles TS, Ator MA, O'Kane TM, McKenna BA, Thomas BA, Mathiasen JR, Saporito MS, et al. (2002) Mixed lineage kinase activity of indolocarbazole analogues. Bioorg Med Chem Lett 12: 147–150.[CrossRef][Medline]
Nye SH, Squinto SP, Glass DJ, Stitt TN, Hantzopoulos P, Macchi MJ, Lindsay NS, Ip NY, and Yancopoulos GD (1992) K-252a and staurosporine selectively block autophosphorylation of neurotrophin receptors and neurotrophin-mediated responses. Mol Biol Cell 3: 677–686.[Abstract]
Obermeier A, Bradshaw RA, Seedorf K, Choidas A, Schlessinger J, and Ullrich A (1994) Neuronal differentiation signals are controlled by nerve growth factor receptor/Trk binding sites for Shc and PLC{gamma}. EMBO (Eur Mol Biol Organ) J 13: 1585–1590.[Medline]
Pierchala BA, Ahrens RC, Paden AJ, and Johnson EM Jr (2004) Nerve growth factor promotes the survival of sympathetic neurons through the cooperative function of the protein kinase C and phosphatidylinositol 3-kinase pathways. J Biol Chem 279: 27986–27993.[Abstract/Free Full Text]
Putcha GV, Moulder KL, Golden JP, Bouillet P, Adams JA, Strasser A, and Johnson EM Jr (2001) Induction of BIM, a proapoptotic BH3-only Bcl-2 family member, is critical for neuronal apoptosis. Neuron 29: 615–628.[CrossRef][Medline]
Roux PP, Dorval G, Boudreau M, Angers-Loustau A, Morris SJ, Makkerh J, and Barker PA (2002) K252a and CEP1347 are neuroprotective compounds that inhibit mixed-lineage kinase-3 and induce activation of Akt and Erk. J Biol Chem 277: 49473–49480.[Abstract/Free Full Text]
Saporito MS, Hudkins RL, and Maroney AC (2002) Discovery of CEP-1347/KT-7515, an inhibitor of the JNK/SAPK pathway for the treatment of neurodegenerative diseases. Prog Med Chem 40: 23–62.[Medline]
Shalizi A, Lehtinen M, Gaudilliere B, Donovan N, Han J, Konishi Y, and Bonni A (2003) Characterization of a neurotrophin signaling mechanism that mediates neuron survival in a temporally specific pattern. J Neurosci 23: 7326–7336.[Abstract/Free Full Text]
Skaper SD, Floreani M, Negro A, Facci L, and Giusti P (1998) Neurotrophins rescue cerebellar granule neurons from oxidative stress-mediated apoptotic death: selective involvement of phosphatidylinositol 3-kinase and the mitogen-activated protein kinase pathway. J Neurochem 70: 1859–1868.[Medline]
Sommerfeld MT, Schweigreiter R, Barde YA, and Hoppe E (2000) Down-regulation of the neurotrophin receptor TrkB following ligand binding. Evidence for an involvement of the proteasome and differential regulation of TrkA and TrkB. J Biol Chem 275: 8982–8990.[Abstract/Free Full Text]
Tapley P, Lamballe F, and Barbacid M (1992) K252a is a selective inhibitor of the tyrosine protein kinase activity of the Trk family of oncogenes and neurotrophin receptors. Oncogene 7: 371–381.[Medline]
Tsui-Pierchala BA, Ahrens RC, Crowder RJ, Milbrandt J, and Johnson EM Jr (2002) The long and short isoforms of Ret function as independent signaling complexes. J Biol Chem 277: 34618–34625.[Abstract/Free Full Text]
Tsui-Pierchala BA, Putcha GV, and Johnson EM Jr (2000) Phosphatidylinositol 3-kinase is required for the trophic, but not the survival-promoting, actions of NGF on sympathetic neurons. J Neurosci 20: 7228–7237.[Abstract/Free Full Text]
Wang LH, Besirli CG, and Johnson EM Jr (2004) Mixed lineage kinases: a target for the prevention of neurodegeneration. Annu Rev Pharmacol Toxicol 44: 451–474.[CrossRef][Medline]
Xue L, Murray JH, and Tolkovsky AM (2000) The Ras/phosphatidylinositol 3-kinase and Ras/Erk pathways function as independent survival modules each of which inhibits a distinct apoptotic signaling pathway in sympathetic neurons. J Biol Chem 275: 8817–8824.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
E. Towers, J. Gilley, R. Randall, R. Hughes, M. Kristiansen, and J. Ham
The proapoptotic dp5 gene is a direct target of the MLK-JNK-c-Jun pathway in sympathetic neurons
Nucleic Acids Res., May 1, 2009; 37(9): 3044 - 3060.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
S. S. Bedi, D. Cai, and D. L. Glanzman
Effects of Axotomy on Cultured Sensory Neurons of Aplysia: Long-Term Injury-Induced Changes in Excitability and Morphology Are Mediated by Different Signaling Pathways
J Neurophysiol, December 1, 2008; 100(6): 3209 - 3224.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
L. H. Wang, E. M. Johnson Jr, I. Shoulson, A. E. Lang, D. Bozyczko-Coyne, and On behalf of the Parkinson Study Group PRECEPT Inv
MIXED LINEAGE KINASE INHIBITOR CEP- 1347 FAILS TO DELAY DISABILITY IN EARLY PARKINSON DISEASE
Neurology, August 5, 2008; 71(6): 462 - 463.
[Full Text] [PDF]


Home page
J. Neurosci.Home page
X. Chen, M. Rzhetskaya, T. Kareva, R. Bland, M. J. During, A. W. Tank, N. Kholodilov, and R. E. Burke
Antiapoptotic and Trophic Effects of Dominant-Negative Forms of Dual Leucine Zipper Kinase in Dopamine Neurons of the Substantia Nigra In Vivo
J. Neurosci., January 16, 2008; 28(3): 672 - 680.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Mishra, M. K. Barthwal, G. Sondarva, B. Rana, L. Wong, M. Chatterjee, J. R. Woodgett, and A. Rana
Glycogen Synthase Kinase-3beta Induces Neuronal Cell Death via Direct Phosphorylation of Mixed Lineage Kinase 3
J. Biol. Chem., October 19, 2007; 282(42): 30393 - 30405.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H. K. Wong, M. Fricker, A. Wyttenbach, A. Villunger, E. M. Michalak, A. Strasser, and A. M. Tolkovsky
Mutually Exclusive Subsets of BH3-Only Proteins Are Activated by the p53 and c-Jun N-Terminal Kinase/c-Jun Signaling Pathways during Cortical Neuron Apoptosis Induced by Arsenite
Mol. Cell. Biol., October 1, 2005; 25(19): 8732 - 8747.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.104.077800v1
312/3/1007    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, L. H.
Right arrow Articles by Johnson, E. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, L. H.
Right arrow Articles by Johnson, E. M., Jr.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition