JPET Assistant Professor of Medicine (Clinician-Educator)

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Journal of Pharmacology And Experimental Therapeutics Fast Forward
First published on July 27, 2004; DOI: 10.1124/jpet.104.069724


0022-3565/04/3113-1179-1187$20.00
JPET 311:1179-1187, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.104.069724v1
311/3/1179    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takane, H.
Right arrow Articles by Ieiri, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takane, H.
Right arrow Articles by Ieiri, I.

ABSORPTION, DISTRIBUTION, METABOLISM, AND EXCRETION

Haplotype-Oriented Genetic Analysis and Functional Assessment of Promoter Variants in the MDR1 (ABCB1) Gene

Hiroshi Takane, Daisuke Kobayashi, Takeshi Hirota, Junzo Kigawa, Naoki Terakawa, Kenji Otsubo, and Ichiro Ieiri

Department of Hospital Pharmacy, Faculty of Medicine, Tottori University, Yonago, Japan (H.T., K.O., I.I.); Department of Clinical Pharmacology, Division of Pharmaceutical Sciences, Graduate School, Kyushu University, Fukuoka, Japan (D.K.); Department of Clinical Pharmacokinetics, Division of Pharmaceutical Sciences, Graduate School, Kyushu University, Fukuoka, Japan (T.H.); and Department of Obstetrics and Gynecology, Faculty of Medicine, Tottori University, Yonago, Japan (J.K., N.T.)

Received April 9, 2004; accepted July 27, 2004.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Recently, a number of nucleotide variants have been described in the multidrug resistance 1 (MDR1/ABCB1) gene; however, most studies have focused on the coding region. In the present study, we identified promoter variants of the MDR1 gene and evaluated their phenotypic consequences using a reporter gene assay and the real-time polymerase chain reaction method. Ten allelic variants were detected in the promoter region (approximately 2 kilobases), seven of which were newly identified. Certain mutations occurred simultaneously, and a total of 10 haplotypes were observed. These promoter polymorphisms were found more frequently in Japanese than Caucasians. Some haplotypes were associated with changes in luciferase activity and placental and hepatic mRNA levels. We also determined DNA methylation status in the proximal promoter region of the MDR1 gene. The promoter region around potential binding sites for transcription factors was found to be hypomethylated and thus likely to be independent of the gene expression. Nucleotide and/or haplotype variants not only in the coding region but also in the promoter region of the MDR1 gene may be important for interindividual differences of P-glycoprotein expression.


Polymorphisms in the genes encoding membrane transporters have recently been reported to be associated with variations in the pharmacokinetic and pharmacological effects of clinically used drugs (Fromm, 2002Go; Kim and Tirona, 2002Go; Takane et al., 2003Go). Among various drug transporters, P-glycoprotein, the multidrug resistance 1 (MDR1/ABCB1) gene product, is one of the best studied. P-glycoprotein is expressed in various human tissues such as the intestine, liver, and kidney, and functions as a cellular efflux pump for foreign xenobiotics and endogenous substrates.

Although a number of nucleotide variants have been described in the MDR1 gene, most studies in this area have focused on the association of single nucleotide polymorphisms (SNPs) in the coding region with the altered expression of P-glycoprotein or pharmacokinetics of clinically used drugs. Hoffmeyer et al. (1999Go) demonstrated that the synonymous C3435T polymorphism (Ile1145Ile) in exon 26 was associated with a low level of expression of P-glycoprotein in the duodenum, resulting in an increase in plasma concentrations after oral administration of digoxin, used as a probe for P-glycoprotein. In contrast, higher level of duodenum P-glycoprotein expression and lower level of serum digoxin after oral administration were observed in the subjects with this variant (Sakaeda et al., 2001Go; Nakamura et al., 2002Go). The association of the C3435T polymorphism with P-glycoprotein protein expression and function is controversial. Up to now, various investigators have reported that the variant is associated with decreased or increased expression, or it has no clearly discernible effect (Sparreboom et al., 2003Go; Ishikawa et al., 2004Go). In a recent report, an approach using genebased haplotypes, which are specific combinations of SNPs located throughout the genome, proved superior to the use of individual SNPs for predicting the association between phenotypes and genomic variation (Judson et al., 2000Go). For example, Drysdale et al. (2000Go) reported that the bronchodilator response to {beta} agonist is significantly related to haplo-type pairs of the {beta}2-adrenergic receptor gene but not to individual SNPs. With regard to the MDR1 gene, Johne et al.(2002Go) indicated that it was important to consider the variability in haplotype structure rather than in SNPs when characterizing the MDR1 phenotype. However, the association of variants in the promoter region of the MDR1 gene with the expression of P-glycoprotein has been not well investigated.

DNA methylation, referred to as the methylation of cytosine in a cytosine-guanosine pair (CpG), is the most common eukaryotic DNA modification and one of many epigenetic (an alteration in gene expression without a change in nucleotide sequence) phenomena (Singal and Ginder, 1999Go). Normally, both the core promoter and transcriptional start site are included within the CpG-rich region, and DNA methylation regulates gene expression by interfering with the binding of specific transcription factors to their recognition sites (Singal and Ginder, 1999Go; Jones and Takai, 2001Go). Interestingly, the human MDR1 gene has a CpG-rich promoter region. Hypomethylation of MDR1 during chemotherapy resulted in a high level of gene expression in recurrent tumors, and it had important consequences for clinical outcome in acute myeloid leukemias (Nakayama et al., 1998Go) and bladder cancer (Toda et al., 2000Go). However, there is currently no data available on the role of DNA methylation in transcriptional regulation in normal tissues.

The aim of this study was to describe variants in the promoter region of MDR1 in Japanese and Caucasian populations and to evaluate their functional significance with regard to transcriptional activity and mRNA expression in placentas and livers obtained from Japanese subjects. Furthermore, we determined the methylation status of the promoter region of MDR1 and its association with the interindividual variability in gene expression in normal tissue.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Isolation of Genomic DNA and RNA. Human full-term placentas (highly enriched placental trophoblast populations) and livers were obtained from 96 and 19 Japanese patients, respectively. These tissues were immediately frozen in liquid nitrogen and stored at -80°C for the preparation of DNA and RNA. Blood samples were obtained from 96 healthy Caucasian volunteers. Genomic DNA from the samples was prepared using the Toyobo blood kit on a Toyobo HMX-2000 robot (Toyobo, Osaka, Japan). The isolation of genomic DNA from tissues was performed using a DNA preparation kit (QIAamp DNA mini kit; QIAGEN GmbH, Hilden, Germany). Total RNA was extracted using ISOGEN (Nippongene, Tokyo, Japan), and reverse transcription was performed with random hexamers (Promega, Madison, WI) and reverse transcriptase (Invitrogen, Carlsbad, CA). This study was approved by the Tottori University Ethics Committee, and informed consent was obtained from all individuals.

Identification of Variants in the MDR1 Promoter Region. The genotypes of MDR1 such as A–41aG, C–145G, T–129C, and C3435T were identified by PCR-restriction fragment length polymorphism analysis as described previously (Tanabe et al., 2001Go). To identify unknown mutations in the MDR1 promoter region, SSCP analysis was performed using the GenePhor system (Amersham Biosciences AB, Uppsala, Sweden) as described previously (Ieiri et al., 2000Go). PCR was performed in a total volume of 25 µl consisting of 50 ng of genomic DNA, 10x PCR buffer II, 1.5 mM MgCl2, 1.25 U of Amplitaq Gold DNA polymerase (Applied Biosystems, Foster City, CA), and 0.25 µM of each primer. The primer sets were designed to divide the promoter region (-1700a to Ex1/+88) of the MDR1 gene (GenBank accession no. AC002457 [GenBank] ) into five fragments (~500 bp). After an initial denaturation at 94°C for 5 min, 45 cycles of 40 s at 94°C, 45 s at 50 to 59°C, and 1 min at 72°C, as well as a final extension period of 5 min at 72°C, were performed.

Haplotype Analysis. A 2112-bp fragment, including the promoter region of MDR1 (-1700a to Ex1/+88), was amplified by using gene-specific primers (5'-GGAGCAAAGAAATGGAATACAATA-3' and 5'-TTCTCCCGTGAAGACCAAGTTC-3'). The PCR mixture was essentially the same as for the identification of mutations except for the Taq polymerase (LA Taq; Takara, Shiga, Japan). After an initial denaturation at 94°C for 5 min, 45 cycles of 40 s at 94°C, 15 s at 58.3°C, and 1 min at 72°C, as well as a final extension period of 5 min at 72°C, were performed. The PCR fragments were subcloned into pGEM-T easy vector (Promega) and sequenced.

DNA Sequence. All PCR products were sequenced directly on an ABI 377 automatic sequencer (Applied Biosystems) using a Big-Dye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems). Before the sequencing, reaction mixtures were purified with a DyeEx Spin kit (QIAGEN GmbH). The sequencing primers were those used in the PCR amplifications. The sequencing of both strands was performed for products from at least two independent PCR amplifications to ensure that the identified mutations identified were not PCR-induced artifacts.

Real-Time Quantitative PCR (TaqMan) Analysis. PCR was performed using a master mix based on the TaqMan universal PCR master mix (Applied Biosystems) and run on the ABI PRISM 7000 sequence detection system (Applied Biosystems). The following primers and TaqMan probe were used for determining the MDR1 mRNA: forward primer, 5'-TATCAGCAGCCCACATCATCA T-3'; reverse primer, 5'-CCAAATGTGACATTTCCTTCCA-3'); and probe, 5'-TACAGCACGGAAGGCCTAATGCCGA-3'. The endogenous reference gene was determined using the commercially available human GAPDH TaqMan Predeveloped Assay Reagent (Applied Biosystems). Each primer set and TaqMan probe were used at final concentrations of 200 and 100 nM, respectively. The reactions were run in duplicate. For all experimental samples, the amount of mRNA was determined from a standard curve (serial diluted samples from placental tissue expressed at higher levels of MDR1 and GAPDH mRNA). The mRNA level of MDR1 was expressed as a ratio to that of GAPDH.

Plasmid Construction. To obtain the first plasmid, a 2056-bp fragment (-1704a to Ex1/+28) of MDR1, including the promoter region and exon 1, was initially amplified from genomic DNA with gene-specific primers incorporating 5'-KpnI and 3'-NheI, for the 5' end of inserts 5'-CGGGGTACCGGAGCAAAGAAATGGAATACA-3' and for the 3' end of inserts 5'-CTAGCTAGCAGTAGCTCCCAGCTTTGCGTG-3'. The PCR fragment was subcloned into the pGEM-T easy vector and then introduced into competent JM109 cells (Promega). The plasmids obtained were sequenced and digested with KpnI and NheI. The digested fragment was ligated into the KpnI/NheI site of the vector pGL3-enhancer (Promega). Manipulated DNA portions were sequenced again in their entirety.

Cell Culture and Transfection. HepG2 human hepatoma cells were incubated at 37°C under 5% CO2 in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. One day before transfection, cells (5.5 x 105) were seed into culture plates (60 mm). The cells were washed two times with serum-free medium. The luciferase reporter gene constructs (5 µg) and the control reporter gene plasmid pRL-TK vector (0.5 µg) (Promega) were mixed with the Tfx-20 reagent (15 µl) (Promega), transferred to serum-free medium, and then incubated at room temperature for 15 min. The mixtures were added to the washed cells and incubated for 1 h at 37°C under 5% CO2. After the incubation, the cells were cultured in growth medium and harvested after 48 h.

Assay of Luciferase Activity. Luciferase reporter gene activity was evaluated with the Dual luciferase reporter assay system (Promega). HepG2 cells were washed once with a phosphate-buffered saline solution and lysed in passive lysis buffer (400 µl). After incubation at 37°C for 15 min, lysates were mixed in a vortex blender for 15 s and centrifuged at 4°C for 30 s. Supernatants (20 µl) were mixed with the luciferase reagent (100 µl), and the luciferase activity was measured with a luminometer (Turner Designs, Sunnyvale, CA). After background correction (activity in untreated cells), results were expressed as the level of pGL3 activity divided by pRL activity. The total cellular protein concentration was determined using the Bio-Rad protein assay (Bio-Rad, Hercules, CA).

Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts from HepG2 cells were prepared as reported previously (Takeuchi et al., 2000Go). Oligonucleotides for the MDR1 gene, including -1517a T (ACTGTTTAGGGAGGGTTTAAGGCCATTCAAA), -1517a C (ACTGTTTAGGGAGGGCTTAAGGCCATTCAAA), -1459a G (ATAAATGAAAGGTGAGATAAAGCAACAAAGC), -1459a A (ATAAATGAAAGGTGAAATAAAGCAACAAAGC), -1017a T (GAGGCAGGAGAATGGTGTGAACCCGGGAGGC), -1017a C (GAGGCAGGAGAATGGCGTGAACCCGGGAGGC), -145 C/-129 C (CTTTGCCACAGGAAGCCTGA GCTCATTCGAGTAGCGGCTCTTCCAAG), -145 G/-129 T (CTTTGCCACAGGAAGGCTGAGCTCATTCGAGTAGCGGCTCTTCCAAG) and -145 C/-129 C (CTTTGCCACAGGAAGCCTGAGCTCATTCGAGCAGCGGCTCTTCCAAG) were synthesized with both sense and antisense strands, the corresponding pairs of which were annealed and end-labeled with T4 polynucleotide kinase (Takara) and [{gamma}-32P]dATP (Amersham Biosciences AB) according to standard methodology. The {gamma}-32P-labeled probe (1 x 104 cpm) was incubated for 30 min at 0°C with nuclear protein (5 µg) in binding buffer (10 µl) containing 25 mM Hepes (pH 7.9), 40 mM KCl, 5 mM MgCl2, 0.1 mM EDTA, 7.5% glycerol, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 0.1% Nonidet-40, 5 µM ZnSO4, 0.2 µg of poly(dI-dC), and 1 µg of bovine albumin. Competitor oligonucleotides were added at 100-fold molar excesses. Reaction mixtures were electrophoresed on 5% polyacrylamide and 2.5% glycerol gel in a Tris-glycine-EDTA buffer (250 mM Tris, 1.9 M glycine, and 10 mM EDTA) at 4°C and visualized by a BAS-2500 Imaging Analyzer (Fuji Film, Tokyo, Japan).

Determination of Methylation. The methylation status of CpG sites within the proximal promoter region of MDR1 was confirmed using the bisulfite sequencing method (Frommer et al., 1992Go). DNA was treated with sodium bisulfite using a CpGenome DNA modification kit (Intergen, Purchase, NY) according to the manufacturer's instructions. PCR (578 bp, -214a to Ex1/+40) was performed in a total volume of 25 µl consisting of 50 ng of bisulfite-modified genomic DNA, 0.625 to 2.5 U of Amplitaq Gold DNA polymerase, and 0.25 µM of each primer, 5'-AAGGTGTTAGGAAGTAGAAAGGT-3' and 5'-AAA CTATCCCATAATAACTCCCAA-3'. After an initial denaturation at 95°C for 5 min, 35 cycles of 45 s at 95°C, 45 s at 55°C, and 1 min at 72°C, as well as a final extension period of 5 min at 72°C, were performed. The PCR product was cloned into the pGEM-T easy vector according to the manufacturer's instructions. The CpG methylation status of individual DNA strands was determined based on a comparison with the sequence obtained from the genomic DNA without the addition of bisulfite modifications. The number of methylated CpGs at a specific site was divided by the number of clones analyzed (N > 15) to yield percentage of methylation for each site.

Statistical Analysis. The 95% confidence interval was calculated to compare the differences in genotype or haplotype frequencies between Japanese and Caucasians. Results of MDR1 mRNA expression and mutation (C3435T) were analyzed with a Kruskal-Wallis test. Comparisons between two groups were performed using a Mann-Whitney U test. A 5% level of probability was considered to be significant.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Identification of Variants in the Promoter Region of the MDR1 Gene. Ten variants were detected in the promoter region of the human MDR1 gene by PCR-SSCP analysis using DNAs obtained from unrelated Japanese and Caucasian subjects (Fig. 1; Table 1). Seven variants, at positions -1517a, -1459a, -1423a, -1132a, -1017a, -824a, and -755a, were newly identified in this study. The most common mutation in Japanese was G–1459aA (allelic frequency 0.250), whereas A–41aG (0.106), T–1517aC (0.080), T–1017aC (0.080), T–129C (0.080) were found at low frequency. The 5-base deletion at position –1132a to –1128a, C–145G and T–824aC were detected at extremely low frequency (0.037, 0.032, and 0.005, respectively). The frequencies of T–1017aC and T–129C were significantly lower in Caucasians than Japanese (P < 0.05). The two-base deletion at position -1423a to -1422a and A–755aG were identified only in Caucasian subjects, but at frequencies below 0.010. In contrast, T–1517aC, G–1459aA, a five-base deletion at position -1132a to -1128a, T–824aC, A–41aG, and C–145C were not detected in Caucasian subjects. These results indicate that genotypic frequencies of variants in the promoter region of the MDR1 gene seemed to be dependent on race.



View larger version (72K):
[in this window]
[in a new window]
 
Fig. 1. Nucleotide sequence of the human MDR1 gene promoter. Positions of nucleotide variants are in bold and are underlined. The exons are boxed. The location of variants in the coding region is relative to the initiation site for translation, which is defined as +1 based on the cDNA nucleotide sequence. The position in the promoter region is relative to the nucleotide sequence immediately preceding exon 1, which is defined as -1a.

 

View this table:
[in this window]
[in a new window]
 
TABLE 1 Variants in promoter region of the MDR1 gene in Japanese (n = 94) and Caucasian (n = 96) subjects

 

Identification of MDR1 Promoter Haplotypes. On the basis of a haplotype analysis using subcloning and direct sequencing, 10 haplotypes derived from all identified promoter variants were found to be present in both populations (Table 2). In Japanese, seven haplotypes were identified with a frequency ranging from 0.005 to 0.665. Unlike in Caucasians, three variants at -1517a, -1017a, and -129 occurred simultaneously in Japanese. In total, 13 different haplotype pairs were found in the subjects examined (Table 3). In Caucasians, the most common haplotype pair was 1/1 (0.923). In contrast, hetero- or homogenous combinations of haplotypes with one or more variant sites were found at a relatively high frequency in Japanese compared with Caucasians (0.553 versus 0.077).


View this table:
[in this window]
[in a new window]
 
TABLE 2 Localization of variants and identification of the MDR1 promoterhaplo types in Japanese and Caucasian subjects

 

View this table:
[in this window]
[in a new window]
 
TABLE 3 Haplotype configurations in promoter region of the MDR1 gene in Japanese and Caucasian subjects

 

Association of MDR1 Promoter Haplotypes with mRNA Expression in Placenta and Liver. Before investigating the influence of MDR1 promoter haplotype combinations on mRNA expression in placental and hepatic tissues, we determined whether the C3435T variant influences MDR1 mRNA expression. As shown in Fig. 2, the synonymous C3435T polymorphism in exon 26 was associated with a low level of placental MDR1 expression (P < 0.05; Kruskal-Wallis test). Next, we compared MDR1 promoter haplotype pairs (haplotypes 1/1, 1/2, 1/3, 1/4, and 4/4) with corresponding placental and hepatic MDR1 levels in 29 and 11 samples with the 3435 C/C and C/T genotype, respectively (Fig. 2). The MDR1 expression in placental tissue with haplotype 1/2 or 1/3 tended to increase compared with that in 1/1 samples (P = 0.091; Mann-Whitney U test; Fig. 2). However, mean mRNA levels in hetero- and homogygous samples for haplotype 4 was comparable with those in 1/1 samples. Also, the MDR1 expression in hepatic tissue of haplotype 1/2 or 1/3 tended to increase compared with that in 1/1 samples (P = 0.07; Mann-Whitney U test; Fig. 2).



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 2. Influence of MDR1 promoter haplotypes and SNPs in the coding region on placental and hepatic MDR1 mRNA levels in Japanese. Statistical significance between the two genotypes was analyzed with the Mann-Whitney U test.

 

Luciferase Reporter Gene Assay. To investigate the influence of promoter haplotypes on the potential for transcriptional regulation, 10 reporter plasmids containing MDR1 promoter sequences were transiently transfected in HepG2 cells, and then luciferase activities were measured. As shown in Fig. 3, haplotypes 2, 3, and 9 increased the luciferase activity by 41, 32, and 30%, respectively, compared with that by haplotype 1. In contrast, the haplotype 6 construct resulted in a 28% reduction in activity. Other haplotypes did not seem to influence the activity.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 3. MDR1 promoter region reporter gene constructs and their relative luciferase activity levels. The value for the haplotype 1 construct was set at 100%. Each value is the mean ± S.D. of relative luciferase activity from four to five experiments.

 

Binding of Nuclear Proteins to the Promoter Variant Sites. To determine whether the variants in the promoter region altered binding for transcription factors, we performed EMSA using nuclear extracts prepared from HepG2 cells. By competition assays using an excess of unlabeled probe, allele-specific binding of nuclear proteins was observed when the nuclear extracts were incubated with probes, including -1517a C (complex I) and -1459a G (complex II) (Fig. 4, A and B). Also, strong nuclear protein-DNA binding (complex III) was observed with the probe containing the -1017a T allele when compared with the -1017a C allele (Fig. 4C). The higher binding completely disappeared under an excess of unlabeled -1017a T probe, and weaker inhibition of the binding was observed with the -1017a C probe. With the -145/-129 C/T and G/T probes, nuclear protein-DNA binding (complex VI) was detected, but with the C/C probe it was not detected or was much weaker (Fig. 4D). The protein-DNA binding was completely inhibited by an excess of unlabeled C/T and G/T probes, and slightly competed with by an excess of unlabeled C/C probe. No nuclear protein-DNA binding was observed when the probes containing the -41a A/G and -145 G/C alleles were incubated with nuclear extracts.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 4. EMSA analysis with oligonucleotides corresponding to variants (A, T-1517aC; B, G-1459aA; C, T-1017aT; and D, C-145G and T-129C) in the MDR1 gene promoter. The nuclear extracts (NE; 5 µg of protein) from HepG2 cells were incubated with 32P-labeled oligonucleotides. Specificity of nuclear protein binding was demonstrated by a 100-fold molar excess of unlabeled oligonucleotide. Data are representative of three similar experiments.

 

Correlation between Placental MDR1 mRNA Expression and Methylation Status at CpG Sites in the MDR1 Promoter Region. The proximal region of the human MDR1 is rich in CpG (Fig. 5A). This region including the Y box and GC box elements is required for activation of the MDR1 promoter. We focused on the CpG-rich proximal promoter region in the MDR1 gene and determined the relationship between methylation status at each CpG site and MDR1 mRNA expression using placenta with promoter haplotype 1/1 and 3435 C/C genotypes. Results of a bisulfite sequencing analysis of 26 CpG sites in seven subjects, whose MDR1 levels varied considerably, are shown in Fig. 5B. In all samples, methylated CpG sites were found upstream of the promoter region. Moreover, an interindividual difference in methylation status was observed; however, no clear association was observed. In addition, methylation was not observed around either the Y box or GC box element in most samples.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5. A, location of CpG sites in the MDR1 promoter region. The CpG sites are represented by short vertical bars. B, methylation status of individual sites of the MDR1 promoter region and mRNA expression in placental tissues with the promoter haplotype 1/1 and 3435 C/C genotypes.

 


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Despite evidence supporting an association of coding SNPs with pharmacokinetics and pharmacodynamics, little is known about the presence or functional relevance of allelic variants in the promoter region of MDR1. We described 10 polymorphic variants in the MDR1 promoter in Japanese and Caucasian populations. A–41aG, C–145G, and T–129C have been detected in the proximal promoter region of the MDR1 gene as low frequency variants (Horinouchi et al., 2002Go; Tang et al., 2002Go; Kroetz et al., 2003Go). Here, we identified another seven variants. Their presence and frequency varied according to race. For example, C–145G was identified in Asian-Americans but not Caucasians (Kroetz et al., 2003Go). In the present study, this variant was observed only in Japanese. In addition, the new G–1459aA variant was the most frequent variant in Japanese (25.0%), but was not found in Caucasians.

The promoter region of the MDR1 gene has been isolated and sequenced (Ueda et al., 1987Go; Madden et al., 1993Go). The promoter has an initiator sequence at the transcriptional start site, without a TATA box (van Groenigen et al., 1993Go). Numerous studies have shown that the Y box (inverted CCAAT box) and GC box, recognized by the transcription factors NF-Y and Sp1, respectively, are required for efficient transcriptional regulation of the MDR1 promoter (Goldsmith et al., 1993Go; Sundseth et al., 1997Go). Several studies suggest that a region upstream of the Y box negatively regulates the MDR1 promoter activity (Ogura et al., 1992Go; Cornwell and Smith, 1993Go), although the exact positions of the negative element differ. However, our variants are not located within those cis-elements.

We identified 10 different MDR1 promoter haplotypes using subcloning and direct sequencing methods. A comparison of MDR1 haplotype pairs with placental and hepatic expression showed that haplotypes 1/2 and 1/3 were associated with increased mRNA expression, independent of the C3435T mutation in the coding region. Interestingly, haplotypes 2 and 3, in which T–1517a C, T–1017aC, and T–129C mutations occurred simultaneously in both populations, were associated with an increase in transcriptional activity in human hepatoma cell line. Moreover, we showed that the T–1517aC, T–1017aC, and T–129C variants affected putative transcriptional protein-DNA binding. Heterozygosity for the –129C allele is associated with a high level of transport activity of P-glycoprotein in hematopoietic stem cells (Calado et al., 2002Go). The tacrolimus oral dose requirement is higher in renal transplant recipients with the T/C allele than T/T allele at position –129 (Anglicheau et al., 2003Go). Although these findings are not significant because the T–129C variant was rare, the C allele at position –129 may be associated with high level of expression of P-glycoprotein, resulting in an increase in transport activity and then a decrease in tacrolimus bioavailability after oral administration. In contrast to these haplotypes, haplotype 6 (G–1459aA and C–145G variant) was associated with a low level of transcriptional activity in hepatoma cells. We found that the G–1459aA variant inhibits the binding of unknown transcriptional factor to DNA. Therefore, allelic variants not only in the coding region but also in the promoter region of the MDR1 gene, may be important to the interindividual difference in P-glycoprotein expression.

We determined the interindividual difference in methylation status in the proximal promoter region of the MDR1 gene using seven placentas whose mRNA levels varied considerably. Extensive methylation of the MDR1 gene assembled into chromatin enriched with methylated CpG binding protein interfered with the binding of transcription factors to their elements, resulting in transcriptional repression of the gene (Jin and Scotto, 1998Go; El-Osta et al., 2002Go). In this study, the region upstream of the promoter region was relatively well methylated, but individual differences in methylation status were unlikely to cause large variation in MDR1 mRNA expression. Nakayama et al. (1998Go) reported that methylation at CpG sites near the Y box was important for MDR1 gene expression and was associated closely with clinical outcome in acute myeloid leukemia. However, we did not find any methylation around either the Y box or GC box element. Similar results for methylation status in the promoter region have been reported in CD8-positive cells (Fryxell et al., 1999Go). The element Sp1 protects the promoter from de novo methylation (Brandeis et al., 1994Go). Macleod et al. (1994Go, 1998Go) have suggested that the presence of a functional element within the GC-rich domain maintains the methylation-free status. Accordingly, although the proximal promoter of the MDR1 gene is important for regulating basal gene expression in normal human tissues, epigenetic status seems not to be associated with variability in the transcriptional activity of the MDR1 gene.

In conclusion, we identified various variants in the promoter of the MDR1 gene and investigated their effects on transcriptional activity and mRNA expression in the placenta. Among these variants, the promoter haplotypes containing T–1517aC, T–1017aC, and T–129C were particularly associated with high level of transcriptional activity and mRNA expression but independently of the coding SNP C3435T. Because these promoter haplotypes or SNPs are found at a relatively low frequency in Japanese and Caucasian populations, further study is needed to establish the impact of their allelic variants on drug disposition and responses in clinical situations. Interestingly, one study has shown a possibility of regulation by tissue-specific factors for the MDR1 gene expression (Kohno et al., 1990Go). Also, Sundseth et al. (1997Go) have reported that an element just upstream of the Y box had opposite effects in different human carcinoma cell lines. Their results suggest that allelic variants in the promoter region of the MDR1 gene contribute to the polymorphic expression of P-glycoprotein in a tissue-specific manner. Future studies may need to estimate the influence of MDR1 promoter variants on transcriptional activity in various P-glycoprotein-expressing tissues.


    Acknowledgements
 
We thank Makoto Taniguchi (Tottori University Faculty of Medicine) for technical support and advice.


    Footnotes
 
This work was supported by grant-in-aid for scientific research from the Ministry of Education, Culture, Sports, and Technology, and Health and Labor Science research grants (Research on Advanced Medical Technology) from The Ministry of Health, Labor and Welfare, Tokyo, Japan.

Article, publication date, and citation information can be found at http://jpet.aspetjournals.org.

doi:10.1124/jpet.104.069724.

ABBREVIATIONS: SNP, single nucleotide polymorphism; CpG, cytosine-guanosine pair; PCR, polymerase chain reaction; SSCP, single-strand conformational polymorphism; bp, base pair; MDR, multidrug resistance; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; EMSA, electrophoretic mobility shift assay.

Address correspondence to: Dr. Hiroshi Takane, Department of Hospital Pharmacy, Faculty of Medicine, Tottori University, 36-1, Nishi-machi, Yonago, 683-8504, Japan. E-mail: takane{at}grape.med.tottori-u.ac.jp


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

Anglicheau D, Verstuyft C, Laurent-Puig P, Becquemont L, Schlageter MH, Cassinat B, Beaune P, Legendre C, and Thervet E (2003) Association of the multidrug resistance-1 gene single-nucleotide polymorphisms with the tacrolimus dose requirements in renal transplant recipients. J Am Soc Nephrol 14: 1889-1896.[Abstract/Free Full Text]

Brandeis M, Frank D, Keshetz I, Siegfried Z, Mendelsohn M, Nemes A, Temper V, Razin A, and Cedar H (1994) Sp1 elements protect a CpG island from de novo methylation. Nature (Lond) 371: 435-438.[CrossRef][Medline]

Calado RT, Falcao RP, Garcia AB, Gabellini SM, Zago MA, and Franco RF (2002) Influence of functional MDR1 gene polymorphisms on P-glycoprotein activity in CD34+ hematopoietic stem cells. Haematologica 87: 564-568.[Abstract/Free Full Text]

Cornwell MM and Smith DE (1993) SP1 activates the MDR1 promoter through one of two distinct G-rich regions that modulate promoter activity. J Biol Chem 268: 19505-19511.[Abstract/Free Full Text]

Drysdale CM, McGraw DW, Stack CB, Stephens JC, Judson RS, Nandabalan K, Arnold K, Ruano G, and Liggett SB (2000) Complex promoter and coding region 2-adrenergic receptor haplotypes alter receptor expression and predict in vivo responsiveness. Proc Natl Acd Sci USA 97: 10483-10488.[Abstract/Free Full Text]

El-Osta A, Kanatharidis P, Zalcberg JR, and Wolffe AP (2002) Precipitous release of methyl-CpG binding protein 2 and histone deacetylase 1 from the methylated human multidrug resistance gene (MDR1) on activation. Mol Cell Biol 22: 1844-1857.[Abstract/Free Full Text]

Fromm MF (2002) The influence of MDR1 polymorphisms on p-glycoprotein expression and function in humans. Adv Drug Deliver Rev 54: 1295-1320.[CrossRef][Medline]

Frommer M, McDonald LE, Millar DS, Collis CM, Watt F, Grigg GW, Molloy PL, and Paul CL (1992) A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc Natl Acad Sci USA 89: 1827-1831.[Abstract/Free Full Text]

Fryxell KB, McGee SB, Simoneaux DK, Willman CL, and Cornwell MM (1999) Methylation analysis of the human multidrug resistance 1 gene in normal and leukemic hematopoietic cells. Leukemia 13: 910-917.[CrossRef][Medline]

Goldsmith ME, Madden MJ, Morrow CS, and Cowan KH (1993) A Y-box consensus sequence is required for basal expression of the human multidrug resistance (mdr1) gene. J Biol Chem 268: 5856-5860.[Abstract/Free Full Text]

Hoffmeyer S, Burk O, von Richter O, Arnold HP, Brockmöller J, Johne A, Casscorbi I, Gerloff T, Roots I, Eichelbaum M, et al. (1999) Functional polymorphisms of the human multidrug-resistance gene: multiple sequence variations and correlation of one allele with P-glycoprotein expression and activity in vivo. Proc Natl Acad Sci USA 97: 3473-3478.

Horinouchi M, Sakaeda T, Nakamura T, Morita Y, Tamura T, Aoyama N, Kasuga M, and Okumura K (2002) Significant genetic linkage of MDR1 polymorphisms at positions 3435 and 2677: functional relevance to pharmacokinetics of digoxin. Pharm Res (NY) 19: 1581-1584.

Ieiri I, Tainaka H, Morita T, Hadama A, Mamiya K, Hayashibara M, Ninomiya H, Ohmori S, Kitada M, Tashiro N, et al. (2000) Catalytic activity of three variants (Ile, Leu and Thr) at amino acid residue 359 in human CYP2C9 gene and simultaneous detection using single-strand conformation polymorphism analysis. Ther Drug Monit 22: 237-244.[CrossRef][Medline]

Ishikawa T, Hirano H, Onishi Y, Sakurai A, and Tarui S (2004) Functional evaluation of ABCB1 (P-glycoprotein) polymorphisms: high-speed screening and structure-activity relationship analyses. Drug Metab Pharmacokinet 19: 1-14.[CrossRef][Medline]

Jin S and Scotto KW (1998) Transcriptional regulation of the MDR1 gene by histone acetyltransferase and deacetylase is mediated by NF-Y. Mol Cell Biol 18: 4377-4384.[Abstract/Free Full Text]

Johne A, Köpke K, Gerloff T, Mai I, Rietbrock S, Meisel C, Hoffmeyer S, Kerb R, Fromm MF, Brinkmann U, et al. (2002) Modulation of steady-state kinetics of digoxin by haplotypes of the P-glycoprotein MDR1 gene. Clin Pharmacol Ther 72: 584-594.[CrossRef][Medline]

Jones PA and Takai D (2001) The role of DNA methylation in mammalian epigenetics. Science (Wash DC) 293: 1068-1070.[Abstract/Free Full Text]

Judson R, Stephens JC, and Windemuth A (2000) The predictive power of haplotypes in clinical response. Pharmacogenomics 1: 15-26.[CrossRef][Medline]

Kim RB and Tirona RG (2002) Pharmacogenomics of organic anion-transporting polypeptides (OATP). Adv Drug Deliver Rev 54: 1343-1352.[CrossRef][Medline]

Kohno K, Sato S, Uchiumi T, Takano H, Kato S, and Kuwano M (1990) Tissuespecific enhancer of the human multidrug-resistance (MDR1) gene. J Biol Chem 265: 19690-19696.[Abstract/Free Full Text]

Kroetz DL, Pauli-Magnus C, Hodges LM, Huang CC, Kawamoto M, Johns SJ, Stryke D, Ferrin TE, Young JD, Taylor T, et al. (2003) Sequence diversity and haplotype structure in the human ABCB1(MDR1, multidrug resistance transporter) gene. Pharmacogenetics 13: 481-484.[CrossRef][Medline]

Macleod D, Ali RR, and Bird A (1998) An alternative promoter in the mouse major histocompatibility complex class II I-A{beta} gene: implications for the origin of CpG islands. Mol Cell Biol 18: 4433-4443.[Abstract/Free Full Text]

Macleod D, Charlton J, Mullins J, and Bird AP (1994) Sp1 sites in the mouse aprt gene promoter are required to prevent methylation of the CpG island. Genes Dev 8: 2282-2292.[Abstract/Free Full Text]

Madden MJ, Morrow CS, Nakagawa M, Goldsmith ME, Fairchild CR, and Cowan KH (1993) Identification of 5' and 3' sequences involved in the regulation of transcription of the human mdr1 gene in vivo. J Biol Chem 268: 8290-8297.[Abstract/Free Full Text]

Nakamura T, Sakaeda T, Horinouchi M, Tamura T, Aoyama N, Shirakawa T, Matsuo M, Kasuga M, and Okumura K (2002) Effect of the mutation (C3435T) at exon 26 of the MDR1 gene on expression level of MDR1 messenger ribonucleic acid in duodenal enterocytes of healthy Japanese subjects. Clin Pharmacol Ther 71: 297-303.[CrossRef][Medline]

Nakayama M, Wada M, Harada T, Nagayama J, Kusaba H, Oshima K, Kozuru M, Komatsu H, Ueda R, and Kuwano M (1998) Hypomethylation status of CpG sites at the promoter region and overexpression of the human MDR1 gene in acute myeloid leukemias. Blood 92: 4296-4307.[Abstract/Free Full Text]

Ogura M, Takatori T, and Tsuruo T (1992) Purification and characterization of NF-R1 that regulates the expression of the human multidrug resistance (MDR1) gene. Nucleic Acids Res 20: 5811-5817.[Abstract/Free Full Text]

Sakaeda T, Nakamura T, Horinouchi M, Kakumoto M, Ohmoto N, Sakai T, Morita Y, Tamura T, Aoyama N, Hirai M, et al. (2001) MDR1 genotype-related pharmacokinetics of digoxin after single oral administration in healthy Japanese subjects. Pharm Res (NY) 18: 1400-1404.

Singal R and Ginder GD (1999) DNA methylation. Blood 93: 4059-4070.[Free Full Text]

Sparreboom A, Danesi R, Ando Y, Chan J, and Figg WD (2003) Pharmacogenomics of ABC transporters and its role in cancer chemotherapy. Drug Resist Update 6: 71-84.[CrossRef][Medline]

Sundseth R, MacDonald G, Ting J, and King AC (1997) DNA elements recognizing NF-Y and Sp1 regulate the human multidrug-resistance gene promoter. Mol Pharmacol 51: 963-971.[Abstract/Free Full Text]

Takane H, Ieiri I, and Otsubo K (2003) Genetic polymorphisms of organic anion and cation transporters: pharmacokinetic and pharmacodynamic consequences in pharmacotherapy. Curr Pharmacogenomics 1: 245-257.[CrossRef]

Takeuchi T, Nakamura S, Kayasuga A, Isa S, and Sato K (2000) Multiple elements for negative regulation of the rat catalase gene expression in dedifferentiated hepatoma cells. J Biochem 128: 1025-1031.[Abstract/Free Full Text]

Tanabe M, Ieiri I, Nagata N, Inoue K, Ito S, Kanamori Y, Takahashi M, Kurata Y, Kigawa J, Higuchi S, et al. (2001) Expression of P-glycoprotein in human placenta: relation to genetic polymorphism of the multidrug resistance (MDR)-1 gene. J Pharmacol Exp Ther 297: 1137-1143.[Abstract/Free Full Text]

Tang K, Ngoi SM, Gwee PC, Chua JMZ, Lee EJD, Chong SS, and Lee CGL (2002) Distinct haplotype profiles and strong linkage disequilibrium at the MDR1 multidrug transporter gene locus in three ethnic Asian populations. Pharmacogenetics 12: 437-450.[CrossRef][Medline]

Toda Y, Wada M, Kuroiwa K, Kinugawa N, Harada T, Nagayama J, Nakagawa M, Naito S, and Kuwano M (2000) MDR1 gene overexpression and altered degree of methylation at the promoter region in bladder cancer during chemotherapeutic treatment. Clin Cancer Res 6: 4618-4627.[Abstract/Free Full Text]

Ueda K, Pastan I, and Gottesman MM (1987) Isolation and sequence of the promoter region of the human multidrug-resistance (P-glycoprotein) gene. J Biol Chem 262: 17432-17436.[Abstract/Free Full Text]

van Groenigen M, Valentijn LJ, and Baas F (1993) Identification of a functional initiator sequence in the human MDR1 promoter. Biochim Biophys Acta 1172: 138-146.[Medline]


This article has been cited by other articles:


Home page
Hum Mol GenetHome page
O. Levran, K. O'Hara, E. Peles, D. Li, S. Barral, B. Ray, L. Borg, J. Ott, M. Adelson, and M. J. Kreek
ABCB1 (MDR1) genetic variants are associated with methadone doses required for effective treatment of heroin dependence
Hum. Mol. Genet., July 15, 2008; 17(14): 2219 - 2227.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
K. Ogasawara, T. Terada, J.-i. Asaka, T. Katsura, and K.-i. Inui
Human Organic Anion Transporter 3 Gene Is Regulated Constitutively and Inducibly via a cAMP-Response Element
J. Pharmacol. Exp. Ther., October 1, 2006; 319(1): 317 - 322.
[Abstract] [Full Text] [PDF]


Home page
JNMHome page
A. Takano, H. Kusuhara, T. Suhara, I. Ieiri, T. Morimoto, Y.-J. Lee, J. Maeda, Y. Ikoma, H. Ito, K. Suzuki, et al.
Evaluation of In Vivo P-Glycoprotein Function at the Blood-Brain Barrier Among MDR1 Gene Polymorphisms by Using 11C-Verapamil
J. Nucl. Med., September 1, 2006; 47(9): 1427 - 1433.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
B. Wang, S. Ngoi, J. Wang, S. S. Chong, and C. G. L. Lee
The Promoter Region of the MDR1 Gene Is Largely Invariant, but Different Single Nucleotide Polymorphism Haplotypes Affect MDR1 Promoter Activity Differently in Different Cell Lines
Mol. Pharmacol., July 1, 2006; 70(1): 267 - 276.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
I. A. Hauser, E. Schaeffeler, S. Gauer, E. H. Scheuermann, B. Wegner, J. Gossmann, H. Ackermann, C. Seidl, B. Hocher, U. M. Zanger, et al.
ABCB1 Genotype of the Donor but Not of the Recipient Is a Major Risk Factor for Cyclosporine-Related Nephrotoxicity after Renal Transplantation
J. Am. Soc. Nephrol., May 1, 2005; 16(5): 1501 - 1511.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.104.069724v1
311/3/1179    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takane, H.
Right arrow Articles by Ieiri, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takane, H.
Right arrow Articles by Ieiri, I.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition