JPET

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Journal of Pharmacology And Experimental Therapeutics Fast Forward
First published on June 22, 2004; DOI: 10.1124/jpet.104.070672


0022-3565/04/3112-456-466$20.00
JPET 311:456-466, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.104.070672v1
311/2/456    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thomas, M. C.
Right arrow Articles by Forbes, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thomas, M. C.
Right arrow Articles by Forbes, J. M.

ABSORPTION, DISTRIBUTION, METABOLISM, AND EXCRETION

The Role of Advanced Glycation in Reduced Organic Cation Transport Associated with Experimental Diabetes

Merlin C. Thomas, Christos Tikellis, Phillip Kantharidis, Wendy C. Burns, Mark E. Cooper, and Josephine M. Forbes

Danielle Alberti Memorial Centre for Diabetes Complications, Baker Medical Research Institute, Melbourne, Victoria, Australia

Received for publication April 26, 2004
Accepted June 14, 2004.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Tubular dysfunction is an important early manifestation of diabetic nephropathy. Reduced renal expression of organic cation transporters (OCTs) potentially contributes to impaired cation clearance in diabetes. This study examines the role of advanced glycation end-products (AGEs) in mediating these changes. Experimental diabetes was induced with streptozotocin (55 mg/kg). Rats were randomly treated with the AGE inhibitor aminoguanidine for 32 weeks. In a second protocol, diabetic rats were followed with and without low-dose insulin therapy (2 U/day) for 4 weeks. Expression of OCTs was determined by real-time RT-PCR (reverse transcription-polymerase chain reaction) and Western blotting. As a marker of cation transport, the fractional clearance of endogenous N-methylnicotinamide (NMN) was determined by high-performance liquid chromatography. Both short- and long-term diabetes was associated with reduced gene and protein expression of the three renal OCT isotypes. This was associated with a reduction in the fractional clearance of NMN compared with control animals by over 50%. These changes correlated with the accumulation of renal and plasma AGEs. Treatment with the AGE inhibitor aminoguanidine restored the expression of OCT-2 and OCT-3 in diabetic animals and normalized renal NMN clearance. NMN clearance was also improved in diabetic animals receiving low-dose insulin, correlating with a reduction in AGEs and improvement in effective renal plasma flow. These studies demonstrate an early impairment of expression of OCTs and cation clearance associated with diabetes. These changes correlate with the accumulation of AGEs and may be partly attenuated by an AGE inhibitor, implicating a role for AGEs in organic cation transport.


Prolonged exposure to hyperglycemia and carbonyl stress in diabetes results in the formation and accumulation of advanced glycation end products (AGEs). These chemically heterogeneous compounds have a wide range of chemical, cellular, and tissue effects implicated in the development and progression of diabetic nephropathy (Forbes et al., 2003Go). The accumulation of AGEs, both in tissue and serum, correlates with the severity of renal complications in diabetes (Makita et al., 1991Go; Suzuki et al., 1999Go). However, AGEs may be considered downstream mediators of renal injury in diabetes. This is illustrated by studies showing that inhibition of advanced glycation is able to attenuate renal injury, without influencing glycemic control (Soulis-Liparota et al., 1991Go). In addition, administration of exogenous AGEs to nondiabetic animals is able to generate changes in renal structure and function, similar to those seen in diabetic nephropathy in the absence of hyperglycemia (Vlassara et al., 1994Go).

Proximal tubular cells represent the principal site of uptake of filtered AGEs (Asano et al., 2002Go) and may therefore be uniquely vulnerable to AGE-mediated injury. Tubular dysfunction can be identified as one of the earliest manifestations of diabetic nephropathy, preceding the development of hyperfiltration or glomerular lesions (Thomson et al., 2001Go). For example, the apical uptake of gentamicin into proximal tubular cells is reduced after as little as 4 days of experimental diabetes (Vaamonde et al., 1984Go). In addition, basolateral tubular transport is also disrupted in diabetes. In experimental diabetes, a significant reduction in tubular cation clearance can be observed, associated with a down-regulation of the expression of tubular organic cation transporters (OCTs) on the basolateral surface of the proximal tubule (Thomas et al., 2003Go; Grover et al., 2004Go). OCTs are important for the renal homeostasis of a number of physiologically important endogenous cations, including monoamine neurotransmitters, agmatine, and prostaglandins. OCTs are also necessary for the renal clearance of a broad range of exogenous substrates, including toxins, xenobiotics, and commonly used drugs (e.g., metformin and {beta}-blockers).

The mechanism of reduced OCT expression in diabetes remains to be established. However, the fact that blockade of the renin angiotensin system was able to correct this, in the presence of ongoing hyperglycemia, suggests organic cation transport in diabetic animals may be influenced by some common downstream mediator of both hyperglycemia and the renin angiotensin system. We hypothesize that AGEs represent one such mediator of tubular dysfunction in diabetes. This study examines the role of AGEs in organic cation clearance associated with experimental diabetes. In addition, we demonstrate the protective effects of aminoguanidine, an inhibitor of advanced glycation, on transporter expression and cation clearance in experimental diabetes.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Male Sprague-Dawley rats (Biological Resource Laboratory, Heidelberg, Australia), aged between 8 and 9 weeks and weighing between 200 and 250 g, were used in this study. Experimental diabetes was induced by intravenous injection of the {beta}-cell toxin streptozotocin (Sigma-Aldrich, St. Louis, MO) at a dose of 55 mg/kg, after an overnight fast. Animals with a plasma glucose concentration in excess of 15 mM 1 week after the induction of diabetes were included in the study as diabetic. Sham-injected control animals (sodium citrate buffer, pH 4.5) were followed concurrently. The protocols for animal experimentation and the handling of animals were in accordance with the principles established by the Animal Welfare Committee of the Austin and Repatriation Medical Centre. Throughout the study, animals were given free access to water and an identical diet (Barrastoc GR2 rat and mouse breeder ration; Clayton, VIC, Australia).

Protocol A: 4-Week Diabetes Model
Experimental diabetes was induced, as described above, and animals were followed for 4 weeks. A 4-week time point was selected specifically to examine the effect of diabetes on organic cation clearance before the onset of proteinuria, which usually takes place after at least 8 weeks of diabetes in this model. Rats with diabetes were randomized to receive either a daily dose of 2 units of Ultralente insulin (Ultratard HM; Novo Industries, Bagsvaerd, Denmark) to prevent ketonuria (n = 10) or no insulin therapy (n = 10).

Protocol B: 32-Week Diabetes Model
After baseline measurements of physiological and biochemical parameters, 20 diabetic and 20 control animals were followed for 32 weeks to examine for changes in the context of overt nephropathy. Diabetic and control animals were further randomized to receive aminoguanidine (Fluka, Buchs, Switzerland) in drinking water at a dose of 1 g/l for diabetic rats and 4 g/l for control rats for 32 weeks (n = 10/group). Aminoguanidine, an inhibitor of advanced glycation, has previously been shown to attenuate the development and progression of renal disease in experimental diabetes (Soulis-Liparota et al., 1991Go). In addition, diabetic animals were given 2 units per day of Ultralente insulin (Ultratard HM; Novo Industries) to maintain body weight and prevent ketoacidosis, without significantly lowering blood glucose levels. Complete insulin deficiency was not ethically appropriate, because of adverse effects on animals' health and high animal mortality. Nonetheless, this model is closer to what may be achieved clinically in patients with type 1 diabetes, who all receive systemic insulin.

Measurement of Physiological and Biochemical Parameters
The following parameters were serially measured: body weight; blood glucose, measured using a glucometer (Accutrend; Roche Diagnostics, Mannheim, Germany); systolic blood pressure, measured by tail-cuff plethysmography in conscious, warmed rats (Buñag, 1973Go); glycated hemoglobin, measured by high-performance liquid chromatography (HPLC) (CLC330 Analyzer; Primus, Kansas City, MO) (Cefalu et al., 1994Go). Urine was collected from animals that were placed for 24 h in individual metabolic cages (Iffa Credo, L'Arbresele, France) for measurement of albumin excretion rate (AER) by radioimmunoassay (Soulis-Liparota et al., 1995Go). Glomerular filtration rate (GFR) was measured by a single-injection isotopic technique (99Tc-diethylenetriaminepenta-acetic acid) developed in our laboratory (Cooper et al., 1988Go). At completion of the study, rats were sacrificed by decapitation. The kidneys were rapidly dissected out and bisected, with one-half snap frozen in liquid nitrogen and stored at –80°C before use, and the other half was embedded in paraffin wax.

Real-Time Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
The upper pole of the right kidney, containing only cortical tissue, was homogenized (Polytron; Kinematica AG, Lucerne, Switzerland), and total RNA was isolated according to the TRIzol protocol (Invitrogen, Carlsbad, CA). RNA samples were treated with RNase-free DNase (Invitrogen). RNA quality was assessed by formaldehyde gel electrophoresis to ensure that all samples used were of equivalent quality based on the 18S:28S ratio. Gene expression of mRNA for OCT-1, OCT-2, and OCT-3 was assessed with quantitative real-time RT-PCR using the TaqMan system based on real-time detection of accumulated fluorescence (ABI Prism 7700, Applied Biosystems, Foster City, CA) as described previously (Thomas et al., 2003Go). Briefly, 3 µg of RNA was used to synthesize cDNA with Superscript First Strand synthesis system (Invitrogen). Genomic DNA contamination was removed by subjecting sample RNA to DNase treatment (Ambion, Austin, TX). Samples were further subjected to PCR amplification, without a reverse transcriptase step, to confirm the absence of genomic DNA. To control for variation in the amount of DNA available for PCR in the different samples, gene expression of OCTs was normalized simultaneously (by multiplexing) in relation to the expression of the housekeeping gene 18S ribosomal RNA (rRNA) (18S rRNA TaqMan Control Reagent kit; ABI Prism 7700, Applied Biosystems), as an endogenous control. Primers and TaqMan probe for OCTs and the endogenous reference 18S rRNA were constructed with the help of Primer Express (ABI Prism 7700; Applied Biosystems). The forward primer for OCT-1 was 5'-[TGGTGTTTAGGCTGATGGAA]-3' and the reverse primer for OCT-1 was 5'-[GCCCAAAACCCCAAACAAA]-3'. The probe specific to OCT-1 was FAM-5'-TTTGGCAAGCCCTGCCCTCA-3'-TAMRA, where FAM is 6-carboxyfluorescein and TAMRA (quencher) is 6-carboxy-tetramethylrhodamine. The forward primer for OCT-2 was 5'-[GCGAGCATGGCTGGGTATAC]-3' and the reverse primer for OCT-2 was 5'-[CAGGTTAAACTCAGTGACAATGG]-3'. The probe specific to OCT-2 was FAM-5'-ACACTCCCGGCTCC-3'-TAMRA. The forward primer for OCT-3 was 5'-[TTGCACCGAATTTTTCTGTGTT]-3' and the reverse primer for OCT-3 was 5'-[CAGGCCCCCTTTCCAAAC]-3'. The probe specific to OCT-3 was FAM-5'-ATCTTCCGCTTCCTGC-3'-TAMRA. PCR amplification was done in a 25-µl volume, including 1x TaqMan buffer A, 200 µM dATP, 200 µM dCTP, 200 µM dGTP, 400 µM dUTP, 100 nM fluorogenic probe, 200 nM each of forward and reverse primers, 0.5 U of uracil-N-glycosylase, 1.25 U of DNA polymerase (Applied Biosystems), and 100-ng sample cDNA. The amplification was performed with the following time course: 50°C, 2 min and 10 min at 95°C, followed by 40 cycles of 94°C, 20 s, and 60°C, 1 min. Each sample was tested in triplicate. Results were expressed as proportional to relevant control animals.

In Situ Hybridization
The site-specific expression of OCT-1 and OCT-2 mRNA was determined by radioactive in situ hybridization using methods carried out as described previously (Thomas et al., 2003Go). Because of the low level of expression of mRNA, in situ hybridization for OCT-3 was not performed. In brief, cDNAs coding for OCTs were prepared from rat cDNA and shortened by alkaline hydrolysis to an average length of 250 bases. Purified probes were then cloned into pGemT easy vector (Promega, Madison, WI) and linearized with Sal-1. Anti-sense riboprobes for OCTs were then generated using T7 RNA polymerase. Background hybridization was controlled by the inclusion of a sense riboprobe or treatment with RNase before hybridization. Four-micrometer sections were hybridized with riboprobes and then exposed to BioMax MR film for 3 to 5 days.

Western Blot and Immunohistochemistry
Forty micrograms of protein extracted from kidney samples was separated on a 12% SDS-polyacrylamide gel electrophoresis gel and transferred to polyvinylidene difluoride membrane. OCT-1, OCT-2, and OCT-3 were detected using polyclonal antibodies (Alpha Diagnostics International, San Antonio, TX) incubated overnight at 4°C at a dilution of 1:1000. Bound antibody was detected on X-ray film by enhanced chemiluminescence with a horseradish peroxidase-conjugated anti-rabbit IgG antibody (1:2000) and Supersignal West Pico chemiluminescent substrate (Pierce Chemical, Rockford, IL).

Renal expression of OCT-1, OCT-2, and OCT-3 was detected using commercial polyclonal antibodies (Alpha Diagnostics International) at a dilution of 1:500, 1:250, and 1:250, respectively. For each of these antibodies, antigen retrieval before incubation with the primary antibody was performed using 0.4% pepsin (Sigma-Adrich) in 0.01 N hydrochloric acid for 5 min at 37°C. Negative control slides were included without addition of primary antibody. Vector biotinylated goat anti-rabbit immunoglobulin was used as the secondary antibody, followed by Vector ABC (Vector Laboratories, Burlingame, CA). Peroxidase activity was identified by reaction with 3,3'-diaminobenzidine tetrahydrochloride tablets (Sigma-Aldrich). Sections were counterstained with hematoxylin, dehydrated, and mounted with DePeX (BDH, Melbourne, Australia).

Measurement of N-Methylnicotinamide (NMN) Clearance
NMN is an endogenous cation that is cleared by the kidney via OCT-dependent pathways (Urakami et al., 1998Go). Urine and serum concentrations of NMN were measured HPLC, as described previously (Thomas et al., 2003Go). Renal NMN clearance was estimated from the daily excretion of NMN divided by the plasma NMN concentration.

Estimation of Renal Plasma Flow
Effective renal plasma flow (ERPF) was estimated from the clearance of endogenous hippuric acid clearance in conscious animals, as described previously (Igarashi et al., 1987Go). Serum samples were taken in the morning, at the time of constant low hippurate excretion. Urine samples were collected in metabolic cages, as detailed above, and analyzed in a 1:50 dilution. Hippuric acid was measured in serum and urine samples using HPLC. Briefly, 300 µl of acetonitrile containing internal standard isopropanoic acid was added dropwise to 100 µl of serum or 1:50 diluted urine. The sample was then centrifuged to remove precipitated protein and the supernatant was dried under nitrogen. Subsequently, the sample was reconstituted in a mobile phase consisting of 10% acetonitrile, 1% trinitrofuran, and 0.5% phosphoric acid. The sample was then injected into a 250 x 3 mm, 5-µm phenyl-hexyl column (Phenomenex, Torrance, CA) with a mobile phase at 1 ml/min. The hippurate peak was detected at 10.2 min, using an on-line UV detector set at 249 nm. Because serum and urine were run sequentially, ERPF was calculated as the urinary volume multiplied by the area under the urine hippurate curve divided by that of plasma hippurate and expressed as milliliters per minute per square meter of body surface area.

Quantification and Localization of AGEs
Plasma AGEs. Incomplete degradation of AGE-modified proteins results in the production of low molecular weight (LMW) AGEs that accumulate in the serum in diabetes. These LMW AGEs parallel the level of tissue AGE-modification in diabetes (Forbes et al., 2003Go). In addition, LMW AGEs may be directly pathogenic to the proximal tubule, because they are both freely filtered at the glomerulus and actively reabsorbed in the proximal nephron. LMW AGE levels present in plasma samples were assayed using on-line spectrofluorometric detection in a flow system, as described previously by our group (Forbes et al., 2003Go). Briefly, 20 µl of serum was deproteinated with 480 µl of trichloroacetic acid and mixed with 100 µl of chloroform. The resulting aqueous phase was injected directly into a carrier stream (deionized water) in which total AGE fluorescence was measured (370/440 nm; Waters 470 fluorescence spectrophotometer; Waters, Milford, MA). Injection volume was corrected by the measurement of UV absorption at 280 nm (A280), using a Hewlett Packard L3500 spectrophotometer detector placed in series. Samples were run in triplicate. LMW AGE content was expressed as arbitrary units defined by the ratio of the area under the fluorescence curve divided by the area under the A280 curve. Results were normalized to the values for hydrolyzed AGE-modified bovine serum albumin prepared using standard methods.

Tissue AGE Content. AGE fluorescence (370/440 nm) was determined in homogenized renal cortical samples after reduction with freshly prepared NaBH4 (1 M NaBH4 in 0.1 M NaOH overnight at 4°C) followed by enzymatic hydrolysis into peptide fragments using proteinase K. The resulting low molecular weight peptides were then analyzed using the same flow injection assay described above. Results were expressed after being normalized for the protein content of the supernatant, which was determined before acid hydrolysis using the BCA assay (Bio-Rad, Hercules, CA).

Immunohistochemical Localization. Localization of renal AGE content was determined by immunohistochemistry, as described previously by our group (Soulis et al., 1997bGo). Briefly, formalin-fixed paraffin sections of kidney were dewaxed and hydrated. After incubation with 0.3% hydrogen peroxide for 20 min, sections were incubated with protein blocking agent (Shandon Lipshaw, Pittsburgh, PA) for 20 min and then incubated with a polyclonal AGE antibody that recognizes the nonfluorescent AGE carboxymethyllysine as its primary epitope (Reddy et al., 1995Go). Tissue sections were stained consecutively with biotinylated IgG for 10 min and avidin-biotin horseradish peroxidase complex for 15 min (Vectastain ABC ELITE kit; Vector Laboratories) before a substrate solution of 3, 3'-diaminobenzidine tetrahydrochloride (Sigma-Aldrich) was added. Sections were counterstained in Harris' hematoxylin and mounted in DePex (BDH, Merck, Poole, Dorset, UK).

Statistical Analysis
Data are expressed as mean ± the standard error of the mean with the exception of AER, which is shown as the geometric mean x/+ a tolerance factor. Normally distributed variables in different groups were compared by analysis of variance. Comparisons between group means were performed by Fisher's least significant difference method. A p value of <0.05 was considered statistically significant.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Animals. Physiological parameters for the 4-week diabetes study are shown in Table 1. Animals with experimental diabetes not treated with insulin (DO4) had increased GHb levels and daily food and water intake compared with diabetic animals receiving a low dose of insulin (DI4) and control animals (C4) after 4-weeks of study. DO4 animals were also smaller than DI4 (p < 0.01). GFR was significantly increased in animals with diabetes with or without insulin treatment (versus control, p < 0.01). AER was not elevated at this time point in any group.


View this table:
[in this window]
[in a new window]
 
TABLE 1 Biochemical parameters in the short-term (4-week) experimental model

Data are mean ± S.E.M.

 

Physiological parameters for the 32-week diabetes study animals are shown in Table 2. After 32 weeks of study, animals with experimental diabetes (DI32) had increased GHb levels and daily food and water intake compared with control animals (C32). Neither GHb nor feeding behavior was influenced in animals treated with aminoguanidine (DIAG32). The AER was increased in DI32 but attenuated in DIAG32, consistent with the previously documented renoprotective effect of aminoguanidine in this model (Soulis-Liparota et al., 1991Go; Osicka et al., 2000Go). GFR was increased in animals with diabetes. However, aminoguanidine had no significant effect on hyperfiltration (p = 0.52).


View this table:
[in this window]
[in a new window]
 
TABLE 2 Biochemical parameters in the long-term (32-week) experimental model

Data are mean ± S.E.M.

 

Estimation of AGE Exposure. Circulating levels of LMW AGEs were higher in animals with diabetes with significant differences detectable at all time points. DO4 animals had higher levels of LMW AGEs than DI4 animals receiving insulin. Treatment with the AGE inhibitor aminoguanidine attenuated this rise in levels of LMW AGEs in diabetic animals, without altering glycemic control. Renal AGE fluorescence was significantly increased in diabetic animals, both at 4 and 32 weeks, although the absolute level of this AGE fluorescence was greater at the latter time point (Tables 1 and 2). Treatment with aminoguanidine and insulin both reduced renal AGE fluorescence compared with untreated animals. Total renal AGE fluorescence was correlated with level of LMW AGEs in control (R2 = 0.43; p < 0.01) and diabetic animals (R2 = 0.56; p < 0.01).

Immunostaining for renal AGEs was most pronounced in distal renal tubules and the macular densa (Figs. 1 and 2). This pattern of intense distal staining for carboxymethyllysine was largely unchanged between control and diabetic animals and was not significantly modified by any intervention. By contrast, there was a significant increase in proximal tubular staining for AGEs in diabetic animals at both early and late time points, compared with respective controls. This tubular staining was significantly reduced in animals treated with aminoguanidine (Fig. 2) and treatment with low-dose insulin reduced immunostaining for AGEs compared with DO4 animals (Fig. 1).



View larger version (132K):
[in this window]
[in a new window]
 
Fig. 1. Immunolocalization of OCT-1, OCT-2, OCT-3, and AGEs in 4-week control animals (left), experimental diabetes (middle), and diabetes treated with insulin (right).

 


View larger version (159K):
[in this window]
[in a new window]
 
Fig. 2. Immunolocalization of OCT-1, OCT-2, OCT-3, and AGEs in control animals (left), experimental diabetes (middle), and diabetes treated with aminoguanidine (right).

 

Expression of OCT mRNA. The major cation transporter expressed in the rat kidney was OCT-2, constituting over 75% of the total expression of mRNA for renal OCTs in both control and diabetic animals. OCT-1 was the next most common transporter expressed, constituting ~23% of all renal OCT mRNA. The gene expression of OCT-3 in the rat kidney was more than 500 times less than OCT-2 and OCT-1, suggesting it does not play an important role in cation transport in the rodent kidney. This distribution (ratio) of OCT mRNA expression was not significantly different between control and diabetic rats or between early and late time points. In addition, this pattern was not significantly modified with prolonged duration of diabetes or by treatment with insulin in the short-term model.

The quantitative gene expression for each of the OCTs, as measured using real-time RT-PCR, was significantly lower in animals with diabetes (Fig. 3). At both 4 weeks and 32 weeks, the reduction in gene expression was of a similar magnitude for each of the OCTs, despite the absence of proteinuria at the 4-week time point. Treatment with low-dose insulin significantly increased the expression of OCT-2 and OCT-3 compared with untreated animals with diabetes (p < 0.05), albeit still lower than control animals. However, the expression of OCT-1 remained unchanged as measured by real-time RT-PCR (Fig. 3A). Treatment with aminoguanidine significantly increased OCT-2 and OCT-3 mRNA expression in animals with diabetes, reaching levels not significantly different from control rats. However, the expression of OCT-1 was equivalent to that of untreated animals with diabetes (Fig. 3A).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3. A, renal expression of OCTs mRNA in the 4-week model. Control animals (open column), untreated diabetes (black column), and diabetes treated with low-dose insulin (gray column). Mean ± S.E.M., *, versus C4, p < 0.05; #, versus DO4, p < 0.05. B, renal expression of OCTs mRNA in the 32-week model. Control animals (open column), diabetes (black column), and diabetes treated with aminoguanidine (gray column). Mean ± S.E.M., *, versus C32, p < 0.05; #, versus D32, p < 0.05.

 

Notably, the gene expression of the OCTs was correlated with one another in both control and diabetic animals, with the single exception of OCT-3 and OCT-1 in diabetic animals (Fig. 4). This close correlation in renal expression is consistent with the cosegregation of the OCTs and the close physical linkage of these three organic cation transporter genes in the rat genome (Eraly et al., 2003Go).



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 4. Correlation in the renal expression of mRNA for each of the OCTs in the 32-week control model (triangle) and diabetic animals (square). *, linear regression, p < 0.01.

 

In all renal tissues, OCT-1 mRNA was predominantly expressed in the pars convoluta (S1) and cortical pars recta (S2) of the proximal tubule as demonstrated by in situ hybridization (Fig. 5). Expression of OCT-2 mRNA was highest in the medullary pars recta (S3). Although the level of expression was reduced for OCT-1 and OCT-2, the localization of gene expression in diabetic kidneys was not significantly different to that seen in control animals. However, the reduced expression of OCT-1 in diabetic animals was most marked in the superficial cortical zones. Neither aminoguanidine nor insulin had any significant effect on the tissue distribution of OCT-1 or OCT-2 gene expression as assessed by in situ hybridization although aminoguanidine increased the overall level of OCT-2 expression (Fig. 5).



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 5. Localization of OCT gene expression of mRNA in the 32-week model.

 

OCT Protein Expression. Proximal tubular immunostaining was specifically basal and lateral for all the OCTs. OCT-1 protein was expressed predominantly in the cortical S1 and S2 tubules and OCT-2 in the juxtamedullary S3 tubule with no staining in the renal medulla (Figs. 1 and 2). As reported previously, OCT-3 was present in both distal and proximal tubules in the rat kidney (Wu et al., 2000Go). The proximal tubular staining was limited to the cortical S1 and S2 tubule, and expressed in a similar pattern to OCT-1.

Correlating with the changes seen in gene expression, the protein expression of the OCTs was diminished in diabetic kidneys both after 4 and 32 weeks, as shown quantitatively on Western blot (Fig. 6) and by immunohistochemistry (Figs. 1 and 2). Although the level of protein expression was reduced, the localization of OCT-1 and OCT-2 expression in diabetic kidneys was not significantly different to that seen in control animals and was similar at both early and late time points. However, immunostaining for OCT-3 was reduced only in proximal tubules, with no clear difference between control and diabetic animals on distal tubular staining.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 6. Renal expression of OCT protein in the 4-week model (A) and in the 32-week model (B). Control animals (open column), diabetes (black column), and diabetes treated with aminoguanidine (gray column). Mean ± S.E.M., *, versus C, p < 0.05; #, versus D, p < 0.05.

 

As for mRNA, protein expression of OCT-2 and OCT-3 in diabetic animals was increased after treatment with aminoguanidine (Fig. 6A). However, treatment with low-dose insulin had no detectable effect on the protein expression of OCTs (Fig. 6B).

N-Methylnicotinamide Clearance. There was a significant decline in the fractional clearance of NMN in animals with diabetes over the 32-week study period (Fig. 7A). This reduction was apparent after 8 weeks of diabetes, before the onset of proteinuria, and persisted throughout the study period. After 32 weeks, tubular excretion of NMN was reduced by over 60% in diabetic compared with control animals (DI32, 43 ± 6 ml/min; C32, 150 ± 12 ml/min; p < 0.01). These changes in the fractional clearance of NMN were independent of hyperfiltration associated with diabetes. However, the observed decline in cation clearance as a result of advanced diabetes was attenuated by correcting for the decline in renal blood flow as estimated by the clearance of endogenous hippurate. When expressed as a ratio of NMN clearance to that of hippurate, organic cation clearance seems to be uniformly reduced at all time points in animals with diabetes. This is consistent with the uniform reduction in OCT mRNA and protein expression observed at both the early and late time points (Fig. 7B).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 7. Renal clearance of N-methylnicotinamide corrected for GFR (A) and ERPF (B) in control animals (open square), diabetes (black circle), and diabetes treated with aminoguanidine (gray triangle). *, versus control, p < 0.05.

 

In the 4-week study, only in untreated animals with diabetes was there a significant decline in the fractional clearance of NMN (DO4, 2.3 ± 0.2; C4, 3.5 ± 0.2; p < 0.01). Organic cation clearance in diabetic animals treated with low dose insulin was not significantly different from control animals (DI4, 3.2 ± 0.3; C4, 3.5 ± 0.2, p = N.S.). Treatment with aminoguanidine also restored cation clearance to control levels (DIAG32, 139 ± 12 ml/min), despite having no effect on hyperfiltration.

Correlations with OCT Expression. In the 32-week model, the level of expression of each of the OCTs was correlated with albuminuria in both diabetic (R2 = 0.33; p < 0.01) and control animals (R2 = 0.60; p < 0.01). On the other hand, there was no clear relationship between "normoalbuminuria" and OCT expression in the 4-week study, reflecting the absence of pathological albuminuria at this time point. However, the concentration of serum LMW AGEs was correlated with OCT expression in animals with and without diabetes (e.g., LMW AGE versus OCT-2; diabetes, R2 = 0.32; p < 0.05 and control, R2 = 0.76; p < 0.01).


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The renal clearance of organic cations is significantly reduced after the induction of experimental diabetes. As has been recently demonstrated by our group (Thomas et al., 2003Go) and others (Grover et al., 2004Go), this decline is temporally associated with reduced gene and protein expression of the organic cation transporters in the diabetic proximal tubule. Although OCT expression is reduced in proportion to tubular injury in advanced diabetes (Thomas et al., 2003Go), a significant reduction in OCT expression was detectable after 4 weeks of diabetes, well before the development of albuminuria and significant renal damage. This suggests that the reduction in OCT expression observed in these studies is not simply an epiphenomenon or marker of renal injury. This finding is further supported by findings recently published in the Journal of Pharmacology and Experimental Therapeutics, showing a reduction in OCT-1 and -2 protein after as little as 14 days of experimental diabetes (Grover et al., 2004Go).

The fact that the expression of all the renal OCTs was reduced in the diabetic kidney is also significant. Knockout models of OCT-1 or OCT-2 alone demonstrated little effect on renal cation clearance, possibly because of receptor redundancy (Jonker et al., 2001Go, 2003Go). On the other hand, a double knockout of both genes results in complete loss of renal cation transport (Jonker et al., 2003Go). In this study, restoration of OCT-2 after treatment with aminoguanidine was sufficient to restore NMN clearance to within control parameters, without significant effects on OCT-1 expression.

Although OCT-3 is expressed at a low level in the rat kidney and has limited affinity for NMN (Okuda et al., 2000Go), a reduction in its expression in diabetic animals may still be significant. OCT-3 is the major cation transporter in the human kidney (Hayer-Zillgen et al., 2002Go). In addition, selective blockade of OCT-3 in rats results in increased plasma catecholamines and metanephrines (Eisenhofer et al., 1996Go). However, OCT-3 knockout mice seem to show no evidence of a monoamine imbalance (Zwart et al., 2001Go), possibly because of redundancy conferred through expression and/or activity of other cation transporters. It is conceivable that a reduction in OCT-1 and OCT-2 expression, on top of changes in OCT-3, could contribute to chronically elevated sympathetic tone or catecholamine sensitivity associated with diabetes and aging.

The mechanism by which OCT expression is reduced in experimental diabetes is unclear. It is likely that the changes are not specific to OCTs because other tubular transport pathways may also be disrupted in early diabetes (Vaamonde et al., 1984Go), suggesting that these changes are a symptom of a more general tubular dysfunction. Renoprotective therapy with inhibitors of advanced glycation and blockade of the renin-angiotensin system (Thomas et al., 2003Go) are both able to normalize the expression of OCTs in this diabetic model, despite having no effect on hyperglycemia, hyperfiltration, or polyuria. This suggests that a common downstream mediator of both hyperglycemia and the renin angiotensin system, such as PKC or cGMP, may influence tubular transport in diabetic animals. Certainly, tubular PKC is activated in early diabetic nephropathy and this effect is attenuated by both angiotensin-converting enzyme inhibition and aminoguanidine (Osicka et al., 2000Go). In addition, AGEs may also represent a common mediator of tubular injury. Indeed, Grover et al. (2004Go) recently suggested that AGEs may contribute to changes in OCT proteins. Of all the cells in the kidney, proximal tubular cells are unique in their ability to assimilate filtered AGEs and are therefore most susceptible to AGE-mediated damage in diabetes. Exposure of tubular cells to AGEs results in a variety of functional changes relevant to cation transport, including a reduction in trans-epithelial polarity and loss of the epithelial phenotype (Forbes et al., 2003Go). AGEs are also capable of independently activating a range of tubular growth and differentiation factors, including known mediators of organic cation transport such as PKC. In this study, serum LMW AGEs levels were correlated with the renal expression of OCTs both at early and late time points in diabetic animals. In addition, aminoguanidine, which inhibits the formation of AGEs, restored the expression of OCT-2 and OCT-3 in diabetic animals. Similarly ramipril, which reduces circulating and tubular levels of AGEs through a different mechanism (Forbes et al., 2002Go) proved equally beneficial (Thomas et al., 2003Go). It is also conceivable that renin-angiotensin system and advanced glycation pathogenic pathways may act in a synergistic manner, and combination therapy may offer better results than either treatment alone (Davis et al., 2004Go). In this study, expression of OCT-1 was not significantly altered by aminoguanidine, although expression of OCT-2 and OCT-3 was fully restored. However, in our previous study, ramipril restored OCT-1 as well as OCT-2 in diabetic animals but had no significant effect on OCT-3 (unpublished data). It seems likely that a combination of hemodynamic and metabolic approaches may offer the best chance of restoring normal tubular function in diabetes (Gilbert and Cooper, 1999Go).

Dynamic changes in tubular blood flow are an early event in diabetic nephropathy, and NMN clearance has been considered a valid measure of tubular blood flow (Musfeld et al., 2001Go). The declining blood flow in animals with advanced diabetes and renal injury also contributes to the reduced NMN clearance observed in our study. Similarly, the lower renal plasma flow in untreated animals with diabetes compared with those treated with low-dose insulin (as originally described by Brenner and colleagues; Hostetter et al., 1981Go) suggests that effective NMN clearance may be even lower in untreated animals. However, even after correcting for changes in renal plasma flow, organic cation clearance is consistently reduced in animals with diabetes, paralleling the uniform reduction in OCT gene and protein expression observed at both early and late time points.

Studies by our group have previously demonstrated that treatment of diabetic animals with aminoguanidine is able to restore a variety of aberrant tubular functions (Osicka et al., 2000Go). With the demonstration of a reduced expression of OCTs after 4 weeks of diabetes, this effect is clearly more than just renoprotection. Although aminoguanidine was used in this study as an inhibitor of advanced glycation, aminoguanidine also inhibits the activity of inducible nitric-oxide synthase, which may be activated in early diabetes (Ziyadeh et al., 1995Go). However, other inhibitors of inducible nitricoxide synthase (N{omega}-nitro-L-arginine methyl ester and methylguanidine) are not renoprotective in diabetes (Soulis et al., 1997aGo), whereas chemically unrelated inhibitors of glycation, such as pyridoxamine, confer some degree of renal protection in diabetes (Degenhardt et al., 2002Go). Furthermore, recent cell culture studies have suggested that nitric oxide has no effect on the activity of organic cation transporter pathways (Song et al., 2002Go). Aminoguanidine also has the added ability to inhibit semicarbazide-sensitive amine oxidase (SSAO) (Yu and Zuo, 1999Go), which has, as its major substrate, a variety of cationic polyamines. SSAO is increased in diabetic animal models from as early as 9 days (Hayes and Clarke, 1990Go). However, regulatory effects on SSAO activity on OCT expression, although plausible, remain to be established.

It is also likely that insulin influences OCT expression, because animals not treated with insulin for 4 weeks have a greater reduction in fractional NMN clearance. This was largely explained by the effect of insulin on renal blood flow and GFR (Hostetter et al., 1981Go; Allen et al., 1990Go), although the renal expression of the OCTs was also marginally increased by low-dose insulin supplementation, without correcting hyperglycemia. Lack of insulin is certainly an important driving force for many of the pathogenic changes seen in experimental diabetes. However, that these changes may be partly reversed by therapies that do not alter insulin levels (i.e., AGE inhibition or ACE inhibition), insulin deficiency alone cannot explain the changes. We speculate that insulin deficiency, activation of the renin-angiotensin system and hyperglycemia must share common downstream meditators, one of which may be AGEs. Notably, small doses of insulin were sufficient to reduce the circulating level of LMW AGEs. It is possible to speculate that some of the beneficial effects of insulin may be mediated via a reduction in AGE levels. Equally, as many AGEs carry a charge at physiological pH, augmentation of clearance pathways, such the renal OCTs, may directly act to reduce circulating LMW AGEs.

In summary, reduced gene and protein expression of OCT-1, OCT-2, and OCT-3 has been demonstrated in experimental diabetes, associated with the reduced clearance of the endogenous cation NMN. This change may be detected after as little as 4 weeks of diabetes. The reduction may be further compounded by a reduced renal plasma flow associated with advanced diabetes and complete insulin deficiency. Organic cation clearance and the expression of OCTs was restored after treatment with aminoguanidine, suggesting a possible role for AGEs in the disruption of tubular organic cation transport associated with diabetes.


    Footnotes
 
M.C.T. is supported by a National Health and Medical Research Council biomedical scholarship. J.M.F. is supported by a Juvenile Diabetes Research Foundation postdoctoral fellowship. W.C.B. is supported by an Australian Kidney Foundation postgraduate scholarship. The Danielle Alberti Memorial Centre for Diabetes Complications at the Baker Medical Research Institute is funded by a program grant from the Juvenile Diabetes Research Foundation.

doi:10.1124/jpet.104.070672.

ABBREVIATIONS: AGE, advanced glycation end-product; OCT, organic cation transporters; HPLC, high-performance liquid chromatography; AER, albumin excretion rate; GFR, glomerular filtration rate; RT-PCR, reverse transcription-polymerase chain reaction; FAM, 6-carboxyfluorescein; TAMRA, 6-carboxy-tetramethylrhodamine; NMN, N-methylnicotinamide; ERPF, effective renal plasma flow; LMW, low molecular weight; PKC, protein kinase C; SSAO, semicarbazide-sensitive amine oxidase.

Address correspondence to: Dr. Merlin C Thomas, Baker Medical Research Institute, Baker Medical Research Institute, P.O. Box 6492, Melbourne, VIC 8008, Australia. E-mail: mthomas{at}baker.edu.au


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

Allen TJ, Cooper ME, O'Brien RC, Bach LA, Jackson B, and Jerums G (1990) Glomerular filtration rate in streptozocin-induced diabetic rats. Role of exchangeable sodium, vasoactive hormones and insulin therapy. Diabetes 39: 1182–1190.[Abstract]
Asano M, Fujita Y, Ueda Y, Suzuki D, Miyata T, Sakai H, and Saito A (2002) Renal proximal tubular metabolism of protein-linked pentosidine, an advanced glycation end product. Nephron 91: 688–694.[CrossRef][Medline]
Buñag RD (1973) Validation in awake rat of a tail-cuff method for measurement of systolic blood pressure. J Appl Physiol 34: 279–282.[Free Full Text]
Cefalu WT, Wang ZQ, Bell-Farrow A, Kiger FD, and Izlar C (1994) Glycohemoglobin measured by automated affinity HPLC correlates with both short-term and long-term antecedent glycemia. Clin Chem 40: 1317–1321.[Abstract/Free Full Text]
Cooper ME, Allen TJ, O'Brien RC, Macmillan PA, Clarke B, Jerums G, and Doyle AE (1988) Effects of genetic hypertension on diabetic nephropathy in the rat - functional and structural characteristics. J Hypertens 6: 1009–1016.[CrossRef][Medline]
Davis BJ, Forbes JM, Thomas MC, Jerums G, Burns WC, Kawachi H, Allen TJ, and Cooper ME (2004) Superior renoprotective effects of combination therapy with ACE and AGE inhibition in the diabetic spontaneously hypertensive rat. Diabetologia 47: 89–97.[CrossRef][Medline]
Degenhardt TP, Alderson NL, Arrington DD, Beattie RJ, Basgen JM, Steffes MW, Thorpe SR, and Baynes JW (2002) Pyridoxamine inhibits early renal disease and dyslipidemia in the streptozotocin-diabetic rat. Kidney Int 61: 939–950.[CrossRef][Medline]
Eisenhofer G, McCarty R, Pacak K, Russ H, and Schömig E (1996) Disprocynium24, a novel inhibitor of the extraneuronal monoamine transporter, has potent effects on the inactivation of circulating noradrenaline and adrenaline in conscious rat. Naunyn-Schmiedeberg's Arch Pharmacol. 354: 287–294.[Medline]
Eraly SA, Hamilton BA, and Nigam SK (2003). Organic anion and cation transporters occur in pairs of similar and similarly expressed genes. Biochem Biophys Res Commun 300: 333–342.[CrossRef][Medline]
Forbes JM, Cooper ME, Oldfield MD, and Thomas MC (2003). Role of advanced glycation end products in diabetic nephropathy. J Am Soc Nephrol 14 (8 Suppl 3): S254–S258.[Abstract/Free Full Text]
Forbes JM, Cooper ME, Thallas V, Burns WC, Thomas MC, Brammar GC, Lee F, Grant SL, Burrell LA, Jerums G, and Osicka TM (2002) Reduction of the accumulation of advanced glycation end products by ACE inhibition in experimental diabetic nephropathy. Diabetes 51: 3274–3282.[Abstract/Free Full Text]
Gilbert RE and Cooper ME (1999) The tubulointerstitium in progressive diabetic kidney disease: more than an aftermath of glomerular injury? Kidney Int 56: 1627–1637.[CrossRef][Medline]
Grover B, Buckley D, Buckley AR, and Cacini W (2004) Reduced expression of organic cation transporters rOCT1 and rOCT2 in experimental diabetes. J Pharmacol Exp Ther 308: 949–956.[Abstract/Free Full Text]
Hayer-Zillgen M, Bruss M, and Bonisch H (2002) Expression and pharmacological profile of the human organic cation transporters hOCT1, hOCT2 and hOCT3. Br J Pharmacol. 136: 829–836.[CrossRef][Medline]
Hayes BE and Clarke DE (1990) Semicarbazide-sensitive amine oxidase activity in streptozotocin diabetic rats. Res Commun Chem Pathol Pharmacol 69: 71–83.[Medline]
Hostetter TH, Troy JL, and Brenner BM (1981) Glomerular hemodynamics in experimental diabetes mellitus. Kidney Int 19: 410–415.[Medline]
Igarashi P, Gulyassy P, Stanfel L, and Depner T (1987) Plasma hippurate in renal failure: high-performance liquid chromatography method and clinical application. Nephron 47: 290–294.[Medline]
Jonker JW, Wagenaar E, Mol CA, Buitelaar M, Koepsell H, Smit JW, and Schinkel AH (2001) Reduced hepatic uptake and intestinal excretion of organic cations in mice with a targeted disruption of the organic cation transporter 1 (Oct1 [Slc22a1]) gene Mol Cell Biol. 21: 5471–5477.[Abstract/Free Full Text]
Jonker JW, Wagenaar E, Van Eijl S, and Schinkel AH (2003) Deficiency in the organic cation transporters 1 and 2 (Oct1/Oct2 [Slc22a1/Slc22a2]) in mice abolishes renal secretion of organic cations. Mol Cell Biol. 23: 7902–7908.[Abstract/Free Full Text]
Makita Z, Radoff S, Rayfield EJ, Yang Z, Skolnik E, Delaney V, Friedman EA, Cerami A, and Vlassara H (1991) Advanced glycosylation end products in patients with diabetic nephropathy. N Engl J Med 325: 836–842.[Abstract]
Musfeld C, Biollaz J, Belaz N, Kesselring UW, and Decosterd LA (2001) Validation of an HPLC method for the determination of urinary and plasma levels of N1methylnicotinamide, an endogenous marker of renal cationic transport and plasma flow. J Pharm Biomed Anal 24: 391–404.[CrossRef][Medline]
Okuda T, Haga T, Kanai Y, Endou H, Ishihara T, and Katsura I (2000) Identification and characterization of the high-affinity choline transporter. Nat Neurosci 3: 120–125.[CrossRef][Medline]
Osicka TM, Yu Y, Panagiotopoulos S, Clavant SP, Kiriazis Z, Pike RN, Pratt LM, Russo LM, Kemp BE, Comper WD, and Jerums G (2000). Prevention of albuminuria by aminoguanidine or ramipril in streptozotocin-induced diabetic rats is associated with the normalization of glomerular protein kinase C. Diabetes 49: 87–93.[Abstract]
Reddy S, Bichler J, Wells-Knecht KJ, Thorpe SR, and Baynes JW (1995) N-epsilon-(Carboxymethyl)lysine is a dominant advanced glycation end product (AGE) antigen in tissue proteins. Biochemistry 34: 10872–10878.[CrossRef][Medline]
Song IS, Lee IK, Chung SJ, Kim SG, Lee MG, and Shim CK (2002) Effect of nitric oxide on the sinusoidal uptake of organic cations and anions by isolated hepatocytes. Arch Pharm Res (NY) 25: 984–988.
Soulis T, Cooper ME, Sastra S, Thallas V, Panagiotopoulos S, Bjerrum OJ, and Jerums G (1997a). Relative contributions of advanced glycation and nitric oxide synthase inhibition to aminoguanidine-mediated renoprotection in diabetic rats. Diabetologia 40: 1141–1151.[CrossRef][Medline]
Soulis T, Thallas V, Youssef S, Gilbert RE, McWilliam B, Murray-McIntosh RP, and Cooper ME (1997b) Advanced glycation end products and the receptor for advanced glycated end products co-localize in organs susceptible to diabetic microvascular injury: immunohistochemical studies. Diabetologia 40: 619–628.[CrossRef][Medline]
Soulis-Liparota T, Cooper ME, Dunlop M, and Jerums G (1995) The relative roles of advanced glycation, oxidation and aldose reductase inhibition in the development of experimental diabetic nephropathy in the Sprague-Dawley rat. Diabetologia 38: 387–394.[Medline]
Soulis-Liparota T, Cooper M, Papazoglou D, Clarke B, and Jerums G (1991) Retardation by aminoguanidine of development of albuminuria, mesangial expansion, and tissue fluorescence in streptozocin-induced diabetic rat. Diabetes 40: 1328–1334.[Abstract]
Suzuki D, Miyata T, Saotome N, Horie K, Inagi R, Yasuda Y, Uchida K, Izuhara Y, Yagame M, Sakai H, et al. (1999) Immunohistochemical evidence for an increased oxidative stress and carbonyl modification of proteins in diabetic glomerular lesions. J Am Soc Nephrol 10: 822–832.[Abstract/Free Full Text]
Thomas MC, Tikellis C, Burns WC, Thallas V, Forbes JM, Cao Z, Osicka TM, Russo LM, Jerums G, Ghabrial H, et al. (2003) Reduced tubular cation transport in diabetes: prevented by ACE inhibition. Kidney Int. 63: 2152–2161.[CrossRef][Medline]
Thomson SC, Deng A, Bao D, Satriano J, Blantz RC, and Vallon V (2001) Ornithine decarboxylase, kidney size and the tubular hypothesis of glomerular hyperfiltration in experimental diabetes. J Clin Investig 107: 217–224.[Medline]
Urakami Y, Okuda M, Masuda S, Saito H, and Inui KI (1998) Functional characteristics and membrane localization of rat multispecific organic cation transporters, OCT1 and OCT2, mediating tubular secretion of cationic drugs. J Pharmacol Exp Ther 287: 800–805.[Abstract/Free Full Text]
Vaamonde CA, Bier RT, Gouvea W, Alpert H, Kelley J, and Pardo V (1984) Effect of duration of diabetes on the protection observed in the diabetic rat against gentamicin-induced acute renal failure. Miner Electrolyte Metab 10: 209–216.[Medline]
Vlassara H, Striker LJ, Teichberg S, Fuh H, Li YM, and Steffes M (1994) Advanced glycation end products induce glomerular sclerosis and albuminuria in normal rats. Proc Natl Acad Sci USA 91: 11704–11708.[Abstract/Free Full Text]
Wu X, Huang W, Ganapathy ME, Wang H, Kekuda R, Conway SJ, Leibach FH, and Ganapathy V (2000) Structure, function and regional distribution of the organic cation transporter OCT3 in the kidney. Am J Physiol 279: F449–F458.
Yu PH and Zuo DM (1999) Aminoguanidine inhibits semicarbazide-sensitive amine oxidase activity: implications for advanced glycation and diabetic complications. Diabetologia 40: 1243–1250.
Ziyadeh FN, Fumo P, Rodenberger CH, Kuncio GS, and Neilson EG (1995) Role of protein kinase C and cyclic AMP/protein kinase A in high glucose-stimulated transcriptional activation of collagen alpha 1 (IV) in glomerular mesangial cells. J Diabetes Complicat 9: 255–261.[CrossRef][Medline]
Zwart R, Verhaagh S, Buitelaar M, Popp-Snijders C, and Barlow DP (2001) Impaired activity of the extraneuronal monoamine transporter system known as uptake-2 in Orct3/Slc22a3-deficient mice. Mol Cell Biol 21: 4188–4196.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Drug Metab. Dispos.Home page
T. Matsuzaki, T. Morisaki, W. Sugimoto, K. Yokoo, D. Sato, H. Nonoguchi, K. Tomita, T. Terada, K.-i. Inui, A. Hamada, et al.
Altered Pharmacokinetics of Cationic Drugs Caused by Down-Regulation of Renal Rat Organic Cation Transporter 2 (Slc22a2) and Rat Multidrug and Toxin Extrusion 1 (Slc47a1) in Ischemia/Reperfusion-Induced Acute Kidney Injury
Drug Metab. Dispos., April 1, 2008; 36(4): 649 - 654.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. M. Pelis, Y. Dangprapai, T. M. Wunz, and S. H. Wright
Inorganic mercury interacts with cysteine residues (C451 and C474) of hOCT2 to reduce its transport activity
Am J Physiol Renal Physiol, May 1, 2007; 292(5): F1583 - F1591.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. M. Pelis, X. Zhang, Y. Dangprapai, and S. H. Wright
Cysteine Accessibility in the Hydrophilic Cleft of Human Organic Cation Transporter 2
J. Biol. Chem., November 17, 2006; 281(46): 35272 - 35280.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
G. Ciarimboli, T. Ludwig, D. Lang, H. Pavenstadt, H. Koepsell, H.-J. Piechota, J. Haier, U. Jaehde, J. Zisowsky, and E. Schlatter
Cisplatin Nephrotoxicity Is Critically Mediated via the Human Organic Cation Transporter 2
Am. J. Pathol., December 1, 2005; 167(6): 1477 - 1484.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
F. Y. Chow, D. J. Nikolic-Paterson, E. Ozols, R. C. Atkins, and G. H. Tesch
Intercellular Adhesion Molecule-1 Deficiency Is Protective against Nephropathy in Type 2 Diabetic db/db Mice
J. Am. Soc. Nephrol., June 1, 2005; 16(6): 1711 - 1722.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.104.070672v1
311/2/456    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thomas, M. C.
Right arrow Articles by Forbes, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thomas, M. C.
Right arrow Articles by Forbes, J. M.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition