![]() |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
NEUROPHARMACOLOGY
7-Nicotinic Acetylcholine Receptors in Rat Midbrain Dopamine Neurons
Divisions of Neurology (J.W.) and Neurobiology (A.A.G., K.M.S., L.X., S.M.-M., L.L., R.J.L.), Barrow Neurological Institute, Phoenix, Arizona
Received April 21, 2004; accepted June 2, 2004.
| Abstract |
|---|
|
|
|---|
7-subunits [
7-nicotinic acetylcholine receptors (nAChRs)], in modulation of DA signaling and in nicotine dependence are not clearly understood. Although midbrain slice recording has been used previously to identify functional
7-nAChRs, these preparations are not optimally designed for extremely rapid and reproducible drug application, and rapidly desensitized,
7-nAChR-mediated currents may have been underestimated or not detected. Here, we use patch-clamp, whole-cell current recordings from single neurons acutely dissociated from midbrain nuclei and having features of DA neurons to characterize acetylcholine-induced, inward currents that rapidly activate and desensitize, are mimicked by the
7-nAChR-selective agonist, choline, blocked by the
7-nAChR-selective antagonists, methyllycaconitine and
-bungarotoxin, and are similar to those of heterologously expressed, human
7-nAChRs. We also use reverse transcriptase-polymerase chain reaction, in situ hybridization, and immunocytochemical staining to demonstrate nAChR
7 subunit gene expression as message and protein in the rat substantia nigra pars compacta and ventral tegmental area. Expression of
7 subunit message and of
7-nAChR-mediated responses is developmentally regulated, with both being absent in samples taken from rats at postnatal day 7, but later becoming present and increasing over the next 2 weeks. Collectively, this electrophysiological, pharmacological, and molecular evidence indicates that nAChR
7 subunits and functional
7-nAChRs are expressed somatodendritically by midbrain DA neurons, where they may play important physiological roles and contribute to nicotine reinforcement and dependence.
There are indications that nicotinic acetylcholine receptors (nAChR) play important roles in midbrain DA function that may be of particular relevance to nicotine dependence. For example, a high density of nAChR subunit expression is observed in the VTA and SNc (Wada et al., 1989
; Azam et al., 2002
), where they could assemble as diverse nAChR subtypes to serve as targets of nicotine and become involved in mediation of nicotine self-administration and perhaps in reinforcement of other biologically rewarding events (Stolerman and Shoaib, 1991
; Dani and Heinemann, 1996
). Nicotine, acting on post- or presynaptic nAChR, can modulate DA release (Wonnacott et al., 2000
; Jones et al., 2001
; Zhou et al., 2001
). Furthermore, DA neuronal activity in the VTA or SNc is also sensitive to the effects of nicotine in stimulating or desensitizing postsynaptic nAChR (Pidoplichko et al., 1997
; Wooltorton et al., 2003
).
nAChR containing
7 subunits (
7-nAChR) are prominent in both the vertebrate central and autonomic nervous systems. The presence of
7-nAChR identified by the existence of
-bungarotoxin (Bgt)-binding sites has been known for many years (Morley et al., 1979
; Schmidt, 1988
; Clarke, 1992
; Sargent, 1993
). These Bgt-binding sites have been known to exhibit many of the biochemical and pharmacological features characteristic of true
7-nAChR, to have brain distributions sub- or perisynaptic to cholinergic terminals, and to have levels of expression sensitive to chronic nicotine exposure and/or modification of cholinergic inputs (Lukas and Bencherif, 1992
). Subsequent study of the function of natural, Bgt-binding nAChR uncovered short-lived, nicotinegated, toxin-sensitive, inward currents and/or elevations of intracellular Ca2+ in chick autonomic neurons (Vijayaraghavan et al., 1992
; Zhang et al., 1996
), in human ganglionic neuron-like clonal cells (Puchacz et al., 1994
), and in rat central nervous system immature neurons maintained in primary cell culture (Zorumski et al., 1992
; McGehee et al., 1995
; Alkondon et al., 1996
; Bonfante-Cabarcas et al., 1996
). Many cell types in the central nervous system that naturally express Bgt-binding sites have been shown to express
7 subunit genes (Lukas et al., 1993
). Knockout of the
7 subunit gene leads to the absence of Bgt-binding nAChR in cell lines or in mice, and these animals also lack rapid kinetic responses to nicotinic agonists (Puchacz et al., 1994
; Orr-Urtreger et al., 1997
).
nAChR
7 subunit mRNA has been detected in about 50% of the neurons tested from the SNc and VTA (Elliott et al., 1998
; Klink et al., 2001
), suggesting involvement of
7-nAChR in midbrain DA neuronal function. Previous patch-clamp recordings from neurons in midbrain slice preparations have demonstrated that high concentrations of acetylcholine (ACh) or choline induce whole-cell current responses with fast kinetics sensitive to blockade by Bgt or the
7-nAChR-selective antagonist, methyllycaconitine (MLA; Pidoplichko et al., 1997
; Klink et al., 2001
; Champtiaux et al., 2003
; Wooltorton et al., 2003
). However, perfusion of brain slice preparations is slow, complicating the ability to rapidly and reproducibly apply and remove drugs as is required to detect and characterize rapidly desensitized
7-nAChR-mediated currents (Gray et al., 1996
; Pidoplichko et al., 1997
). Therefore, there may be deficiencies in our understanding of the physiology, pharmacology, and channel properties of functional nAChR, including
7-nAChR, in midbrain DA neurons.
Here, we provide studies employing both perforated patch-clamp recording and molecular biological techniques describing the properties of pharmacologically identified, somatodendritic
7-nAChR on acutely dissociated, single DA neurons from the VTA and SNc. Our studies reveal new potential mechanisms by which somatodendritic, midbrain neuronal
7-nAChR may contribute to physiologically important DA neuronal activity of possible relevance to nicotine dependence.
| Materials and Methods |
|---|
|
|
|---|
|
Immunostaining. Immunohistochemical detection of the nAChR
7 subunit was accomplished via several steps. Postnatal day 21 brains were removed, frozen in liquid nitrogen for 15 s, and stored at 80°C for
2 days. Coronal 20-µm cryostat sections were obtained, serially mounted onto subbed slides, and stored at 80°C with desiccant until processed (
3 days). The slides were then allowed to reach room temperature, rinsed twice in phosphate-buffered saline (PBS; made with ddH2O), fixed in 4% paraformaldehyde, rinsed, then treated with 3% H2O2 for 5 min to block endogenous peroxidase activity, and rinsed again before blocking nonspecific binding by incubating in rinse solution [PBS made with ddH2O containing 1% bovine serum albumin, 10% dimethyl sulfoxide, and 5% Triton X-100 containing 10% normal (horse) serum] for 20 min. Primary antibody mAb 306 (Sigma-Aldrich, St. Louis, MO) was then added overnight at 4°C, followed by 30-min sequential incubations using biotinylated secondary antibody (Vector Laboratories, Burlingame, CA) and horseradish peroxidase-conjugated avidin-biotin complex (Vector Laboratories) in 1% bovine serum albumin-PBS. Antigen was detected using diaminobenzidine (Vector Laboratories). Between addition of primary antibody and antigen detection, slides were rinsed twice for 10 min in rinse solution between steps. Slides were then dehydrated and permanently mounted using Permount (Sigma-Aldrich). Sections were viewed under bright field (Olympus IX70 microscope), and images were captured at 200x magnification using Magnafire 2.1 software (Optronics, Goleta, CA; Fig. 1A, right). Parallel slides where primary antibody was omitted showed no staining (data not shown).
|
To identify single, dissociated cells after a patch-clamp recording session, the recording pipette was filled with Lucifer yellow CH (Sigma-Aldrich; 1.0 mg/ml dissolved in the recording solution), and dye was ejected by a pulse (200 ms, 0.5 Hz) of hyperpolarizing current (1.0 nA) for 3 min. Cells were then fixed with 4% paraformaldehyde for 10 min, rinsed three times with PBS, treated for 20 min with 0.03% hydrogen peroxide to quench endogenous peroxidase activity, and permeabilized with blocking solution (10% horse serum in PBS) containing 0.02% Triton X-100. Rabbit anti-tyrosine hydroxylase primary antibody (AB152; Chemicon International, Temecula, CA) was added overnight at 4°C in blocking solution, followed by incubation (30 min) with horseradish peroxidase-conjugated donkey anti-rabbit secondary antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), with three 10-min PBS rinses between steps. Lucifer yellow was visualized using epifluorescence (Fig. 2A, left); tyrosine hydroxylase staining was detected using diaminobenzidine (Vector Laboratories), and images were obtained as described above (Fig. 2A, right).
In Situ Hybridization. Wistar rats (postnatal days 721) were sacrificed, and brains were immediately removed and snap-frozen in isopentane. Samples were stored in desiccant at 80°C and subsequently sectioned (20 µm) using a cryostat. Sections were mounted on subbed (chrome alum and gelatin), poly-D-lysine-coated slides and kept under desiccant at 80°C until required. Generation of cRNA probes from known nAChR subunit templates involved utilizing Ambion's Lig'n Scribe no-cloning promoter addition systems and MAXIscript in vitro transcription. Briefly,
7 subunit primers were generated in forward and reverse orientations to allow polymerase chain reaction (PCR)-based amplification of heterologous, cytoplasmic domains from human, mouse, and rat
7 subunit cytoplasmic regions. PCR products were run on a 1% agarose gel to confirm size and quantity of DNA. After product purification, cytoplasmic domain templates for
7 subunits were nondirectionally ligated to the T7 phage promoter adapter. Gene-specific
7 subunit primers were chosen according to the desired orientation. Concomitant with the use of Lig'n Scribe PCR adapter primers, subsequent PCR of the ligation product was performed, and transcription templates for sense and antisense orientations were selected for in vitro transcription reactions.
7 sense and antisense cRNAs, 232 bp in length, were transcribed incorporating biotinylated UTPs. Stored sections were thawed by rinsing in 1x PBS and then fixed in 4% paraformaldehyde. Samples were subsequently rinsed in 1x PBS for 5 min, and sections were then acetylated, delipidated with chloroform, and serially dehydrated with ethanol (50, 75, 85, and 95%). Sections were then incubated in prehybridization solution containing final concentrations of 250 µg/ml tRNA, 25% formamide, 10% dextran sulfate, 2.5x Denhardt's solution, 0.05 mg/ml salmon sperm DNA, 48 mM NaCl, 60 mM sodium citrate, 80 mM NaH2PO4, pH 7.0, and 4 mM EDTA, pH 8.0, for 2 h at 50°C. Sections were then incubated in hybridization solution containing antisense or sense probes (final concentration ranging from 0.20.7 ng/µl) for 20 h at 50°C. After hybridization, sections were rinsed twice in 2x SSC for 5 min each, 1x SSC for 10 min, 0.5x SSC for 10 min, and 0.1x SSC for 20 min at 60°C, and then briefly rinsed in ddH2O. Slides were then dehydrated in a graded ethanol series and vacuum dried under desiccant. Samples were conjugated using avidin-Alexa fluorophore complexes and subjected to fluorescence microscopy and image analysis using Image Pro Plus version 4.1 (Media Cybernetics, Silver Spring, MD) (Fig. 1A, left and middle). Staining was only observed in samples treated with antisense probe, and additional control studies using cell lines expressing
7-nAChR and excess unlabeled antisense riboprobe also were devoid of signal, demonstrating specificity of the technique.
RNA Preparation and Reverse Transcriptase (RT)-PCR. RT-PCR was performed as previously described (Kuo et al., 2002
). Briefly, total RNA was isolated from tissue punches representing the SNc via dissociation through a 23-gauge needle in TRIZOL reagent. RNA was prepared according to the manufacturer's instructions followed by DNase I (Invitrogen, Carlsbad, CA) treatment to remove any residual genomic DNA and quantitated spectrophotometrically for reverse transcription using the Superscript II Preamplification system (Invitrogen). Typically, 1 µg of RNA was used for each RT reaction consisting of a cocktail of 10 rat-specific nAChR subunit antisense primers plus a primer for the housekeeping gene, gapdh. Each reaction was carried out at 48°C, heat inactivated, and RNase H treated prior to PCR. PCR was performed with approximately 70 ng of RT template, 200 nM each sense and antisense gene-specific primer pairs, 200 µM dNTPs, and 2.5 units of RediTaq (Sigma-Aldrich). Standard PCR reactions were performed using a RoboCycler (Stratagene, La Jolla, CA) for 35 cycles using the following amplification protocol: 95°C for 60 s, 55°C for 90 s, and 72°C for 90 s, followed by a single-cycle, 4-min 72°C extension. One-fifth of each reaction was run on an ethidium bromide/1% agarose gel for visualization against a 100-bp sizing ladder (New England Biolabs, Beverly, MA). Representative samples without template DNA or minus reverse transcriptase were routinely run to monitor potential contamination. Whole rat brain RNA was purchased from Ambion (Austin, TX). Rat oligonucleotide primer pairs used in this study are presented in the 5'
3' orientation with the sense primer listed first:
2, cgggtgcccaggtggctgatga/gaggtgacagcagaatctcgctag,
3, gctgtgcttcggtggtcagcacc/gccggcgggatccaagtcacttc;
4, gaatgtcacctccatccgcatc/ccggca(a/g)ttgtc(c/t)ttgaccac;
5, cctagaggaccaagatgtcgacag/gtccagccccactctcggcttc;
6, gtgtttgtgttgaacata/ctacctcctt(g/t)gtttcattgtggct;
7, gttctatgagtgctgcaaagagcc/ctccacactggccaggctgcag;
9, gctcagaaattgttcagcgatc/cagcaggcatgccatggacc;
2, ctccaactcaatggcgctgttcag/ccatgagcgaaacttcatggtgcaa;
3, ggttccatcagaatcgctc/ccgtgagaaaagacaaccccagg;
4, caagagtgcctgcaagattgaggtg/ggagctgactgcagacttaggagc; and gapdh, cggatttggccgtatcggacgcc/gccttggcagcaccagtggatgc. All primer pairs except
2,
5,
6, and
3 span one or more exons. All nAChR primer sets, except
2 and
5 (Keiger and Walker, 2000
), were designed to be subunit specific, species universal (rat/mouse/human) in our laboratory using DNASTAR software (Lasergene, Madison, WI).
Patch-Clamp Whole-Cell Recordings. Perforated and conventional patch-clamp whole-cell recordings were employed (Wu and Partridge, 1998
). The perforated patch recordings were crucial for obtaining stable ACh responses from dissociated midbrain neurons, although the precise mechanism involved is still unclear. The pipettes (35 M
) used for perforated patch recording were filled with intracellular recording solution containing nystatin. After tight seal (>2 G
) formation, it usually took 5 to 30 min to convert to perforated patch mode (Horn, 1991
), which was monitored by access resistance. An access resistance of less than 60 M
was accepted to start the experiments. Series resistance was not compensated in this study. The data were filtered at 2 kHz, acquired at 5 kHz, and digitized online (Axon Instruments Digidata 1200 series A/D board, Axon Instruments Inc., Union City, CA). All experiments were performed at room temperature (22 ± 1°C). Studies of acutely dissociated neurons were done using cells attached to the cell culture dish, whereas studies of cells transfected to express human
7-nAChR were lifted off the dish via the recording pipette before study.
Solutions and Drug Application. The standard external solution contained 150 mM NaCl, 5 mM KCl, 1 mM MgCl2, 2 mM CaCl2, 10 mM glucose, and 10 mM HEPES, pH 7.4 with Tris base. The nystatin-perforated patch pipette solution used for current- and voltage-clamp recordings contained 150 mM potassium gluconate, 5 mM MgCl2, and 10 mM HEPES, pH 7.2 with Tris-OH. Nystatin was dissolved in acidified methanol, and the stock solution was diluted with the internal (patch-pipette) solution to a final concentration of 200 to 300 µg/ml just before use. The pipette solution for conventional whole-cell recordings contained 140 mM KCl, 4 mM MgCl2, 0.1 mM EGTA, 4 mM ATP, and 10 mM HEPES, pH 7.4 with KOH. To initiate whole-cell current responses, under constant superfusion of the recording chamber, nicotinic agonists were rapidly delivered into the bath medium by a computer-controlled U-tube system, in which the applied drug completely surrounds the recorded cell in less than 30 ms (Zhao et al., 2003
). The times between drug applications (
3 min) were adjusted specifically to ensure stability of nAChR responsiveness (absence of functional rundown). The drugs used in the present study were ()nicotine, ACh, choline, MLA, mecamylamine, dihydro-
-erythroidine, Bgt, APV, and atropine sulfate (Sigma-Aldrich). RJR-2403 fumarate (C10H14N2.C4H4O4) and CNQX were purchased from Tocris Cookson Inc. (Ellisville, MO). In experiments using ACh as the agonist, 1 µM atropine sulfate was routinely added to the standard solution to exclude any possible influences of muscarinic receptors, although the drug had no clear effects on nAChR-mediated currents (Fig. 3A).
|
Data Acquisition and Analysis. All experimental data were recorded using a 200B amplifier (Axon Instruments Inc.), typically using data filtered at 2 kHz, acquired at 5 kHz, displayed and digitized online (Axon Instruments Digidata 1200 series A/D board), and stored to hard drive. Data acquisition and analyses were done using Pclamp8 (Axon Instruments Inc.), and results were plotted using Origin 5.0 (OriginLab Corp., Northampton, MA). nAChR acute desensitization was analyzed for decay time (
), peak current (Ip), and steady-state current (Is) using fits to the mono-exponential expression I = [(Ip Is)ekt] + Is. There was no significant improvement if data were fit to higher order exponential expressions. Data usually were fit over the period between 90 and 10% of the peak inward current. Curve fitting for sigmoid agonist and antagonist data were performed using Origin (OriginLab Corp.) or Prism (GraphPad Software Inc., San Diego, CA) and the Hill equation.
| Results |
|---|
|
|
|---|
7 Subunit Expression in Midbrain DA Nuclei. Studies were done to assess natural expression of nAChR
7 subunits in the VTA and SNc. In situ hybridization and immunohistochemistry revealed extensive nAChR
7 subunit expression as mRNA and protein in the SNc and VTA (Fig. 1A). Comparisons between SNc and whole-brain expression of
7 and other nAChR subunits based on RT-PCR showed that
7 subunit message could also be detected in the SNc using an alternative approach. Our findings of native expression of nAChR
7 subunit mRNA in the VTA and SNc regions are consistent with previous reports (Wada et al., 1989
Identification of Midbrain DA Neurons. Cells acutely dissociated from the VTA or SNc were subjected to electrophysiological and histological characterization to determine whether they met standard criteria used to identify neurons expressing DA phenotypes. The structure of such a DA neuron from the VTA was revealed after it was injected with Lucifer yellow upon termination of the electrophysiological recording session (Fig. 2A). The same neuron was subsequently shown to be tyrosine hydroxylase positive after immunostaining based on horseradish peroxidase labeling (Fig. 2A), and similar neurons also exhibited immunofluorescence staining for
7 subunits (Fig. 2B). From the same cell as shown in Fig. 2A, the representative traces shown in Fig. 2, C and D were obtained using patch-clamp recordings. Current-clamp recording from this cell showed that it exhibited spontaneous activity characterized by long-duration action potentials (>2.5 ms) appearing with a frequency of
3 Hz (Fig. 2C). Upon application of DA (10 µM), there was hyperpolarization of the membrane potential and cessation of spontaneous activity (Fig. 2C). Current-clamp recordings showed a "sag" in membrane potential changes (Fig. 2D, a), and voltage-clamp recordings showed a hyperpolarization-activated current (H-current, Fig. 2D, b). Collectively, these features show that this neuron, and others presented in the remainder of this study, exhibited electrophysiological, immunostaining, and morphological characteristics of DA neurons.
nAChR-Mediated Currents in Midbrain DA Neurons. To evaluate expression of functional nAChR in identified DA neurons, ACh-induced currents (IACh) were recorded using the perforated patch whole-cell recording technique coupled with computer-controlled, U-tube-mediated, rapid drug application. At a holding potential of 60 mV, 1 mM ACh-induced inward currents consisted of a rapidly activated and desensitized transient peak response succeeded by a lower in amplitude, more slowly decaying, steady-state component (Fig. 3A; representative SNc DA neuron). Pharmacological blockade of muscarinic acetylcholine receptors using 1 µM atropine, ionotropic glutamate receptors using 50 µM CNQX plus 100 µM APV, and voltage-gated Na+ channels using 1 µM tetrodotoxin had no effect on IACh when samples were pretreated for 3 min with these drugs (Fig. 3A). The IACh also was insensitive to blockade by 100 nM
-conotoxin MII (Fig. 3A), which actually and significantly enhanced IACh (p < 0.05, n = 6). These results indicate that IACh is mediated via activation of somatodendritic nAChR on SNc (or from other results on VTA) DA neurons. In addition, in current-clamp recordings, both ACh and choline modulated DA neuron spontaneous activity by transiently increasing cell firing rates soon after ACh or choline application and also by ceasing or lowering cell firing rates after prolonged exposure to ACh or choline (Fig. 3, D and E).
Perforated Whole-Cell Recordings Are Necessary for Maintaining IACh Stability. One of the challenges in studying
7-nAChR-mediated currents is current run down over time, which makes it difficult to evaluate receptor function and/or pharmacology. We assessed run down of IACh elicited by repetitive applications of ACh at 3-min intervals using either conventional or perforated patch whole-cell recordings (Fig. 4). IACh run down occurred over time when using conventional whole-cell recordings (Fig. 4A). In contrast, when employing perforated patch whole-cell recordings, IACh was stably maintained for at least 20 min (Fig. 4, B and C). Figure 4C summarizes peak current amplitudes for IACh recorded by these two methods and shows that the perforated patch whole-cell recording method is necessary for maintaining stable IACh.
|
Pharmacological Dissection of
7-nAChR-Mediated Currents. To distinguish between nAChR subtypes that might be contributing to IACh, different pharmacological probes selective or specific for distinct nAChR subtypes were employed. Fast, peak components of IACh were mimicked by application of a selective
7-nAChR agonist, choline, whereas slow, steady-state components of IACh were mimicked by application of a selective
4
2-nAChR agonist (Papke et al., 2000
), RJR-2403 (Fig. 5A). The slow component of IACh was completely blocked by a noncompetitive, nonselective nAChR antagonist, mecamylamine, whereas the remaining fast component was abolished by addition of MLA, a relatively selective
7-nAChR antagonist (Fig. 5B). Both MLA (Fig. 5C, a) and Bgt (Fig. 5C, b) selectively blocked the fast component without affecting the slow component. The responses recovered faster from MLA than from Bgt block. Moreover, 10 mM choline-induced fast inward currents (Icholine) were completely abolished by 1 nM MLA (Fig. 5D, a), whereas a selective
4
2-nAChR antagonist, dihydro-
-erythroidine (1 µM), blocked the RJR-2403-induced slow inward current (Fig. 5D, b). From a total of 68 DA neurons dissociated from the SNc, 66 neurons (98%) responded to 1 mM ACh, whereas 50 neurons (73%) responded to both ACh (1 mM) and choline (10 mM). Similarly, from 40 DA neurons dissociated from the VTA, 38 neurons (96%) responded to 1 mM ACh and 33 neurons (83%) responded to both ACh (1 mM) and choline (10 mM). There are no clear differences in cholinergic (ACh or choline) responses when comparing these two brain regions.
|
Concentration-Response Relationship for
7-nAChR-Mediated Currents. To determine agonist affinity for functional
7-nAChR naturally expressed in midbrain DA neurons, a concentration-response relationship for choline, a selective agonist of
7-nAChRs, was examined in VTA and SNc DA neurons, and was compared with concentration-response profiles for activation of functional, human
7-nAChR heterologously expressed in the SH-EP1-h
7 cell-line (Zhao et al., 2003
; Fig. 6). Based on summation of individual records (Fig. 6A), fits of the data to the Hill equation indicated that EC50 values for Icholine recorded from VTA, SNc, and SH-EP1-h
7 cells were 4.5, 2.7, and 0.9 mM, respectively, and the values of the Hill coefficient were 0.90, 0.91, and 1.10, respectively. Thus, choline showed higher functional agonist potency for SH-EP1 h
7-nAChR than for rat SNc (3-fold) or VTA (5-fold)
7-like-nAChR.
|
Kinetics of
7-nAChR-Mediated Currents in SNc, VTA, and
7-Transfected Cells. Since
7-nAChR-mediated currents are characterized by fast activation and acute desensitization (which is the term we apply to describe the decay from peak to steady-state inward current levels during agonist exposure, in this case, over 2 s of drug exposure), the kinetics of choline-induced currents were analyzed in DA neurons dissociated from either the SNc (seven neurons) or VTA (11 neurons; using cells attached to the dish), and also in
7-nAChR-expressing SH-EP1 cells (12 cells; using the lifted cell technique). The results show that the required time to traverse from 10 to 90% of the peak current response (rising time) was 20.4 ± 4.8 ms for SNc cells, 29.4 ± 5.9 ms for VTA cells, and 13.6 ± 1.7 ms for
7-nAChR transfected cells, respectively (Fig. 7). The half-times for decay from peak current to steady-state levels during acute desensitization were 14.8 ± 2.6 ms (SNc), 17.5 ± 2.4 ms (VTA), and 23.0 ± 3.8 ms (
7-nAChR-expressing SH-EP1 cells), respectively (Fig. 7). Statistical analyses indicate that rising times are only statistically different (p < 0.05) when comparing activation of responses in VTA DA neurons to those in transfected SH-EP1 cells, perhaps simply reflecting faster, drug perfusion rate-limited responses obtained when using lifted, transfected cells (p < 0.05). Furthermore, there is no significant difference in the rate of acute desensitization of responses from these three types of cells (Fig. 7B). These results suggest that there are functional
7-nAChR-mediating fast, choline-, MLA-, and Bgt-sensitive currents located somatodendritically on single, DA neurons freshly isolated from midbrain nuclei. The slower, steady-state response, characterized by slow acute desensitization, seems to include contributions from non-
7-nAChR (likely
4
2-nAChR).
|
Developmental Changes in
7-nAChR Expression in DA Neurons. We undertook additional studies to assess the developmental profile for nAChR
7 subunit and functional
7-nAChR expression in rat brain. From rats younger than postnatal day 7, no detectable ACh responses were recorded (seven neurons from three animals). Typical traces indicated that whole-cell current responses to ACh are evident at postnatal day 10, and peak current amplitudes in response to ACh continued to increase until postnatal days 18 to 21 (Fig. 8, A and C). Similarly, Icholine could only be recorded from postnatal day 10 and had amplitudes that increased through postnatal day 18 (Fig. 8C). The proportion of neurons that showed responses of greater than 25 pA magnitude to ACh that also showed responses of that same magnitude to choline increased with age and was evident in 83% of recorded VTA/SNc DA neurons from postnatal days 18 to 22 (Fig. 8B). A summary of the findings taken from numerous cells (Fig. 8C) reinforces the observations illustrated as individual traces (Fig. 8A). Likewise, in situ hybridization analyses revealed a pattern of increasing nAChR
7 subunit mRNA levels with age during the first 1 to 3 postnatal weeks (Fig. 8D).
|
| Discussion |
|---|
|
|
|---|
7-nAChR located somatodendritically on single, midbrain DA neurons based on the following evidence. In identified DA neurons, ACh-induced whole-cell currents are insensitive to blockade by atropine, APV plus CNQX, or tetrodotoxin, meaning that postsynaptic nAChR mediate the observed responses. ACh-induced, fast peak current responses are mimicked by application of an
7-nAChR-selective agonist, choline, and blocked by
7-nAChR-selective antagonists, such as Bgt and MLA, also suggesting that
7-nAChR are responsible for the effects. Agonist concentration-response relationships showing comparatively low affinity for nicotinic agonists and the fast activation and acute desensitization of responses further confirms functional
7-nAChR-like behavior. Developmentally regulated expression of nAChR
7 subunit message and protein parallels expression of functional
7-nAChR-like responses. Thus, our approaches provide, and our findings validate, an experimental basis for understanding native
7-nAChR physiology, pharmacology, and pathophysiology at the single midbrain neuronal level.
The current RT-PCR results illustrate significant expression of nAChR
7 subunit mRNA in the SNc and complement clear, in situ hybridization and immunocytochemical evidence of
7 subunit mRNA and protein expression in VTA and SNc neurons. These experimental results demonstrate the existence of building blocks for generation of
7-nAChR in the mesolimbic dopamine system (VTA and SNc), and they are consistent with previous observations (Zoli et al., 1998
; Arroyo-Jimenez et al., 1999
; Klink et al., 2001
; Azam et al., 2002
).
Other findings reported here are consistent with previous evidence showing that high concentrations of ACh induce fast, inward currents sensitive to MLA or Bgt, characteristic of functional
7-nAChR, in cells taken from VTA slices (Pidoplichko et al., 1997
). Our observations are also consistent with patch-clamp recording results from midbrain slices combined with single-cell RT-PCR techniques that were used to provide a rather detailed survey of molecular and physiological diversities of nAChR subtypes, including
7-nAChR, located in the VTA and SNc regions (Klink et al., 2001
). Similarly, the results of our studies complement those obtained from alternative strategies that were employed to study
7-nAChR function in midbrain slices, e.g., employing
7-nAChR mutations (
7L250T; Revah et al., 1991
) to slow desensitization of
7-nAChR (Ji et al., 2001
) or by conducting analyses using nAChR
2-subunit knockout mice, both of which may have increased
7-nAChR function and/or the ability to detect it, since
7-nAChR-mediated currents became predominant and seemed to be more resistant to desensitization during prolonged (about 10 min) exposure to low concentrations of nicotine in these models (Wooltorton et al., 2003
). However, these previous studies might have been confounded by a low expression of
7-nAChR and their rapid desensitization kinetics, which present technical difficulties for convincingly establishing the properties of functional
7-nAChR when patch-clamp recording techniques are used, especially when employing brain slice preparations. Both slow drug application and washout, while performing slice recordings, will desensitize
7-nAChR, and even when using a pressure injection system to increase drug application speed, it is still difficult to rapidly apply different drugs to the same neuron for pharmacological studies. Another limitation is that a brain slice is indeed a complex system, containing both DA and nonDA neurons. Additionally, nAChR are also found post- and presynaptically. Bath-applied nicotinic ligands may directly or indirectly affect DA or nonDA neurons. Moreover, our current demonstration of developmentally dependent expression of both
7 subunits and functional
7-nAChR may also have adversely impacted earlier studies.
To overcome these technical limitations, we applied perforated patch-clamp recordings to acutely dissociated, single DA neurons. We paid special attention to neuron dissociation and recording procedures. For instance, we found that maintaining dissociated neurons in their original morphology (with relatively long dendrites) is important to induce nAChR-mediated currents in VTA and SNc DA neurons. In the present study, from 108 DA neurons dissociated from the VTA and SNc, 97% responded to ACh, whereas 78% responded to choline. The ratio of neurons responding to choline in our study is higher (using acutely dissociated neurons) when compared with previously published work that employed slice preparations (Klink et al., 2001
; Wooltorton et al., 2003
). Considering that the ratio of ACh-induced responses in the present study (97% of cells tested) and in the previous report (95% of cells tested; Klink et al., 2001
) are comparable, but that the ratio of choline-induced current is higher in the present study (78% of cells tested) than in the previous report (
50% of cells tested; Klink et al., 2001
), perhaps use of single, dissociated neurons has aided our ability to detect fast
7-nAChR-mediated currents. Findings may also be influenced by: the animal strains/species employed, postnatal ages, the enzyme used for cell dissociation, or the single-cell dissociation procedure. Another important finding is that perforated patch whole-cell recordings used in this study, rather than conventional whole-cell recordings (Fig. 4), resulted in relatively long-term, stable nicotinic responses (for at least 20 min), which allowed us to analyze the pharmacological properties of
7-nAChR, such as concentration-response relationships from the same recorded neuron. Furthermore, our interesting and important finding of the developmentally regulated increase in
7-nAChR expression and channel function allowed us to choose an optimal age range (postnatal days 1821) for the productive study of
7-nAChR function.
The electrophysiological responses to nicotinic agonists that we identified were pharmacologically distinct from those that could be mediated by other signaling molecules, such as muscarinic or ionotropic glutamate receptors. Distinctive features of whole-cell current responses to ACh (fast peak and slower steady-state components) could be further parsed pharmacologically. The sensitivity of steady-state responses to mecamylamine, dihydro-
-erythroidine, and RJR-2403, but not to choline, suggests they are mediated by non-
7-nAChR. Because these slow responses are also insensitive to blockade by
-conotoxin MII, they are not likely to be due to somatodendritic, DA neuronal nAChR containing
6- or perhaps
3-subunits. Therefore, our interpretation is that slow, steady-state current responses to ACh are due to
4
2-nAChR. By contrast, fast, peak current responses that are sensitive to activation by choline and blockade by MLA or Bgt clearly demonstrate characteristics of
7-nAChR, and parallel studies comparing these properties with those of heterologously expressed
7-nAChR reinforce this conclusion. Thus, we demonstrate that two kinds of nAChR, the abundant
7- and
4
2-nAChR subtypes, are both expressed by most midbrain DA neurons. This means that DA neurons, as well as neurons from other brain regions (Alkondon et al., 1996
), can be counted among those cells that may be used as models in future studies of the specific roles played by diverse nAChR subtypes in the control of brain neuronal function.
Our observation that ACh induces an initial increase in DA neuronal firing rates followed by a period of membrane potential hyperpolarization and absence of cell firing upon prolonged (>10 s) exposure is consistent with earlier observations of the complex effects of nicotinic agonist exposure on DA cell activity that probably reflects an admixture of activities across nAChR subtypes. Previous electrophysiological experiments indicated that nicotine increases VTA DA neuron firing frequency and alters firing patterns from single spikes to burst patterns, which leads to an increase of DA release in the nucleus accumbens (Calabresi et al., 1989
). Our studies using ACh reveal a similar effect, but just transiently. In vivo experiments have shown that nicotine self-administration is reduced either by creating a lesion of the mesolimbic DA system or by direct microinfusion of
7-nAChR antagonists into the VTA (Corrigall and Coen, 1989
; Corrigall et al., 1994
). Based on other results, it has been postulated that
7-nAChR located on presynaptic glutamatergic terminals in the VTA play an important role in the regulation of DA neuron activity (Wonnacott et al., 2000
; Jones et al., 2001
; Zhou et al., 2001
), but much less is known about the roles of postsynaptic
7-nAChR in midbrain DA neuronal function. According to a recent report, VTA
7-nAChRs exhibit far less desensitization when persistently exposed to a smoker's level of nicotine than do non-
7-nAChRs, which suggests an important role of
7-nAChR in nicotine addiction (Wooltorton et al., 2003
). Our preliminary observation that prolonged exposure to choline also induces initial activation followed by a sustained decrease in DA neuron activity, although less dramatic when compared with exposure to ACh, is consistent with possibly lower "chronic" desensitization of
7-nAChR-compared with
4
2-nAChR-mediated responses in the presence of agonist at lower concentrations. Thus, we now have evidence of somatodendriticand presumably postsynaptic
7-nAChR on midbrain DA neurons, with most of the dendrites being preserved by our acute dissociation technique, which suggests that
7-nAChR contribute to cholinergic and nicotinic control of VTA or SNc DA neuronal firing. Nevertheless, more work is needed to more completely extricate cause-effect relationships and explore the specific roles of selected nAChR subtypes in the control of DA cell activity.
The fact that expression of
7 subunits and functional
7-nAChR are developmentally regulated has potential relevance to the development and activity of the midbrain DA system. First, the possible roles played by
7-nAChR in neurite extension and long-term potentiation could affect anatomic and functional substrates for reward in these cells and the systems they serve. Second, the increase in
7 subunit and
7-nAChR expression during the 2nd and 3rd weeks of development in the rat suggests that similar phenomena occurring at corresponding times in human development could influence not only the structure of entities comprising the reward system but also could modulate its function during adolescence, arguably the period of highest vulnerability to the initiation of drug use, which could cause some individuals to struggle with a life-long battle of dependence. As a result, the finding that naturally expressed
7-nAChR are abundantly positioned somatodendritically on single DA neurons located in the brain reward center gives new perspectives to mechanisms involved in nicotinic mediation of DA neuronal firing and signaling and provides a new model system with which roles of
7-nAChR (and other nAChR subtypes) can be explored in regards to their relevance in nicotine dependence and the molecular mechanisms of pleasure and reward.
| Footnotes |
|---|
ABBREVIATIONS: DA, dopamine or dopaminergic; VTA, ventral tegmental area; SNc, substantia nigra pars compacta; nAChR, nicotinic acetylcholine receptor(s); Bgt,
-bungarotoxin; ACh, acetylcholine; MLA, methyllycaconitine; PBS, phosphate-buffered saline; ddH2O, double distilled H2O; PCR, polymerase chain reaction; SSC, standard saline citrate; RT, reverse transcriptase; IACh, current response induced by acetylcholine; CNQX, 6-cyano-2,3-dihydroxy-7-nitroquinoxaline; APV, 2-amino-5-phosphonovalerate; Icholine, current response induced by choline.
Address correspondence to: Dr. Jie Wu, Division of Neurology, Barrow Neurological Institute, 350 West Thomas Road, Phoenix, AZ 85013-4496. E-mail: jwu2{at}chw.edu
| References |
|---|
|
|
|---|
Alkondon M, Rocha ES, Maelicke A, and Albuquerque EX (1996) Diversity of nicotinic acetylcholine receptors in rat brain: V. alpha-Bungarotoxin-sensitive nicotinic receptors in olfactory bulb neurons and presynaptic modulation of glutamate release. J Pharmacol Exp Ther 278: 14601471.
Arroyo-Jimenez MM, Bourgeois JP, Marubio LM, Le Sourd AM, Ottersen OP, Rinvik E, Fairen A, and Changeux JP (1999) Ultrastructural localization of the alpha 4-subunit of the neuronal acetylcholine nicotinic receptor in the rat substantia nigra. J Neurosci 19: 64756487.
Azam L, Winzer-Serhan UH, Chen Y, and Leslie FM (2002) Expression of neuronal nicotinic acetylcholine receptor subunit mRNAs within midbrain dopamine neurons. J Comp Neurol 444: 260274.[CrossRef][Medline]
Berke JD and Hyman SE (2000) Addiction, dopamine and the molecular mechanisms of memory. Neuron 25: 515532.[CrossRef][Medline]
Bonfante-Cabarcas R, Swanson KL, Alkondon M, and Albuquerque EX (1996) Diversity of nicotinic acetylcholine receptors in rat hippocampal neurons: IV. Regulation by external Ca++ of alpha-bungarotoxin-sensitive receptor function and of rectification induced by internal Mg++. J Pharmacol Exp Ther 277: 432444.
Calabresi P, Lacey MG, and North RJ (1989) Nicotinic excitation of rat ventral tegmental neurones in vitro studied by intracellular recording. Br J Pharmacol 98: 135140.[Medline]
Champtiaux N, Gotti C, Cordero-Erausquin M, David DJ, Przybylski C, Lena C, Clementi F, Moretti M, Rossi FM, Le Novere N, et al. (2003) Subunit composition of functional nicotinic receptors in dopaminergic neurons investigated with knockout mice. J Neurosci 23: 78207829.
Clarke PB (1992) The fall and rise of neuronal alpha-bungarotoxin binding proteins. Trends Pharmacol Sci 13: 407413.[CrossRef][Medline]
Corrigall WA and Coen KM (1989) Nicotine maintains robust self-administration in rats on a limited-access schedule. Psychopharmacology 99: 473478.[CrossRef][Medline]
Corrigall WA, Coen KM, and Adamson KL (1994) Self-administered nicotine activates the mesolimbic dopamine system through the ventral tegmental area. Brain Res 653: 278284.[CrossRef][Medline]
Dani JA and De Biasi M (2001) Cellular mechanisms of nicotine addiction. Pharmacol Biochem Behav 70: 439446.[CrossRef][Medline]
Dani JA and Heinemann S (1996) Molecular and cellular aspects of nicotine abuse. Neuron 16: 905908.[CrossRef][Medline]
Di Chiara G (1999) Drug addiction as dopamine-dependent associative learning disorder. Eur J Pharmacol 375: 1330.[CrossRef][Medline]
Elliott KJ, Jones JM, Sacaan AI, Lloyd GK, and Corey-Naeve J (1998) 6-hydroxydopamine lesion of rat nigrostriatal dopaminergic neurons differentially affects nicotinic acetylcholine receptor subunit mRNA expression. J Mol Neurosci 10: 251260.[Medline]
Gray R, Rajan AS, Radcliffe KA, Yakehiro M, and Dani JA (1996) Hippocampal synaptic transmission enhanced by low concentrations of nicotine. Nature (Lond) 383: 713716.[CrossRef][Medline]
Horn R (1991) Diffusion of nystatin in plasma membrane is inhibited by a glassmembrane seal. Biophys J 60: 329333.[Medline]
Ji D, Lape R, and Dani JA (2001) Timing and location of nicotinic activity enhances or depresses hippocampal synaptic plasticity. Neuron 31: 131141.[CrossRef][Medline]
Jones IW, Bolam JP, and Wonnacott S (2001) Presynaptic localisation of the nicotinic acetylcholine receptor beta2 subunit immunoreactivity in rat nigrostriatal dopaminergic neurones. J Comp Neurol 439: 235247.[CrossRef][Medline]
Keiger CJ and Walker JC (2000) Individual variation in the expression profiles of nicotinic receptors in the olfactory bulb and trigeminal ganglion and identification of alpha2, alpha6, alpha9 and beta3 transcripts. Biochem Pharmacol 59: 233240.[CrossRef][Medline]
Klink R, d'Exaerde A, de K, Zoli M, and Changeux JP (2001) Molecular and physiological diversity of nicotinic acetylcholine receptors in the midbrain dopaminergic nuclei. J Neurosci 21: 14521463.
Kuo Y, Lucero L, Michaels J, DeLuca D, and Lukas RJ (2002) Differential expression of nicotinic acetylcholine receptor subunits in fetal and neonatal mouse thymus. J Neuroimmunol 130: 140154.[CrossRef][Medline]
Lukas RJ and Bencherif M (1992) Heterogeneity and regulation of nicotinic acetylcholine receptors. Int Rev Neurobiol 34: 25131.[Medline]
Lukas RJ, Norman SA, and Lucero L (1993) Characterization of nicotinic acetylcholine receptors expressed by cells of the SH-S&5Y human neuroblastoma clonal line. Mol Cell Neurosci 4: 112.
McGehee DS, Heath MJS, Gelber S, Devay P, and Role LW (1995) Nicotine enhancement of fast excitatory synaptic transmission in CNS by presynaptic receptors. Science (Wash DC) 269: 16921696.
Morley BJ, Kemp GE, and Salvaterra P (1979) alpha-Bungarotoxin binding sites in the CNS. Life Sci 24: 859872.[CrossRef][Medline]
Orr-Urtreger A, Goldner FM, Saeki M, Lorenzo I, Goldberg L, De Biasi M, Dani JA, Patrick JW, and Beaudet AL (1997) Mice deficient in the alpha7 neuronal nicotinic acetylcholine receptor lack alpha-bungarotoxin binding sites and hippocampal fast nicotinic currents. J Neurosci 17: 91659171.
Papke RL, Webster JC, Lippiello PM, Bencherif M, and Francis MM (2000) The activation and inhibition of human nicotinic acetylcholine receptor by RJR-2403 indicate a selectivity for the alpha4beta2 receptor subtype. J Neurochem 75: 204216.[CrossRef][Medline]
Pidoplichko VI, DeBiasi M, Williams JT, and Dani JA (1997) Nicotine activates and desensitizes midbrain dopamine neurons. Nature (Lond) 390: 401404.[CrossRef][Medline]
Puchacz E, Buisson B, Bertand D, and Lukas RJ (1994) Functional expression of nicotinic acetylcholine receptors containing rat alpha 7 subunits in human SH-SY5Y neuroblastoma cells. FEBS Lett 354: 155159.[CrossRef][Medline]
Revah F, Bertrand D, Galzi JL, Devillers-Thiery A, Mulle C, Hussy N, Bertrand S, Ballivet M, and Changeux JP (1991) Mutations in the channel domain alter desensitization of a neuronal nicotinic receptor. Nature (Lond) 353: 846849.[CrossRef][Medline]
Sargent PB (1993) The diversity of neuronal nicotinic acetylcholine receptors. Ann Rev Neurosci 16: 403443.[Medline]
Schmidt J (1988) Biochemistry of nicotinic acetylcholine receptors in the vertebrate brain. Int Rev Neurobiol 30: 138.[Medline]
Stolerman IP and Shoaib M (1991) The neurobiology of tobacco addiction. Trends Pharmacol Sci 12: 467473.[CrossRef][Medline]
Vijayaraghavan S, Pugh PC, Zhang ZW, Rathous MM, and Berg DK (1992) Nicotinic receptors that bind alpha-bungarotoxin on neurons raise intracellular free Ca2+. Neuron 8: 353362.[CrossRef][Medline]
Wada E, Wada K, Boulter J, Deneris E, Heinemann S, Partrick J, and Swanson LW (1989) Distribution of alpha 2, alpha 3, alpha 4 and beta 2 neuronal nicotinic receptor subunit mRNAs in the central nervous system: a hybridization histochemical study in the rat. J Comp Neurol 284: 314335.[CrossRef][Medline]
Wonnacott S, Kaiser S, Mogg A, Soliakov L, and Jones IW (2000) Presynaptic nicotinic acetylcholine receptors modulating dopamine release in the rat striatum. Eur J Pharmacol 393: 5158.[CrossRef][Medline]
Wooltorton JR, Pidoplichko VI, Broide RS, and Dani JA (2003) Differential desensitization and distribution of nicotinic acetylcholine receptor subtypes in midbrain dopamine areas. J Neurosci 23: 31763185.
Wu J and Partridge LD (1998) Dissociated dopaminergic neurons from substantia nigra zona compacta in young rats lack functional NMDA receptors. Pflugers Arch 435: 699704.[CrossRef][Medline]
Zhang ZW, Coggan JS, and Berg DK (1996) Synaptic currents generated by neuronal acetylcholine receptors sensitive to alpha-bungarotoxin. Neuron 17: 12311240.[CrossRef][Medline]
Zhao L, Kuo YP, George AA, Peng JH, Purandare MS, Schroeder KM, Lukas RJ, and Wu J (2003) Functional properties of homomeric, human alpha 7-nicotinic acetylcholine receptors heterologously expressed in the SH-EP1 human epithelial cell line. J Pharmacol Exp Ther 305: 11321141.
Zhou FM, Liang Y, and Dani JA (2001) Endogenous nicotinic cholinergic activity regulates dopamine release in the striatum. Nat Neurosci 4: 12241229.[CrossRef][Medline]
Zoli M, Lena C, Picciotto MR, and Changeux JP (1998) Identification of four classes of brain nicotinic receptors using beta2 mutant mice. J Neurosci 18: 44614472.
Zorumski CF, Thio LL, Isenberg KE, and Clifford DB (1992) Nicotinic acetylcholine currents in cultured postnatal rat hippocampal neurons. Mol Pharmacol 41: 931936.[Abstract]
This article has been cited by other articles:
![]() |
Q. Liu, Y. Huang, F. Xue, A. Simard, J. DeChon, G. Li, J. Zhang, L. Lucero, M. Wang, M. Sierks, et al. A Novel Nicotinic Acetylcholine Receptor Subtype in Basal Forebrain Cholinergic Neurons with High Sensitivity to Amyloid Peptides J. Neurosci., January 28, 2009; 29(4): 918 - 929. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yang, J. Hu, L. Lucero, Q. Liu, C. Zheng, X. Zhen, G. Jin, R. J. Lukas, and J. Wu Distinctive nicotinic acetylcholine receptor functional phenotypes of rat ventral tegmental area dopaminergic neurons J. Physiol., January 15, 2009; 587(2): 345 - 361. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wu, J. Hu, Y.-P. Chen, T. Takeo, S. Suga, J. DeChon, Q. Liu, K.-C. Yang, P. A. St. John, G. Hu, et al. Iptakalim Modulates ATP-Sensitive K+ Channels in Dopamine Neurons from Rat Substantia Nigra Pars Compacta J. Pharmacol. Exp. Ther., October 1, 2006; 319(1): 155 - 164. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wu, Q. Liu, K. Yu, J. Hu, Y.-P. Kuo, M. Segerberg, P. A. St John, and R. J. Lukas Roles of nicotinic acetylcholine receptor {beta} subunits in function of human {alpha}4-containing nicotinic receptors J. Physiol., October 1, 2006; 576(1): 103 - 118. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hu, K. Lindenberger, G. Hu, H. Wang, R. J. Lukas, and J. Wu Iptakalim as a Human Nicotinic Acetylcholine Receptor Antagonist J. Pharmacol. Exp. Ther., February 1, 2006; 316(2): 914 - 925. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||