![]() |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GASTROINTESTINAL, HEPATIC, PULMONARY, AND RENAL
1-Adrenoceptor Subtypes
Department of Pharmacology, Creighton University School of Medicine, Omaha, Nebraska
Received April 23, 2004; accepted July 19, 2004.
| Abstract |
|---|
|
|
|---|
1-adrenoceptor regulation of submandibular function.
1-Adrenoceptors are subdivided into three subtypes called
1A,
1B, and
1D, which can be distinguished from one another by their differential affinity values for subtype-selective
1-adrenoceptor antagonists. Thus,
1-adrenoceptor subtypes in SMG-C10 cells were characterized with reverse transcription-polymerase chain reaction (RT-PCR) and [3H]prazosin binding in side-by-side experiments with native submandibular glands. RT-PCR identified mRNAs for
1A-,
1B-, and
1D-adrenoceptors in SMG-C10 cells and submandibular glands. The inhibition of [3H]prazosin binding by 5-methylurapidil (
1A-selective) was biphasic and fit best to a two-site binding model with 40 ± 8% high (KiH)- and 60 ± 10% low (KiL)-affinity binding sites in SMG-C10 cells, and 76% high- and 24% low-affinity binding sites in submandibular glands. Respective KiH and KiL values for 5-methylurapidil were 1.9 ± 0.4 and 100 ± 30 nM in SMG-C10 cells and 3.2 ± 0.8 and 170 ± 20 nM in submandibular glands. BMY-7378 [8-[2-[4-(2-methoxyphenyl)-1-piperazinyl]ethyl]-8-azaspiro[4.5]decane-7,9-dione dihydrochloride (
1D-selective)] bound with low affinity in SMG-C10 cells and submandibular glands with Ki values of 81 ± 20 and 110 ± 20 nM, respectively. Chloroethylclondine, an irreversible alkylating agent selective for
1B adrenoceptors, reduced the density of [3H]prazosin binding sites by 42 and 26% in SMG-C10 and submandibular membranes, respectively. Thus, SMG-C10 cells and submandibular glands are similar in expressing receptor protein for
1A- and
1B-adrenoceptor subtypes, establishing SMG-C10 cells as a potential model for
1-adrenoceptor-mediated secretion.
1-adrenoceptors on submandibular acinar cells, causing secretion of fluid, electrolytes, amylase, and mucins (Quissell, 1980
An important impediment to a better understanding of
1-adrenoceptor regulation of secretion in submandibular glands has been the lack of an immortalized cell line maintaining the phenotypical characteristics of an epithelial cell of acinar origin. Because acinar cells generate the secretory product, a cell line that is similar in phenotype to native submandibular acinar cells would be a useful model for studying the role of
1-adrenoceptors and their signaling pathways in submandibular glands. Quissell et al. (1997
) reported the immortalization of two clonal rat submandibular gland acinar cell lines established from the same preparation (SMG-C6 and SMG-C10). They, as well as others (Liu et al., 2000
), have shown that both cell lines exhibit similar morphological, biochemical, and functional characteristics as those in native submandibular acinar cells. For example, SMG-C6 cells and SMG-C10 cells are polarized in culture and, like native acinar cells, express functional adrenergic, muscarinic, and purinergic receptors that couple to an elevation in intracellular free calcium. The similarities between native submandibular acinar cells and SMG-C6/C10 cells with respect to polarity, signal transduction pathways, and other morphological characteristics suggest that these immortalized acinar cell lines are useful tools for studying salivary gland secretion. However, the
1-adrenoceptor subtypes expressed in SMG-C6/C10 cells are unknown.
1-Adrenoceptors do not represent a homogenous population of receptors. Molecular cloning and pharmacological studies performed using native tissues are in agreement with one another and show that there are separate genes encoding for three structurally and pharmacologically distinct cell-surface receptor proteins. These
1-adrenoceptor subtypes are referred to as the
1A-,
1B-, and
1D-adrenoceptor subtypes (Hieble et al., 1995
). The
1-adrenoceptor subtypes can be distinguished from one another using reverse transcription-polymerase chain reaction (RT-PCR) with gene-specific primers and radioligand binding to determine affinity constants for
1-adrenoceptor subtype-selective drugs. The possibility that immortalization, culture conditions, or both alter expression patterns and/or the pharmacological characteristics of
1-adrenoceptor subtypes in SMG-C6/C10 cells should be considered if these cell lines are to be used as a model in secretion studies. Thus, the overall aim of this study was to characterize the
1-adrenoceptor subtypes in side-by-side experiments comparing SMG-C10 cells with native rat submandibular glands. We used RT-PCR to identify the mRNA for the
1-adrenoceptor subtypes present in SMG-C10 cells and submandibular glands. In addition, we characterized the
1-adrenoceptor subtypes expressed in SMG-C10 cells and submandibular glands by determining the affinities of several
1-adrenoceptor subtype-selective drugs for inhibiting specific [3H]prazosin binding.
| Materials and Methods |
|---|
|
|
|---|
Cell Culture. In preliminary experiments, the density of specific [3H]prazosin binding sites was higher in SMG-C10 cells compared with SMG-C6 cells; thus, we used SMG-C10 cells in the present study. SMG-C10 cells (generously provided by Dr. David O. Quissell, School of Dentistry, University of Colorado Health Sciences Center, Denver, CO) were seeded onto T-75 (8 x 105 cells) Falcon Primaria tissue culture flasks (BD Biosciences, Franklin Lakes, NJ) and grown in Dulbecco's modified Eagle's medium/F-12 nutrient mixture (1:1) and 2.5% fetal bovine serum (Invitrogen, Carlsbad, CA). Growth medium was supplemented with 2 mM glutamine and 4 µg/ml transferrin (Invitrogen); 0.1 µM retinoic acid, 2 nM triiodothyronine, 1 µM hydrocortisone, 5 µg/ml insulin, and 50 µg/ml gentamicin (Sigma-Aldrich); 50 ng/ml epidermal growth factor (BD Biosciences); and trace element mix (Biofluids, Rockville, MD). Cells were grown to confluence at 37°C in a humidified 95% air/5% CO2 incubator and used for experiments between passages 18 and 22.
Total RNA Isolation. Total cellular RNA was prepared from 100 mg of pulverized frozen rat submandibular glands and confluent SMG-C10 cultures grown in T-75 tissue culture flasks using TRIzol (Invitrogen) according to the manufacturer's instructions. Contaminating genomic DNA was removed from total RNA by treatment with RNase-free DNase I, followed by RNA extraction with water-saturated phenol-chloroform and precipitation with ethanol. The integrity of the RNA was confirmed by denaturing agarose gel electrophoresis. Total RNA was determined by measuring the absorbance at 260 nm with a Beckman DU-650 spectrophotometer (Beckman Coulter, Fullerton, CA). Preparations were stored at -70°C.
RT-PCR. Approximately 1 µg of total RNA from either rat submandibular glands or SMG-C10 cells was reverse-transcribed using 25 pmol of random hexamers and 25 pmol of oligo d(T) primers. First-strand cDNA was synthesized from RNA preparations using 50 units of murine leukemia virus reverse transcriptase (PerkinElmer Life and Analytical Sciences) in a 10-µl reaction volume containing 20 units of RNasin (Promega, Madison, WI), 1 mM deoxynucleoside-5'-triphosphate, and 2.5 mM MgCl2 in PCR buffer (Invitrogen). The reaction was incubated at room temperature for 15 min and then at 42°C for 50 min, and followed by enzyme inactivation for 5 min at 95°C in a RoboCycler Gradient 96 Thermal Cycler (Stratagene, LaJolla, CA). PCR was performed on 10 µl of the reverse-transcribed cDNA reaction using
1-adrenoceptor subtype-specific oligonucleotide primers synthesized on an Applied Biosystems Synthesizer (PerkinElmer Life and Analytical Sciences). The sense (S) and antisense (AS) primer sequences were GTAGCCAAGAGAGAAAGCCG (
1A-S), CAACCCACCACGATGCCCAG (
1A-AS); GCTCCTTCTACATCCCGCTCG (
1B-S), AGGGGAGCCAACATAAGATGA (
1B-AS); and CGTGTGCTCCTTCTACCTACC (
1D-S), GCACAGGACGAAGACACCCAC (
1D-AS).
The design of
1-adrenoceptor subtype-specific primer pairs was previously described (Scofield et al., 1995
). The PCR mixture contained 1.25 units of TaqDNA polymerase (Invitrogen), 3 mM MgCl2, 25 pmol of AS primer, 25 pmol of S primer, and 0.2 mM deoxynucleoside-5'-triphosphate in PCR buffer. The cDNA template and primers were denatured for 5 min at 95°C, then amplified in a 50-µl reaction volume for 40 cycles of denaturation at 95°C for 45 s, followed by annealing for 45 s at 55°C, and then extension at 72°C for 45 s. After amplification, products were extended further by incubation at 72°C for 7 min. The products were horizontally electrophoresed on a 2% agarose-ethidium bromide gel. The 212-, 300-, and 304-bp PCR products for the
1A-,
1B-, and
1D-adrenoceptor subtypes, respectively, were cloned using a TA Cloning Kit with a PCR II vector (Invitrogen) and sequenced to confirm the primer specificity. The absence of genomic DNA for each reaction was confirmed by amplification of the RNA that was not previously incubated with reverse transcriptase.
Membrane Preparation. SMG-C10 cells were washed twice with phosphate-buffered saline and removed from T-75 tissue culture flasks with a rubber policeman. Cells were homogenized twice in 10 volumes of ice-cold 50 mM Tris buffer (pH 7.4) using a Janke and Kunkel Ultra-Turrax T25 homogenizer (Janke and Kunkel, Staufen, Germany) at 22,000 rpm for 10 s. The homogenate was centrifuged at 30,000g for 15 min, and the supernatant was discarded. The membrane pellet was resuspended in Tris buffer, washed twice more by centrifugation, and stored at -78°C.
Male Sprague-Dawley rats (140190 g) were anesthetized with pentobarbital (50 mg/kg i.p.) and exsanguinated by cutting the abdominal aorta as approved by Creighton University's Institutional Animal Care and Use Committee. Submandibular glands were removed and placed in ice-cold Krebs' solution at pH 7.4 containing 118 mM NaCl, 4.7 mM KCl, 1.3 mM CaCl2, 1.2 mM MgSO4, 25 mM NaHCO3, 1.2 mM KH2PO4, and 11.7 mM dextrose; trimmed of visible fat, fascia, lymph nodes, blood vessels, and ducts; and then minced with iris scissors. The mince was centrifuged at 1,000g for 5 min at 4°C, and the supernatant was discarded. The resulting mince was enriched with acinar units. The pellet was resuspended in 20 volumes of Tris buffer, and membranes were prepared as described for SMG-C10 cells, with the exception of an additional step whereby the homogenate was filtered through a 100-µm nylon mesh.
Radioligand Binding Assays. Membrane pellets were resuspended and homogenized in Tris buffer. Assay tubes used in radioligand binding experiments were pretreated with Sigmacote (Sigma-Aldrich) according to the manufacturer's instructions. For saturation binding experiments, total [3H]prazosin binding was determined using duplicate tubes containing 300 µl of membrane suspension (150 µg and 100 µg/0.5 ml of assay volume for SMG-C10 cells and submandibular glands, respectively), 100 µl of Tris buffer, and 100 µl of [3H]prazosin ranging in concentration from 0.02 to 2.5 nM. To a parallel set of duplicate tubes, 100 µl of 10 µM phentolamine in Tris buffer was added to determine nonspecific binding. After a 30-min incubation in a shaking water bath at 37°C, a 48-sample cell harvester (Brandel Inc., Gaithersburg, MD) was used to filter membrane suspensions through GF/B glass fiber filter strips (Whatman, Maidstone, UK) pretreated with polyethylenimine (0.2% w/v for 30 min) and bovine serum albumin (0.1% w/v for 15 min). Tubes and filters were washed three times with 5 ml of ice-cold Tris buffer, and radioactivity retained on the filters was counted by liquid scintillation spectroscopy. Specific binding was calculated as the difference between total and nonspecific binding. For competition binding experiments, duplicate tubes containing 300 µl of membrane suspension, 100 µl of 0.3 nM [3H]prazosin, and 100 µl of increasing concentrations of various unlabeled drugs were incubated and processed as described for saturation experiments. The protein concentration was determined by the method of Lowry et al. (1951
) using bovine serum albumin as the standard.
Chloroethylclonidine Treatment. Crude membranes were treated with chloroethylclonidine as previously described (Minneman et al., 1988
). Briefly, membrane pellets were resuspended in 5 ml of 50 mM Tris buffer and incubated with or without 30 µM chloroethylclonidine for 12 min at 37°C. Chloroethylclonidine treatment was terminated by a 4-fold dilution with ice-cold Tris buffer and then followed with three successive washings by centrifugation (30,000g for 15 min) to remove any unbound drug. Treated and nontreated membranes were then used in side-by-side radioligand binding experiments.
Data Analysis. Radioligand binding data were analyzed using a nonlinear least-squares curve-fitting program (GraphPad Prism; GraphPad Software, San Diego, CA) to determine Kd and Bmax values from saturation binding experiments and IC50 values from competition binding experiments. Ki values were calculated from IC50 values by using the method of Cheng and Prusoff (1973
). All values are given as means ± S.E. The F test was used to determine whether or not the binding data fit best to a 1- or 2-site binding model. A value of P < 0.05 was used to conclude that the two-site model fit the data best.
| Results |
|---|
|
|
|---|
1-Adrenoceptor Subtypes in SMG-C10 Cells and Submandibular Glands. We used RT-PCR to determine whether or not the pattern of expression of mRNA for the three
1-adrenoceptor subtypes was similar between SMG-C10 cells and native rat submandibular glands. Figure 1 shows horizontal gel electrophoresis of RT-PCR products of total RNA from SMG-C10 cells and submandibular glands using gene-specific primers for the
-1 adrenoceptor subtypes. In both SMG-C10 cells and submandibular glands, mRNAs for the
1A-,
1B-, and
1D-adrenoceptor subtypes were expressed. RT-PCR analysis of
1-adrenoceptor subtypes produced products of the correct size for the
1A-,
1B-, and
1D-adrenoceptor receptor subtypes of 212, 300, and 304 bp, respectively. Sequence analysis confirmed the identity of the RT-PCR products. These data suggest that there is a similar pattern of expression of
1-adrenoceptor subtype mRNA in SMG-C10 cells and native rat submandibular glands.
|
Characteristics of [3H]Prazosin Binding in Membranes from SMG-C10 Cells and Submandibular Glands. Figure 2 illustrates mean saturation binding isotherms for specific [3H]prazosin binding in SMG-C10 (Fig. 2A) and submandibular gland (Fig. 2B) membranes. Nonlinear regression analysis of four individual specific binding isotherms indicated that [3H]prazosin bound to a single class of sites with a mean Kd value of 0.34 ± 0.1 nM in SMG-C10 cells and 0.40 ± 0.1 nM in submandibular glands. The Bmax was 97 ± 20 fmol/mg protein and 179 ± 30 fmol/mg protein in SMG-C10 cells and submandibular glands, respectively. Specific [3H]prazosin binding ranged from 75 to 90% of total binding at the Kd concentration in both SMG-C10 cells and submandibular glands. The insets show Rosenthal plots derived from their respective saturation binding isotherms shown in the main figure. In Fig. 3, competition curves for the inhibition of [3H]prazosin binding by unlabeled prazosin in both SMG-C10 (Fig. 3A) and submandibular gland (Fig. 3B) membranes were monophasic and characterized by relatively steep slopes with Hill coefficients of -0.98 ± 0.2 and -0.78 ± 0.2, respectively (Table 1). Affinities (Ki values) for prazosin obtained from these experiments were 0.31 ± 0.1 nM in SMG-C10 and 0.78 ± 0.2 nM in submandibular gland membranes.
|
|
|
1-Adrenoceptor Subtypes in Membranes from SMG-C10 Cells and Submandibular Glands. Figure 3 illustrates competition curves for the inhibition of [3H]prazosin binding by
1-adrenoceptor subtype-selective antagonists in side-by-side experiments comparing SMG-C10 cells (Fig. 3A) and submandibular glands (Fig. 3B). From these experiments, Ki values for drugs and Hill coefficients for curves were obtained to determine the
1-adrenoceptor subtypes expressed in SMG-C10 and submandibular gland membranes (Table 1). In SMG-C10 membranes, the inhibition of [3H]prazosin binding by drugs that distinguish the
1A-adrenoceptor subtype from
1B- and
1D-adrenoceptor subtypes was biphasic and characterized by relatively shallow slopes, indicating binding site heterogeneity. For example, Hill coefficients of competition curves for both 5-methylurapidil and WB-4101 inhibition of [3H]prazosin binding were -0.53 ± 0.1 and -0.63 ± 0.1, respectively (Table 1). Additionally, these competition binding curves for 5-methylurapidil and WB-4101 were fit best by a two-site binding model (P < 0.05) with 40 ± 8% high-affinity binding sites and 60 ± 10% low-affinity binding sites, suggesting the presence of a heterogeneous population of
1-adrenoceptor subtypes. Both 5-methylurapidil and WB-4101 are selective for the
1A-adrenoceptor subtype. Thus, the respective high- and low (KiH and KiL)-affinity values for 5-methylurapidil (1.9 ± 0.4 and 100 ± 30 nM) and WB-4101 (0.44 ± 0.1 and 15 ± 4 nM) indicated the presence of the
1A-adrenoceptor subtype and either the
1B- or
1D-adrenoceptor subtypes in SMG-C10 cells (Table 1). To determine whether the
1B-or
1D-adrenoceptor subtype was expressed in SMG-C10 cells, we generated competition binding curves for BMY-7378, which is an
1D-adrenoceptor subtype-selective antagonist that distinguishes the
1D-adrenoceptor from the
1A- and
1B-adrenoceptor subtypes. Competition curves for BMY-7378 inhibition of [3H]prazosin binding were monophasic, relatively steep (Hill coefficient = -0.83 ± 0.1), and fit best by a one-site binding model with a Ki value of 81 ± 20 nM (Table 1), suggesting the lack of the
1D-adrenoceptor subtype in SMG-C10 cells.
The examination of [3H]prazosin binding in submandibular glands produced similar results as those in SMG-C10 cells. For example, competition curves for 5-methylurapidil inhibition of [3H]prazosin binding were biphasic (Fig. 3B), characterized by shallow slopes (Hill coefficient = -0.63 ± 0.1), and fit best by a two-site binding model (P < 0.05) with 76 ± 10% high-affinity binding sites and 24 ± 4% low-affinity binding sites (Table 1). KiH and KiL values for the inhibition of [3H]prazosin binding by 5-methylurapidil were 3.2 ± 0.8 and 170 ± 50 nM, respectively, indicating the presence of the
1A adrenoceptor subtype and either the
1B- or
1D-adrenoceptor subtypes. WB-4101 inhibited [3H]prazosin binding with a Hill coefficient of -0.83 ± 0.1 and a Ki value of 0.76 ± 0.1 nM. The inhibition of [3H]prazosin binding by BMY-7378 was characterized by a relatively steep (Hill coefficient = -0.80 ± 0.1), monophasic curve that was fit best by a one-site binding model with a Ki value of 110 ± 20 nM (Table 1). Together, these data show the expression of
1A-adrenoceptor and
1B-adrenoceptor subtypes but not the
1D-adrenoceptor subtype in submandibular glands.
Chloroethylclonidine Inactivation of the
1B-Adrenoceptor Subtype in SMG-C10 Cells and Submandibular Glands. In SMG-C10 cells (Fig. 4A) and submandibular glands (Fig. 4B), we examined the heterogeneity of the
1-adrenoceptor population by generating saturation binding isotherms for specific [3H]prazosin binding before and after treatment with chloroethylclondine, which is an irreversible antagonist selective for alkylating the
1B-adrenoceptor subtype. In SMG-C10 cells, chloroethylclonidine decreased the density (Bmax) of specific [3H]prazosin binding sites from 86 ± 4 fmol/mg protein in control membranes to 50 ± 8 fmol/mg protein in treated membranes, which is a 42% reduction in Bmax. Similarly, chloroethylclonidine decreased the Bmax by 26% in submandibular gland membranes. For example, the density of specific [3H]prazosin binding sites was 110 ± 3 fmol/mg protein in control membranes and 81 ± 2 fmol/mg protein in membranes treated with chloroethylclonidine.
|
In addition, competition curves for 5-methylurapidil inhibition of [3H]prazosin binding were obtained in SMG-C10 cell (Fig. 5A) and submandibular gland (Fig. 5B) membranes pretreated with chloroethylclonidine. In contrast to the shallow, biphasic control competition binding curves for 5-methylurapidil that were fit best by a two-site binding model, competition binding curves in chloroethylclonidine-treated membranes were monophasic, characterized by steep slopes (Hill coefficients = -0.80 ± 0.2 in SMG-C10 cells and -0.85 ± 0.2 in submandibular glands), and fit best by a one-site binding model (P > 0.05). Thus, in membranes pretreated with chloroethylclonidine, 5-methylurapidil bound to a single class of high-affinity sites with Ki values of 5.3 ± 2 and 4.7 ± 2 nM in SMG-C10 cells and submandibular glands, respectively. These results show that chloroethylclonidine inactivated the low-affinity 5-methylurapidil binding site, i.e., the
1B-adrenoceptor subtype, leaving exclusively the high-affinity 5-methylurapidil binding site, i.e., the
1A-adrenoceptor subtype. These experiments using chloroethylclonidine, together with our other competition binding data, indicate that both SMG-C10 cells and native submandibular glands express the
1A- and
1B-adrenoceptor subtypes.
|
| Discussion |
|---|
|
|
|---|
1-adrenoceptors that contribute to secretion (Michel et al., 1989
1-adrenoceptor population on SMG-C10 cells have not been examined and compared with native submandibular acinar cells. Thus, in side-by-side experiments comparing SMG-C10 cells and native submandibular glands, we characterized the expression of
1-adrenoceptor subtype mRNA and receptor protein using RT-PCR and radioligand binding, respectively.
We tested the possibility that immortalization and/or culture conditions affected the pattern of expression of
1-adrenoceptor subtype mRNA and protein in SMG-C10 cells. RT-PCR analysis using gene-specific primers for the three
1-adrenoceptor subtypes identified mRNA for the
1A-,
1B-, and
1D-adrenoceptor subtypes in both SMG-C10 cells and submandibular glands, suggesting gene expression of
1-adrenoceptor subtypes is similar between SMG-C10 cells and native submandibular glands. The expression of receptor protein was examined with
1-adrenoceptor subtype-selective competitive antagonists in radioligand binding experiments comparing the pharmacological profile of the
1-adrenoceptor population in SMG-C10 cells with that of submandibular glands. For example, 5-methylurapidil has been shown to be a selective antagonist at the
1A subtype, with approximately 100-fold higher affinity for the
1A than the
1B or
1D subtypes (Table 2); thus, 5-methylurapidil can distinguish the
1A adrenoceptor from the other two
1-adrenoceptor subtypes. In the present study, 5-methylurapidil bound to high- and low-affinity sites in both SMG-C10 cells and submandibular glands, indicating the presence of the
1A and either the
1B,
1D, or both adrenoceptor subtypes. We then determined the expression of the
1B,
1D, or both subtypes using BMY-7378, an
1D subtype-selective drug with approximately 100-fold higher affinity for the
1D than the
1B or
1A subtypes (Table 2). BMY-7378 bound to a single low-affinity site in both SMG-C10 cells and submandibular glands, indicating the absence of
1D-adrenoceptor expression but consistent with the presence of
1A- and
1B-adrenoceptor subtypes in both cell line and native gland. Together, these data show that receptor protein for both the
1A- and
1B-adrenoceptor subtypes, along with detectable
1D mRNA, is present in SMG-C10 cells and submandibular glands. This similarity in the pattern of expression of
1-adrenoceptor subtype mRNA and protein between SMG-C10 cells and native glands indicates SMG-C10 cells are a potentially useful model system to characterize the functional roles of the individual
1-adrenoceptor subtypes in the submandibular gland.
|
Additional data supporting the presence of both
1A- and
1B-adrenoceptor subtypes in SMG-C10 cells and submandibular glands were obtained using chloroethylclonidine. Chloroethylclondine irreversibly alkylates the
1B-adrenoceptor subtype. Therefore, in cells and tissues that contain
1B-adrenoceptors, chloroethylclonidine decreases the density of the
1-adrenoceptor population; thus, chloroethylclonidine has been used in a variety of tissues to differentiate
1-adrenoceptor subtypes (Minneman et al., 1988
). In our study, chloroethylclonidine reduced the density of [3H]prazosin binding sites in SMG-C10 cells by 42% and submandibular glands by 26%. These results are consistent with our competition binding data, which showed that the
1B subtype comprises 60 and 24% of the
1-adrenoceptor population in SMG-C10 cells and submandibular glands, respectively. The use of chloroethylclonidine to characterize
1-adrenoceptor subtypes is controversial because its selectivity for the
1B subtype is highly dependent on experimental conditions (Zhong and Minneman, 1999
). Therefore, we obtained competition binding curves for 5-methylurapidil in chloroethylclonidine-treated SMG-C10 cell and submandibular gland membranes to determine whether chloroethylclonidine treatment would result in the loss of low-affinity binding sites, i.e., the
1B subtype, while maintaining the high-affinity binding sites, i.e., the
1A subtype. In SMG-C10 cells and submandibular glands, chloroethylclonidine treatment resulted in 5-methylurapidil identifying only a single high-affinity binding site that was the
1A subtype. Our data suggest that, when using appropriate experimental conditions and proper controls, chloroethylclonidine is useful in distinguishing among the various
1-adrenoceptor subtypes.
The relationship between mRNA expression and protein measured as radioligand binding sites is not always clear. For example, in the present study, RT-PCR detected
1D-adrenoceptor subtype mRNA; however,
1D-adrenoceptor protein was not identified with radioligand binding in SMG-C10 cells or submandibular glands. It is possible that the mRNA is not translated into receptor protein; however, recent data show that
1D-adrenoceptor protein is predominantly localized to intracellular compartments (Piascik and Perez, 2001
; Chalothorn et al., 2002
). In addition, N-terminal truncation of the
1D-adrenoceptor results in an increase in its binding site density (Pupo et al., 2003
), subsequent to changes in the subcellular distribution of the shortened receptor protein (Hague et al., 2004
). Together, these results support the idea that, although
1D-adrenoceptor mRNA is translated into receptor protein,
1D-adrenoceptor protein may not be efficiently processed into an able-binding form and translocated to the cell membrane where it can be detected with radioligands. Our result showing that mRNA for the
1D-adrenoceptor subtype is not expressed as an
1D-adrenoceptor binding site is consistent with these studies and not unique to the submandibular gland. For example, in another major salivary gland, the parotid gland, Abel et al. (1995
) identified mRNA for the
1D-adrenoceptor subtype but could not detect its expression with radioligand binding. In contrast, the
1D-adrenoceptor subtype is reported to be a cell surface receptor protein that mediates contraction of blood vessels from certain vascular beds (Piascik et al., 1995
). These differences underscore the importance of examining mRNA expression and radioligand binding site density, as well as receptor protein expression with subtype-specific antibodies when they become available, because the regulation of intracellular sequestration and trafficking of
1D-adrenoceptors likely varies among cell types and disease states.
In the present study, competition by 5-methylurapidil for [3H]prazosin binding identified both the
1A-adrenoceptor and
1B-adrenoceptor subtypes in the submandibular gland. In contrast, the submandibular gland is generally thought to contain only the
1A-adrenoceptor subtype (Michel et al., 1989
) and thus has been widely used as a prototypical tissue for studying
1A-adrenoceptors (Zhong and Minneman, 1999
). However, in the original study by Michel and coworkers (1989
), WB-4101, but not 5-methylurapidil, was used in competition binding experiments. Although WB-4101 is selective for the
1A-adrenoceptor subtype, with approximately 20-fold higher affinity for the
1A- than the
1B-adrenoceptor (Morrow and Creese, 1986
), this limited selectivity likely precluded ascertainment of the multiple
1-adrenoceptor subtypes present in the submandibular gland. The usefulness of WB-4101 in differentiating between subtypes is further moderated in tissues where the proportion of the
1B-adrenoceptor subtype is low relative to the total
1-adrenoceptor population, such as in the submandibular gland. For example, using WB-4101, we too were unable to identify the
1B-adrenoceptor subtype in the submandibular gland. However, when we used 5-methylurapidil, which exhibits greater selectivity (50500-fold) than WB-4101 for the
1A subtype over the
1B subtype, we detected a heterogeneous population of
1-adrenoceptors comprised of 76%
1A and 24%
1B in submandibular glands. Interestingly, in SMG-C10 cells, where 5-methylurapidil identified a more equal distribution of the two
1-adrenoceptor subtypes (40%
1A and 60%
1B), WB-4101 also detected the
1A- and
1B-adrenoceptor subtypes. These results not only highlight the similarity between SMG-C10 cells and submandibular glands but also provide important new information about additional
1-adrenoceptor subtypes in the native gland.
The SMG-C10 cell line is unique in that it expresses multiple
1-adrenoceptor subtypes. Most other clonal cell lines containing
1-adrenoceptors express only the
1B subtype (Zhong and Minneman, 1999
). Together, these findings suggest multiple
1-adrenoceptor subtypes coexist on native submandibular acinar cells rather than the individual cell types of the gland each expressing a single subtype; thus, the SMG-C10 cell line is an important new tool for examining the role of
1A- and
1B-adrenoceptor subtypes in regulating submandibular gland functions. For instance, it is widely known that the stimulation of
1-adrenoceptors on submandibular acinar cells results in an elevation of intracellular free calcium that activates calcium-dependent chloride channels to cause fluid secretion (Martinez and Reed, 1988
; Quissell et al., 1992
). In addition, we recently reported that
1-adrenoceptors activate extracellular signal-regulated protein kinases 1 and 2 in submandibular glands and SMG-C10 cells (Bruchas et al., 2002
). Extracellular signal-regulated protein kinase 1/2 is an important second messenger in the mitogen-activated protein kinase pathway; however, its role in the submandibular gland is unknown. How these multiple signaling pathways activated by
1-adrenoceptor subtypes interact with each other and are ultimately integrated into the final acinar cell response remains to be determined in submandibular glands. The SMG-C10 cell line may be useful in elucidating these interactions.
| Acknowledgements |
|---|
| Footnotes |
|---|
Article, publication date, and citation information can be found at http://jpet.aspetjournals.org.
ABBREVIATIONS: RT-PCR, reverse transcription-polymerase chain reaction; BMY-7378, 8-[2-[4-(2-methoxyphenyl)-1-piperazinyl]ethyl]-8-azaspiro[4.5]decane-7,9-dione dihydrochloride; WB-4101, 2-([2,6-dimethoxyphenoxyethyl])aminomethyl)-1,4-benzodioxane; S, sense; AS, antisense; bp, base pair(s).
Address correspondence to: Dr. Charles S. Bockman, Department of Pharmacology, Creighton University School of Medicine, 2500 California Plaza, Omaha, NE 68178. E-mail: cbockman{at}creighton.edu
| References |
|---|
|
|
|---|
Abel PW, Zeng W, Porter JE, Scofield MA, Liu F, Gonzalez-Cabrera I, Dowd FJ, and Jeffries WB (1995) The atypical
1-adrenoceptor. Pharmacol Res Commun 6: 29-38.
Baum BJ (1987) Neurotransmitter control of secretion. J Dent Res 66: 628-632.
Bockman CS, Bradley ME, Dang HK, Zeng W, Scofield MA, and Dowd FJ (2001) Molecular and pharmacological characterization of muscarinic receptor subtypes in a rat parotid gland cell line: comparison with native parotid gland. J Pharmacol Exp Ther 297: 718-726.
Bruchas MR, Abel PW, and Bockman CS (2002)
1-Adrenergic receptor (
1-AR) coupling to mitogen activated protein kinase in a submandibular gland cell line. Pharmacologist 44: A34.
Chalothorn D, Mccune DF, Edelmann SE, Garcia-Cazarin ML, Tsujimoto G, and Piascik MT (2002) Differences in the cellular localization and agonist-mediated internalization properties of the
1-adrenoceptor subtypes. Mol Pharmacol 61: 1008-1016.
Cheng YC and Prusoff WH (1973) Relationship between the inhibition constant (KI) and the concentration of inhibitor which causes 50 percent inhibition (IC50) of an enzymatic reaction. Biochem Pharmacol 22: 3099-3108.[CrossRef][Medline]
Dharmsathaphorn K, McRoberts JA, Mandel KG, Tisdale LD, and Masui H (1984) A human colonic tumor cell line that maintains vectorial electrolyte transport. Am J Physiol 246: G204-G208.
Gross G, Hanft G, and Rugevics C (1988) 5-Methyl-urapidil discriminates between subtypes of the
1-adrenoceptor. Eur J Pharmacol 151: 333-335.[CrossRef][Medline]
Hague C, Chen Z, Pupo AS, Schulte NA, Toews ML, and Minneman KP (2004) The N terminus of the human
1D-adrenergic receptor prevents cell surface expression. J Pharmacol Exp Ther 309: 388-397.
Hieble JP, Bylund DB, Clarke DE, Eikenburg DC, Langer SZ, Lefkowitz RJ, Minneman KP, and Ruffolo RR Jr (1995) International Union of Pharmacology X. Recommendation for nomenclature of
1-adrenoceptors: consensus update. Pharmacol Rev 47: 267-270.[Medline]
Liu XB, Sun X, Mork AC, Dodds MW, Martinez JR, and Zhang GH (2000) Characterization of the calcium signaling system in the submandibular cell line SMG-C6. Proc Soc Exp Biol Med 225: 211-220.
Lowry OH, Rosebrough NJ, Farr AL, and Randall RJ (1951) Protein measurement with the Folin phenol reagent. J Biol Chem 193: 265-275.
Martinez JR and Reed P (1988) Effect of alpha-receptor stimulation on Cl transport by rat submandibular acini. J Dent Res 67: 561-564.
Michel AD, Loury DN, and Whiting RL (1989) Identification of a single
1-adrenoceptor corresponding to the
1A-subtype in rat submaxillary gland. Br J Pharmacol 98: 883-889.[Medline]
Minneman KP, Han C, and Abel PW (1988) Comparison of
1-adrenergic receptor subtypes distinguished by chloroethylclonidine and WB 4101. Mol Pharmacol 33: 509-514.[Abstract]
Morrow AL and Creese I (1986) Characterization of alpha 1-adrenergic receptor subtypes in rat brain: a reevaluation of [3H]WB4101 and [3H]prazosin binding. Mol Pharmacol 29: 321-330.[Abstract]
Piascik MT, Guarino RD, Smith MS, Soltis EE, Saussy DL Jr, and Perez DM (1995) The specific contribution of the novel alpha-1D adrenoceptor to the contraction of vascular smooth muscle. J Pharmacol Exp Ther 275: 1583-1589.
Piascik MT and Perez DM (2001)
1-Adrenergic receptors: new insights and directions. J Pharmacol Exp Ther 298: 403-410.
Porter JE, Dowd FJ, and Abel PW (1992) Atypical alpha-1 adrenergic receptors on the rat parotid gland acinar cell. J Pharmacol Exp Ther 263: 1062-1067.
Pupo AS, Uberti MA, and Minneman KP (2003) N-terminal truncation of human
1D-adrenoceptors increases expression of binding sites but not protein. Eur J Pharmacol 462: 1-8.[CrossRef][Medline]
Quissell DO (1980) Secretory response of dispersed rat submandibular cells. I. Potassium release. Am J Physiol 238: C90-C98.
Quissell DO and Barzen KA (1980) Secretory response of dispersed rat submandibular cells. II. Mucin secretion. Am J Physiol 238: C99-C106.
Quissell DO, Barzen KA, Gruenert DC, Redman RS, Camden JM, and Turner JT (1997) Development and characterization of SV40 immortalized rat submandibular acinar cell lines. In Vitro Cell Dev Biol 33: 164-173.[CrossRef]
Quissell DO, Watson E, and Dowd FJ (1992) Signal transduction mechanisms involved in salivary gland regulated exocytosis. Crit Rev Oral Biol Med 3: 83-107.
Saussy DL Jr, Goetz AS, Queen KL, King HK, Lutz MW, and Rimele TJ (1996) Structure activity relationships of a series of buspirone analogs at alpha-1 adrenoceptors: further evidence that rat aorta alpha-1 adrenoceptors are of the alpha-1D-subtype. J Pharmacol Exp Ther 278: 136-144.
Scofield MA, Liu F, Abel PW, and Jeffries WB (1995) Quantification of steady state expression of mRNA for alpha-1 adrenergic receptor subtypes using reverse transcription and a competitive polymerase chain reaction. J Pharmacol Exp Ther 275: 1035-1042.
Simmons NL (1981) Stimulation of Cl- secretion by exogenous ATP in cultured MDCK epithelial monolayers. Biochim Biophys Acta 646: 231-242.[Medline]
Zhong H and Minneman KP (1999)
1-Adrenoceptor subtypes. Eur J Pharmacol 375: 261-276.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
B. Xiang, Y. Zhang, Y.M. Li, K. Zhang, Y.Y. Zhang, L.L. Wu, and G.Y. Yu Effects of Phenylephrine on Transplanted Submandibular Gland Journal of Dental Research, December 1, 2006; 85(12): 1106 - 1111. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Huang, L.L. Wu, Y.Y. Zhang, Y. Gao, and G.Y. Yu Functional {alpha}1-Adrenoceptor Subtypes in Human Submandibular Glands Journal of Dental Research, March 1, 2006; 85(3): 251 - 256. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Finch and R. M. Graham The {alpha}1D-Adrenergic Receptor: Cinderella or Ugly Stepsister Mol. Pharmacol., January 1, 2006; 69(1): 1 - 4. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Hague, S. E. Lee, Z. Chen, S. C. Prinster, R. A. Hall, and K. P. Minneman Heterodimers of {alpha}1B- and {alpha}1D-Adrenergic Receptors Form a Single Functional Entity Mol. Pharmacol., January 1, 2006; 69(1): 45 - 55. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||