![]() |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CARDIOVASCULAR
Department of Pharmacology, Johannes Gutenberg University, Mainz, Germany (H.L., I.B., Y.Y., U.F.); and the Department of Cardiology, University of Heidelberg, Heidelberg, Germany (N.X.)
Received February 6, 2004; accepted May 3, 2004.
| Abstract |
|---|
|
|
|---|
Besides its vasodilator effects, NO also protects blood vessels from thrombosis by inhibiting platelet aggregation and adhesion. In addition, endothelial NO possesses multiple anti-atherosclerotic properties, which include 1) prevention of leukocyte adhesion to vascular endothelium and leukocyte migration into the vascular wall; 2) decreased endothelial permeability, reduced influx of lipoproteins into the vascular wall and inhibition of low-density lipoprotein (LDL) oxidation; and 3) inhibition of DNA synthesis, mitogenesis, and proliferation of vascular smooth muscle cells (Li and Förstermann, 2000a
). In agreement with these protective effects of endothelial NO, pharmacological inhibition of eNOS caused accelerated atherosclerosis in rabbits (Cayatte et al., 1994
). Based on these antihypertensive and anti-atherosclerotic effects, the enhancement of endothelial NO production could be of prophylactic or therapeutic interest.
Artichoke (Cynara scolymus L.) is one of the world's oldest medicinal plants. It has been known by the ancient Egyptians, and the ancient Greeks and Romans used it as a digestive aid. Clinical trials have shown antidyspeptic (Fintelmann, 1996
; Marakis et al., 2002
; Holtmann et al., 2003
) and lipid-lowering effects (Fintelmann, 1996
; Englisch et al., 2000
) of artichoke leaf extract (ALE). Oral administration of ALE increased bile flow in rats (Saenz-Rodriguez et al., 2002
). Such a choleretic action has also been documented in humans (Kirchhoff et al., 1994
). In primarily cultured rat hepatocytes (Gebhardt, 1998
) as well as in HepG2 cells (Gebhardt, 2002
), artichoke extracts inhibited cholesterol biosynthesis, likely due to an indirect inhibition of 3-hydroxy-3-methylglutaryl-CoA reductase activity (Gebhardt, 1998
). Interestingly, ALE also possesses antioxidant properties. It protected cultured rat hepatocytes against hydroperoxide-induced oxidative stress (Gebhardt, 1997
). ALE also inhibited LDL oxidation (Brown and Rice-Evans, 1998
) and reduced the production of intracellular reactive oxygen species by oxidized LDL in cultured endothelial cells and monocytes (Zapolska-Downar et al., 2002
).
Besides its lipid-lowering and antioxidant activities (Brown and Rice-Evans, 1998
; Gebhardt, 1998
; Zapolska-Downar et al., 2002
), preliminary evidence from our laboratory suggested that artichoke may also stimulate vascular NO production. Therefore, the current study was designed to investigate the effect of artichoke on the vascular NO system and to identify the active constituents.
| Materials and Methods |
|---|
|
|
|---|
|
Cynarin (1,3-dicaffeoylquinic acid) and cynaroside (luteolin-7-O-glucopyranoside) were obtained from AppliChem (Darmstadt, Germany); chlorogenic acid (5-O-caffeoylquinic acid) was obtained from Cayman Chemical (Ann Arbor, MI). Luteolin was obtained from Sigma (Taufkirchen, Germany). S-Nitroso-N-penicillamine (SNAP) and 5,6-dichloro-1-
-D-ribofuranosylbenzimidazole (DRB) were obtained from Merck (Darmstadt, Germany).
Cell Culture. Human umbilical vein endothelial cells (HUVECs) were isolated by collagenase digestion. HUVECs were cultured in endothelial cell growth medium (PromoCell, Heidelberg, Germany). HUVECs from passages 3 to 5 were used in the experiments. HUVEC-derived EA.hy 926 endothelial cells were kindly provided by Dr. Cora-Jean Edgell (Chapel Hill, NC). EA.hy 926 endothelial cells were grown under 10% CO2 in Dulbecco's modified Eagle's medium (Sigma) supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 1 mM sodium pyruvate, 100 U/ml penicillin, 100 µg/ml streptomycin, and 1x hypoxanthine, amethopterin/methotrexate, and thymin (Invitrogen, Karlsruhe, Germany) (Li and Förstermann, 2000b
).
Analysis of eNOS Promoter Activity by Stable Transfection of EA.hy 926 Cells. A stable EA.hy 926 cell line was generated by transfection of EA.hy 926 cells with pGL3-eNOS-Hu-3500-neo, which contains a neomycin-resistance gene and a 3.5-kb promoter fragment of human eNOS driving the luciferase reporter gene (Li et al., 1998
). Stable EA.hy 926 cells were cultured in medium containing 1 mg/ml compound G418. For analysis of eNOS promoter activity, the stably transfected cells were incubated with artichoke extracts for 18 h. Then, cell lysates were prepared and luciferase activities were determined as described (Li et al., 1998
). The luciferase activity, normalized for protein concentration of cell lysates, was used as a determinant of eNOS promoter activity.
RNase Protection Assay for eNOS mRNA Analyses. Confluent HUVECs and EA.hy 926 cells were incubated with artichoke extracts for 18 h and total RNA was isolated. The expression of eNOS mRNA was analyzed by the RNase protection assay as described previously (Li et al., 1998
; Li and Förstermann, 2000b
).
Real-Time RT-PCR for eNOS mRNA Analyses. In some experiments, eNOS mRNA expression was analyzed with quantitative real-time RT-PCR using an iCycler iQ System (Bio-Rad, Munich, Germany). Confluent HUVECs and EA.hy 926 cells were incubated with cynarin, chlorogenic acid, luteolin, or cynaroside for 6 h and total RNA was isolated. Total RNA (0.5 µg) was used for real-time RT-PCR analysis with the QuantiTect Probe RT-PCR kit (QIAGEN, Hilden, Germany). Sequences of used primers were GTGGCTGTCTGCATGGACCT (forward) and CCACGATGGTGACTTTGGCT (reverse). The sequence of the dual-labeled TaqMan probe was AGTGGAAATCAACGTGGCCGTGCTGC.
Western Blot for eNOS Protein Analyses. Confluent EA.hy 926 cells were incubated with artichoke extracts for 18 h and total protein was isolated. Western blotting was performed using 50 µg of protein and a monoclonal anti-eNOS antibody (BD Biosciences PharMingen, San Diego, CA), as described previously (Li and Förstermann, 2000b
). Immunocomplexes were developed using an enhanced horseradish peroxidase/luminol chemiluminescence reagent (PerkinElmer Life and Analytical Sciences, Boston, MA) according to the manufacturer's instructions.
Determination of NO Synthesis. EA.hy 926 cells were treated with artichoke extracts for 18 h and then stimulated with 10 µM calcium ionophore A23187
[GenBank]
for 1 h. The supernatants were collected and the oxidation products of NO, nitrite and nitrate, were assayed as a measure of NO synthesis. After reduction of nitrate with nitrate reductase, total nitrite was determined by NO-ozone chemiluminescence using a NOA 280 NO Analyzer (Sievers, Boulder, CO). Total protein content of the cells was determined (Bradford, 1976
), and nitrite levels were normalized for protein (Li et al., 2002a
, 2003
).
Organ Chamber Experiment using Rat Aorta. Aortas were isolated from male Sprague-Dawley rats (250300 g) and cut into rings of 3 mm width. The rings were washed twice with penicillin/streptomycin (100 U/ml, 100 µg/ml)-containing PBS and then maintained in cell culture incubators in Dulbecco's modified Eagle's medium (supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 1 mM sodium pyruvate, 100 U/ml penicillin, and 100 µg/ml streptomycin) for 18 h, with or without cynara OSF (100 µg/ml), or, in other experiments, for 8 h with or without 30 µM cynaroside. After the ex vivo incubation, rings were mounted into organ chambers and isometric tension was measured. Concentration-response curves to norepinephrine (1 nM to 1 µM) were generated (a contraction induced by 80 mM KCl was set at 100%). After washout, the rings were contracted again using 100 nM norepinephrine, and relaxation concentration-response curves were generated with acetylcholine in the absence or presence of the NOS inhibitor NG-nitro-L-arginine methyl ester (L-NAME, 1 mM). Vasodilator response to the NO donor SNAP was achieved after precontraction with 100 nM norepinephrine in the presence of L-NAME.
Statistics. Statistical differences between mean values were determined by analysis of variance followed by Fisher's protected least significant difference test for comparison of different means.
| Results |
|---|
|
|
|---|
|
eNOS mRNA Expression in Human Endothelial Cells. Treatment of HUVECs and EA.hy 926 cells for 18 h with 100 µg/ml ALE or OSF resulted in a significant increase in eNOS mRNA expression, as analyzed with the RNase protection assay (Fig. 2).
|
eNOS Protein Expression in EA.hy 926 Cells. As analyzed with Western blot, both ALE and OSF increased eNOS protein in EA.hy 926 cells after an 18-h treatment (Fig. 3). Densitometric analyses of the three blots demonstrated an average increase to 185% of control after 100 µg/ml ALE and to 197% of control after 100 µg/ml OSF.
|
NO Production in EA.hy 926 Cells. Both ALE and OSF increased NO synthesis in EA.hy 926 cells after an 18-h treatment, as determined by the NO-ozone chemiluminescence assay (Fig. 4). OSF was more efficacious than ALE in stimulating endothelial NO production.
|
In contrast to the long-term effects on eNOS expression (and thus activity), ALE and OSF had no acute effect on eNOS activity. Incubation of EA.hy 926 cells for up to 30 min with ALE or OSF (up to 100 µg/ml), or with the flavonoid cynaroside (up to 30 µM), did not increase NO production.
Effects of Artichoke Flavonoids and Caffeoylquinic Acids. ALE is known to contain large amounts of polyphenolic compounds, with caffeoylquinic acids and flavonoids being major constituents. We therefore tested four commercially available compounds known to be present in ALE: two caffeoylquinic acids (cynarin and chlorogenic acid) and two flavonoids (luteolin and cynaroside). As shown in Fig. 5, luteolin and cynaroside, but not cynarin or chlorogenic acid, increased eNOS promoter activity in a concentration-dependent manner. In parallel, the two artichoke flavonoids also increased eNOS mRNA expression both in HUVECs and EA.hy 926 cells (Fig. 6). Cynarin and chlorogenic acid did not increase eNOS mRNA expression (three experiments).
|
|
eNOS mRNA Stability. To study eNOS mRNA stability, EA.hy 926 cells were treated either with 100 µg/ml OSF for 18 h or with 30 µM cynaroside for 8 h. After the pretreatment, transcription was stopped by adding 60 µM DRB, an inhibitor of RNA polymerase II transcription (Cai et al., 2001
), to the culture medium. eNOS mRNA levels were determined with quantitative real-time RT-PCR at 0, 6, 12, and 24 h thereafter. As shown in Fig. 7, OSF and cynaroside had no significant effect on eNOS mRNA stability.
|
Vasomotor Responses of Rat Aorta ex Vivo. To investigate functional consequences of an eNOS up-regulation, we studied the effects of OSF and cynaroside on vasomotion. In organ chamber experiments, rat aortic rings pretreated with OSF for 18 h showed a decreased vasoconstriction in response to norepinephrine (Fig. 8A). The NOS inhibitor L-NAME (1 mM) did not change basal vascular tone. However, the norepinephrine-induced vasoconstriction was significantly enhanced by L-NAME, both in control and OSF-pretreated rings, although the OSF-exposed rings did not reach the same level of contraction as control vessels (Fig. 8A).
|
The vasodilator response to acetylcholine was significantly enhanced by OSF pretreatment (Fig. 8B). No significant relaxation was observed in the presence of the NOS inhibitor L-NAME (Fig. 8B). The vasodilator response to the NO donor SNAP was not changed by OSF (Fig. 8C).
Pretreatment of aortic rings with the flavonoid cynaroside had an effect on vasomotion similar to that of OSF. Cynaroside-pretreated rings showed decreased constriction response to norepinephrine (similar to Fig. 8A, three experiments). Also, the vasodilator response to acetylcholine was enhanced (similar to Fig. 8B, three experiments).
Additional experiments using aortic rings without OSF/cynaroside pretreatment showed that OSF and cynaroside has no acute effects on vasomotion. In the absence of acetylcholine, no relaxation to OSF (10300 µg/ml) or cynaroside (1100 µM) was observed within 10 min in rings precontracted with 100 nM norepinephrine (three experiments).
| Discussion |
|---|
|
|
|---|
NO synthesis can be modulated by eNOS activity and/or eNOS gene expression (Li et al., 2002b
,c
). Since short-term incubation with the artichoke extract had no effect on NO production in EA.hy 926 cells and did not change vascular tone of aortic rings, the effects of artichoke on endothelial NO synthesis seem to result mainly or exclusively from up-regulation of eNOS gene expression. Due to the antithrombotic, anti-atherosclerotic, and antihypertensive properties of endothelial NO, the eNOS enzyme could be an interesting target for the prevention or therapy of cardiovascular diseases. In vivo up-regulation of eNOS gene expression seems to be a reasonable and realistic strategy.
There is precedent for this strategy in the form of the 3-hydroxy-3-methylglutaryl-CoA reductase inhibitors (statins). Statins possess vasoprotective properties independent of their cholesterol-lowering effect, which include the up-regulation of eNOS expression in platelets and endothelial cells. This eNOS up-regulation was found to be associated with a decrease in platelet activation (Laufs et al., 2000b
), an improvement of endothelial function in hypercholesterolemia (Wilson et al., 2001
), an augmentation of cerebral blood flow (Endres et al., 1998
; Laufs et al., 2000a
), and a protection from stroke (Endres et al., 1998
; Laufs et al., 2000a
; Amin-Hanjani et al., 2001
). Up-regulation of eNOS gene expression seems to be the predominant, if not the only, mechanism, because the protective effects are absent in eNOS-deficient mice.
However, one recent study has questioned the beneficial effects of eNOS up-regulation in vivo (Ozaki et al., 2002
). In this study, a transgenic mouse strain (eNOS-Tg) was interbred with atherogenic apoE-deficient (apoE-KO) mice resulting in apoE-KO/eNOS-Tg mice. These mice expressed about 11-fold more eNOS than did the wild-type mice and, unexpectedly, developed larger atherosclerotic lesions than did apoE-KO mice (Ozaki et al., 2002
). As discussed by the authors themselves (Ozaki et al., 2000), "uncoupling" of eNOS seems to occur under these circumstances. It is established that under certain pathological conditions, eNOS can generate superoxide rather than NO by dissociation of the ferrousdioxygen complex (Vasquez-Vivar et al., 1998
; Xia et al., 1998
). Superoxide produced by the uncoupled eNOS may enhance the preexisting oxidative stress. The molecular mechanisms underlying eNOS uncoupling have not been completely understood. A relative lack of (6R)-5,6,7,8-tetrahydro-L-biopterin, an eNOS cofactor, seems to play a crucial role in many cases (Stuehr et al., 2001
; Vasquez-Vivar et al., 2003
).
In contrast to the extreme overexpression of eNOS mentioned above, the eNOS up-regulation by pharmacological compounds like statins is usually moderate (<3-fold). At these levels, the up-regulated eNOS seems to remain functional. In addition, a novel compound from Aventis (Strasbourg, France) (Cpd2431), which also moderately up-regulates eNOS expression, has been shown to reduce experimental atherosclerosis in apoE-KO mice (Wohlfart et al., 2002
). In the present study, artichoke extracts increased eNOS gene expression to a similar extent. Results from the organ bath experiments indicate that the up-regulated eNOS remained functional.
The active constituents responsible for this eNOS-up-regulating action of artichoke are present in the OSF. The OSF is rich in polyphenolic compounds, with caffeoylquinic acids and flavonoids as the major chemical components. Examples are cynarin and chlorogenic acid for caffeic acid derivatives, and luteolin as well as apigenin for flavonoids (Rechner et al., 2001
; Llorach et al., 2002
; Wang et al., 2003
). The aqueous subfraction contains sesquiterpenes (cynaropicrin, aguerin B, and grosheimin) and sesquiterpene glycosides (cynarascolosides A, B, and C) (Shimoda et al., 2003
). Polyphenolic compounds, such as resveratrol (present in red wine and grapes), can increase eNOS gene expression, as recently reported by our group (Wallerath et al., 2002
, 2003
).
The artichoke extract OSF enriched in flavonoids and caffeoylquinic acids was more efficacious in stimulating eNOS expression than was the crude extract. The ASF, in contrast, contains only small amounts of these compounds and was without effect on eNOS expression (Table 1). Results from our experiments with cynarin, chlorogenic acid, luteolin, and cynaroside suggest that artichoke flavonoids represent one group of the compounds that are responsible for the eNOS up-regulation caused by cynara extracts.
In conclusion, the present study demonstrates that artichoke leaf extracts increase eNOS gene expression and NO production in cultured human vascular endothelial cells. Artichoke leaf extract also enhances endothelium-dependent vasodilation in rat aorta. This novel action of the plant seems to be mediated, at least in part, by artichoke flavonoids. Based on the beneficial effects of endothelial NO, vasoprotective and anti-atherosclerotic effects are likely to ensue also in vivo.
| Acknowledgements |
|---|
| Footnotes |
|---|
Article, publication date, and citation information can be found at http://jpet.aspetjournals.org.
ABBREVIATIONS: NO, nitric oxide; ALE, artichoke leaf extract; apoE-KO, apolipoprotein E-knockout; ASF, aqueous subfraction from ALE; DRB, 5,6-dichloro-1-
-D-ribofuranosylbenzimidazole; HUVEC, human umbilical vein endothelial cell; kb, kilobase(s); LDL, low-density lipoprotein; L-NAME, NG-nitro-L-arginine methyl ester; NOS, nitric-oxide synthase; eNOS, endothelial-type NOS; OSF, organic subfraction from ALE; RT-PCR, reverse transcription-polymerase chain reaction; SNAP, S-nitroso-N-penicillamine.
Address correspondence to: Dr. Huige Li, Department of Pharmacology, Johannes Gutenberg University, Obere Zahlbacher Strasse 67, D-55131 Mainz, Germany. E-mail: HuigeLi{at}mail.Uni-Mainz.de
| References |
|---|
|
|
|---|
Amin-Hanjani S, Stagliano NE, Yamada M, Huang PL, Liao JK, and Moskowitz MA (2001) Mevastatin, an HMG-CoA reductase inhibitor, reduces stroke damage and upregulates endothelial nitric oxide synthase in mice. Stroke 32: 980-986.
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254.[CrossRef][Medline]
Brown JE and Rice-Evans CA (1998) Luteolin-rich artichoke extract protects low density lipoprotein from oxidation in vitro. Free Radic Res 29: 247-255.[CrossRef][Medline]
Cai H, Davis ME, Drummond GR, and Harrison DG (2001) Induction of endothelial NO synthase by hydrogen peroxide via a Ca(2+)/calmodulin-dependent protein kinase II/janus kinase 2-dependent pathway. Arterioscler Thromb Vasc Biol 21: 1571-1576.
Cayatte AJ, Palacino JJ, Horten K, and Cohen RA (1994) Chronic inhibition of nitric oxide production accelerates neointima formation and impairs endothelial function in hypercholesterolemic rabbits. Arterioscler Thromb 14: 753-759.
Endres M, Laufs U, Huang Z, Nakamura T, Huang P, Moskowitz MA, and Liao JK (1998) Stroke protection by 3-hydroxy-3-methylglutaryl (HMG)-CoA reductase inhibitors mediated by endothelial nitric oxide synthase. Proc Natl Acad Sci USA 95: 8880-8885.
Englisch W, Beckers C, Unkauf M, Ruepp M, and Zinserling V (2000) Efficacy of artichoke dry extract in patients with hyperlipoproteinemia. Arzneim-Forsch 50: 260-265.[Medline]
Fintelmann V (1996) Antidyspeptic and lipid-lowering effect of artichoke leaf extract. Z Allg Med 72 (Suppl 2): 3-19.
Gebhardt R (1997) Antioxidative and protective properties of extracts from leaves of the artichoke (Cynara scolymus L.) against hydroperoxide-induced oxidative stress in cultured rat hepatocytes. Toxicol Appl Pharmacol 144: 279-286.[CrossRef][Medline]
Gebhardt R (1998) Inhibition of cholesterol biosynthesis in primary cultured rat hepatocytes by artichoke (Cynara scolymus L.) extracts. J Pharmacol Exp Ther 286: 1122-1128.
Gebhardt R (2002) Prevention of taurolithocholate-induced hepatic bile canalicular distortions by HPLC-characterized extracts of artichoke (Cynara scolymus) leaves. Planta Med 68: 776-779.[CrossRef][Medline]
Holtmann G, Adam B, Haag S, Collet W, Grunewald E, and Windeck T (2003) Efficacy of artichoke leaf extract in the treatment of patients with functional dyspepsia: a six-week placebo-controlled, double-blind, multicentre trial. Aliment Pharmacol Ther 18: 1099-1105.[CrossRef][Medline]
Huang PL, Huang Z, Mashimo H, Bloch KD, Moskowitz MA, Bevan JA, and Fishman MC (1995) Hypertension in mice lacking the gene for endothelial nitric oxide synthase. Nature (Lond) 377: 239-242.[CrossRef][Medline]
Kirchhoff R, Beckers CH, Kirchhoff GM, Trinczek-Gärtner H, and Petrowitz OH Jr (1994) Increase in choleresis by means of artichoke extract: results of a randomised placebo-controlled double-blind study. Phytomedicine 1: 107-115.
Laufs U, Endres M, Stagliano N, Amin Hanjani S, Chui DS, Yang SX, Simoncini T, Yamada M, Rabkin E, Allen PG, et al. (2000a) Neuroprotection mediated by changes in the endothelial actin cytoskeleton. J Clin Investig 106: 15-24.[Medline]
Laufs U, Gertz K, Huang P, Nickenig G, Bohm M, Dirnagl U, and Endres M (2000b) Atorvastatin upregulates type III nitric oxide synthase in thrombocytes, decreases platelet activation and protects from cerebral ischemia in normocholesterolemic mice. Stroke 31: 2442-2449.
Li H, Burkhardt C, Heinrich U-R, Brausch I, Xia N, and Förstermann U (2003) Histamine upregulates gene expression of the endothelial NO synthase in human vascular endothelial cells. Circulation 107: 2348-2354.
Li H and Förstermann U (2000a) Nitric oxide in the pathogenesis of vascular disease. J Pathol 190: 244-254.[CrossRef][Medline]
Li H and Förstermann U (2000b) Structure-activity relationship of staurosporine analogs in regulating expression of endothelial nitric-oxide synthase gene. Mol Pharmacol 57: 427-435.
Li H, Junk P, Huwiler A, Burkhardt C, Wallerath T, Pfeilschifter J, and Förstermann U (2002a) Dual effect of ceramide on human endothelial cells: induction of oxidative stress and transcriptional upregulation of endothelial nitric oxide synthase. Circulation 106: 2250-2256.
Li H, Oehrlein SA, Wallerath T, Ihrig-Biedert I, Wohlfart P, Ulshöfer T, Jessen T, Herget T, Förstermann U, and Kleinert H (1998) Activation of protein kinase C alpha and/or epsilon enhances transcription of the human endothelial nitric oxide synthase gene. Mol Pharmacol 53: 630-637.
Li H, Wallerath T, and Förstermann U (2002b) Physiological mechanisms regulating the expression of endothelial-type NO synthase. Nitric Oxide 7: 132-147.[CrossRef][Medline]
Li H, Wallerath T, Münzel T, and Förstermann U (2002c) Regulation of endothelial-type NO synthase expression in pathophysiology and in response to drugs. Nitric Oxide 7: 149-164.[CrossRef][Medline]
Llorach R, Espin JC, Tomas-Barberan FA, and Ferreres F (2002) Artichoke (Cynara scolymus L.) byproducts as a potential source of health-promoting antioxidant phenolics. J Agric Food Chem 50: 3458-3464.[CrossRef][Medline]
Marakis G, Walker AF, Middleton RW, Booth JC, Wright J, and Pike DJ (2002) Artichoke leaf extract reduces mild dyspepsia in an open study. Phytomedicine 9: 694-699.[CrossRef][Medline]
Ozaki M, Kawashima S, Yamashita T, Hirase T, Namiki M, Inoue N, Hirata K, Yasui H, Sakurai H, Yoshida Y, et al. (2002) Overexpression of endothelial nitric oxide synthase accelerates atherosclerotic lesion formation in apoE-deficient mice. J Clin Investig 110: 331-340.[CrossRef][Medline]
Rechner AR, Pannala AS, and Rice-Evans CA (2001) Caffeic acid derivatives in artichoke extract are metabolised to phenolic acids in vivo. Free Radic Res 35: 195-202.[CrossRef][Medline]
Rees DD, Palmer RM, and Moncada S (1989) Role of endothelium-derived nitric oxide in the regulation of blood pressure. Proc Natl Acad Sci USA 86: 3375-3378.
Saenz-Rodriguez T, Garcia-Gimenez D, and de la Puerta Vazquez R (2002) Choleretic activity and biliary elimination of lipids and bile acids induced by an artichoke leaf extract in rats. Phytomedicine 9: 687-693.[CrossRef][Medline]
Shimoda H, Ninomiya K, Nishida N, Yoshino T, Morikawa T, Matsuda H, and Yoshikawa M (2003) Anti-hyperlipidemic sesquiterpenes and new sesquiterpene glycosides from the leaves of artichoke (Cynara scolymus L.): structure requirement and mode of action. Bioorg Med Chem Lett 13: 223-228.[CrossRef][Medline]
Stuehr D, Pou S, and Rosen GM (2001) Oxygen reduction by nitric-oxide synthases. J Biol Chem 276: 14533-14536.
Vasquez-Vivar J, Kalyanaraman B, and Martasek P (2003) The role of tetrahydrobiopterin in superoxide generation from eNOS: enzymology and physiological implications. Free Radic Res 37: 121-127.[CrossRef][Medline]
Vasquez-Vivar J, Kalyanaraman B, Martasek P, Hogg N, Masters BS, Karoui H, Tordo P, and Pritchard KA Jr (1998) Superoxide generation by endothelial nitric oxide synthase: the influence of cofactors. Proc Natl Acad Sci USA 95: 9220-9225.
Wallerath T, Deckert G, Ternes T, Anderson H, Li H, Witte K, and Förstermann U (2002) Resveratrol, a polyphenolic phytoalexin present in red wine, enhances expression and activity of endothelial nitric oxide synthase. Circulation 106: 1652-1658.
Wallerath T, Poleo D, Li H, and Förstermann U (2003) Red wine increases the expression of human endothelial nitric oxide synthase: a mechanism that may contribute to its beneficial cardiovascular effects. J Am Coll Cardiol 41: 471-478.
Wang M, Simon JE, Aviles IF, He K, Zheng QY, and Tadmor Y (2003) Analysis of antioxidative phenolic compounds in artichoke (Cynara scolymus L.). J Agric Food Chem 51: 601-608.[CrossRef][Medline]
Wilson SH, Simari RD, Best PJ, Peterson TE, Lerman LO, Aviram M, Nath KA, Holmes DR, and Lerman A (2001) Simvastatin preserves coronary endothelial function in hypercholesterolemia in the absence of lipid lowering. Arterioscler Thromb Vasc Biol 21: 122-128.
Wohlfart P, Tiemann M, Strobel H, Suzuki T, Dharanipragada R, Li H, Förstermann U, and Rütten H (2002) A novel endothelial nitric oxide synthase expression enhancer reduces atherocsclerosis in apoE-deficient mice (Abstract). Circulation (Suppl) 106: II-213.
Xia Y, Tsai AL, Berka V, and Zweier JL (1998) Superoxide generation from endothelial nitric-oxide synthase. A Ca2+/calmodulin-dependent and tetrahydrobiopterin regulatory process. J Biol Chem 273: 25804-25808.
Zapolska-Downar D, Zapolski-Downar A, Naruszewicz M, Siennicka A, Krasnodebska B, and Koldziej B (2002) Protective properties of artichoke (Cynara scolymus) against oxidative stress induced in cultured endothelial cells and monocytes. Life Sci 71: 2897-2908.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
P. Wohlfart, H. Xu, A. Endlich, A. Habermeier, E. I. Closs, T. Hubschle, C. Mang, H. Strobel, T. Suzuki, H. Kleinert, et al. Antiatherosclerotic Effects of Small-Molecular-Weight Compounds Enhancing Endothelial Nitric-Oxide Synthase (eNOS) Expression and Preventing eNOS Uncoupling J. Pharmacol. Exp. Ther., May 1, 2008; 325(2): 370 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Steinkamp-Fenske, L. Bollinger, H. Xu, Y. Yao, S. Horke, U. Forstermann, and H. Li Reciprocal Regulation of Endothelial Nitric-Oxide Synthase and NADPH Oxidase by Betulinic Acid in Human Endothelial Cells J. Pharmacol. Exp. Ther., August 1, 2007; 322(2): 836 - 842. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||