JPET Assistant Professor of Medicine (Clinician-Educator)

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Journal of Pharmacology And Experimental Therapeutics Fast Forward
First published on April 14, 2004; DOI: 10.1124/jpet.104.067819


0022-3565/04/3103-845-854$20.00
JPET 310:845-854, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.104.067819v1
310/3/845    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by DeLozier, T. C.
Right arrow Articles by Goldstein, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by DeLozier, T. C.
Right arrow Articles by Goldstein, J. A.

ABSORPTION, DISTRIBUTION, METABOLISM, AND EXCRETION

CYP2C44, a New Murine CYP2C That Metabolizes Arachidonic Acid to Unique Stereospecific Products

Tracy C. DeLozier, Cheng-Chung Tsao, Sherry J. Coulter, Julie Foley, J. Alyce Bradbury, Darryl C. Zeldin, and Joyce A. Goldstein

Laboratory of Pharmacology and Chemistry (T.C.D., C.-C.T., S.J.C., J.A.G.), Experimental Pathology (J.F.), and Laboratory of Pulmonary Pathobiology (J.A.B., D.C.Z.), National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, North Carolina

Received March 1, 2004; accepted April 14, 2004.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The human CYP2Cs have been studied extensively with respect to the metabolism of clinically important drugs and endogenous chemicals such as arachidonic acid (AA). Five members of the mouse CYP2C family have previously been described that metabolize arachidonic acid into regio- and stereospecific epoxyeicosatrienoic acids (EETs) and hydroxyeicosatetraenoic acids, which have many important physiological roles. Herein, we describe the cloning and characterization of a new mouse cytochrome P450 (P450), CYP2C44, which has the lowest homology with other known mouse CYP2Cs. Western blotting and real-time polymerase chain reaction detected CYP2C44 mRNA and protein in liver >> kidney > adrenals. Kidney contained approximately 10% of the CYP2C44 mRNA content of liver. CYP2C44 metabolized AA to unique stereospecific products, 11R,12S-EET and 8R, 9S-EET, which are similar to those produced by rat CYP2C23. CY2C23 is highly expressed in rat kidney and has been suggested to be important in producing compensatory renal artery vasodilation in response to salt-loading in this species. Immunohistochemistry showed the presence of CYP2C44 in hepatocytes, biliary cells of the liver, and the proximal tubules of the kidney. Unlike mouse CYP2C29, CYP2C38, and CYP2C39, CYP2C44 did not metabolize the common CYP2C substrate tolbutamide. CYP2C44 was not induced by phenobarbital or pregnenolone-16{alpha}-carbonitrile, two prototypical inducers of hepatic P450s. The presence of CYP2C44 in mouse liver, kidney, and adrenals and the unique stereospecificity of its arachidonic acid metabolites are consistent with the possibility that it may have unique physiological roles within these tissues, such as modulation of electrolyte transport or vascular tone.


The human CYP2C subfamily is well characterized and known to metabolize clinically important pharmaceuticals such as the hypoglycemic drug tolbutamide (Veronese et al., 1991Go; de Morais et al., 1994Go), the anticoagulant warfarin (Rettie et al., 1992Go) and nonsteroidal anti-inflammatory drugs such as diclofenac, ibuprofen, and acetylsalicylic acid (Leemann et al., 1993Go). Members of the human CYP2C subfamily also metabolize arachidonic acid (Daikh et al., 1994Go). CYP2Cs have been identified in the chicken and mammalian species with four members in humans (Goldstein and de Morais, 1994Go), seven in rats (Legraverend et al., 1994Go; Strom et al., 1994Go; Nelson et al., 1996Go), and nine members in rabbits (Nelson et al., 1996Go). The mouse CYP2C family appears to be the most complex, with 5 members published to date (Matsunaga et al., 1994Go; Luo et al., 1998Go) at least 10 unpublished new members, and 4 pseudogenes identified (Wang et al., 2004Go; Y. Zhao, J. A. Goldstein, and D. C. Zeldin, unpublished data) (for update see http://drnelson.utmem.edu/CytochromeP450.html). With increasing attention being given to the mouse as a model to study the physiological relevance of enzymes in vivo, identification and characterization of the individual members of the CYP2C subfamily is an important first step in identifying their physiological and pathological roles.

Most members of the P450 families 1 through 4 are expressed predominately in liver but are also found in extrahepatic tissues of both humans and rats. These include the CYP1A, CYP2C, CYP2D, CYP2E, CYP2J, and CYP3A subfamilies (Murray et al., 1988Go; Peters and Kremers, 1989Go; Rich et al., 1989Go; de Waziers et al., 1990Go; Shimizu et al., 1990Go; Fasco et al., 1993Go; Zeldin et al., 1997Go; Zhang et al., 1998Go; Dey et al., 1999Go). Interestingly, many of these P450s are not only capable of metabolizing foreign compounds, but they are also able to metabolize endogenous compounds such as arachidonic acid to physiologically important metabolites.

Arachidonic acid (AA) is known to be biotransformed by three types of enzymes: lipoxygenases, cyclooxygenases, and P450 monooxygenases (Zeldin, 2001Go). The CYP2B, CYP2C, and CYP2J subfamilies biotransform AA to four epoxyeicosatrienoic acids (EETs): 14,15-, 11,12-, 8,9-, and 5,6-EETs. These products are stereospecific and exist as either the R,S- or the S,R-enantiomers (Zeldin, 2001Go). P450-mediated metabolism of arachidonic acid can also produce {omega}-terminal HETEs, (16-, 17-, 18-, 19-, and 20-HETE), as well as lipoxygenase-like metabolites (5-, 8-, 9-, 11-, 12-, and 15-HETEs) (Zeldin, 2001Go).

Substantial evidence has accumulated showing that regio-specific metabolites formed from the P450 arachidonic acid pathway are involved in regulating many physiological effects including kidney transport, gluconeogenesis, cellular proliferation, and vascular tone. Biological effects are also frequently stereospecific (Campbell et al., 1996Go; Imig et al., 1996aGo). Previous reports have shown a physiological role of 11,12-EET and 14,15-EET as vasodilators of renal arterioles (Imig et al., 1996bGo). In the rat, dietary salt has been shown to up-regulate CYP2C23 in the kidney (Holla et al., 1999Go). This enzyme produces a unique stereospecific product,11R,12S-EET. Importantly, when renal arteries were preconstricted with epinephrine, 11,12-EET increased the diameter of the renal arteries, and this effect was specific to the 11R,12S-enantiomer (Imig et al., 1996aGo). Thus, the increase in rat CYP2C23 appears to be part of a compensatory pathway to protect against salt-induced hypertension in the rat, and the production of 11R,12S-EET may be involved in controlling renal vasodilation.

In this study, ESTs from a mouse kidney library were identified as belonging to a previously unknown member of the CYP2C subfamily, and the sequence information was used to clone a novel CYP2C that is stereospecific for biosynthesis of 11R,12S-EET and 8R,9S-EET. The stereospecificity of these metabolites is unique from those produced by other previously reported mouse CYP2Cs (Luo et al., 1998Go). This new isoform is expressed primarily in liver, but also is found in kidney and adrenal. Immunohistochemistry studies demonstrated specific staining for CYP2C44 in the hepatic bile duct epithelial cells and hepatocytes of the liver as well as the proximal tubules of the kidney. Understanding the function of this P450 and its products may reveal unique physiological roles in these tissues.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Materials. Female and Male C57/BL6 mice, approximately 60 days old, were obtained from Charles River (Raleigh, NC). Recombinant human NADPH-P450 oxidoreductase was purchased from Oxford Biomedical Research (Oxford, MI). Restriction endonucleases were purchased from New England Biolabs (Beverly, MA). [{alpha}-32P]dCTP was purchased from Amersham Biosciences Inc. (Piscataway, NJ) and [1-14C]arachidonic acid was purchased from PerkinElmer Life and Analytical Sciences (Boston, MA).

Cloning of the Mouse CYP2C44 cDNA. A new CYP2C subfamily sequence was discovered from searching an EST mouse database (http://drnelson.utmem.edu/UNIGENE.mouse.html). Total RNA was prepared from C57/BL6 mouse kidneys using a QIAGEN RNeasy Mini Kit (QIAGEN, Valencia, CA). Reverse-transcribed PCR was performed with the SuperScript II Reverse Transcriptase kit from Invitrogen (Carlsbad, CA). Briefly, 500 ng of total RNA was used to synthesize cDNA utilizing the oligo(dT) primer. For PCR, primers utilized for CYP2C44 amplification were: ATGGAGCTGGCTGGGTCTCCCTACG (sense primer) and AGATTTCAGGTTAAAGTTCTG (antisense primer). The PCR reaction contained 1x PCR buffer, 1.5 µM MgCl2, 0.2 µM deoxynucleoside-5'-triphosphates, 0.25 µM each primer, and 2 U of TaqDNA polymerase from Invitrogen in a final volume of 50 µl. PCR was performed on a PerkinElmer 4800 thermal cycler (Applied Biosystems, Foster City, CA). The cycling conditions consisted of an initial denaturation of 94°C for 3 min followed by 35 cycles of 94°C for 30 s, 58°C for 30 s, 72°C for 1 min and 30 s with a final extension at 72°C for 10 min. The resulting product was isolated on a 1.5% ethidium bromide-stained agarose gel, gel purified using the QIAquick Gel Extraction Kit from QIAGEN, and cloned into PCR II vectors using a TA cloning kit from Invitrogen. The subsequently cloned DNA was sequenced. Based on amino acid sequence homology with other mouse CYP2Cs, the new mouse hemoprotein encoded by the cDNA was designated CYP2C44 by the Committee on Standardized Cytochrome P450 Nomenclature. Nucleotide sequence data reported are available in the Third Party Annotation Section of the DNA Data Bank of Japan/European Molecular Biology Laboratory/GenBank databases under the accession number TPA: BK005218 [GenBank] . Analysis of the cDNA and protein sequences was performed by the Genetic Computer Group program (Madison, WI).

Construction of a CYP2C44 Expression Plasmid. Recombinant mouse CYP2C44 was expressed in Escherichia coli using the pCW vector (Barnes, 1996Go). To produce high levels of expression of the P450 in bacteria, the N-terminus of CYP2C44 was modified to that of bovine CYP17, MALLLAVF (Barnes et al., 1991Go). The modification was accomplished by PCR amplification of the open reading frame of CYP2C44 using Pfu DNA polymerase from Stratagene (La Jolla, CA). The forward primer, 5' GGTGGACATATGGCTCTGTTATTAGCAGTTTTTGAGCTGCTGGGTCTCC 3', contains an NdeI restriction site followed by the bovine CYP17 N-terminus, and the antisense primer, 3' GCGGAACAAGGTTCTATCTTCGAAGGCTGA 5', contains a HindIII restriction site. The PCR products were cloned into the pCW vector using the NdeI and HindIII restriction sites, and the resulting plasmid was sequenced and confirmed to be without PCR errors.

Expression and Partial Purification of CYP2C44. An overnight bacterial culture was grown at 37°C in LB in the presence of ampicillin (100 µg/ml). A 50-ml aliquot was diluted 10-fold with Terrific Broth and cultured at 25°C for 48 h to 72 h in the presence of ampicillin (100 µg/ml) until the OD600 was approximately 0.4 to 0.6. Isopropyl-B-D-thiogalactoside (0.5 mM final concentration) and {delta}-aminolevulinic acid (0.5 mM final concentration) were then added to the culture at log phase. Samples were taken at 24-, 48-, or 72-h intervals, and the P450 spectrum was analyzed using a DW-2000 spectrophotometer (Omura and Sato, 1964Go). The cultured cells were harvested after 72 h and P450 proteins were partially purified as described previously (Luo et al., 1998Go).

Pregnenolone-16{alpha}-Carbonitrile (PCN) and Phenobarbital (PB) Induction Studies. C57/BL6 female and male mice were fed a standard solid diet and tap water for 5 days. For PCN induction studies, mice received either vehicle (corn oil) or 50 mg/kg PCN by intraperitoneal injection for 4 days. For phenobarbital induction studies, mice received vehicle (corn oil), or PB (80 mg/kg) via oral gavage at a volume of 10 ml/kg for 4 days. Mice were then sacrificed on the 5th day, and livers were collected for both total RNA and protein studies.

Salt Treatment. Salt loading was done by giving C57/BL6 female and male mice either salt water (2% NaCl by weight) for 2 weeks or regular tap water (control mice). Mice were given free access to the drinking water. After the 2-week period, the mice were sacrificed, and the kidneys and livers were harvested for Western blotting.

Isolation of Total RNA and Real-Time PCR Analysis. Normal C57/BL6 male and female mouse tissues were excised, placed in RNAlater (Ambion, Austin, TX), and stored at -20°C until use. Total RNA was extracted from animal tissues using RNeasy from QIAGEN, following the manufacturer's protocol. RNA (200 ng) was transcribed to cDNA using 200 units of Superscript II reverse transcriptase from Invitrogen (Carlsbad, CA), 100 ng of random hexamers, and a 10 mM concentration each of dGTP, dATP, dTTP, and dCTP in 1x buffer (supplied) in a total volume of 20 µl following the manufacturer's protocol. The reaction was initially incubated at 42°C for 2 min and then at 25°C for 10 min before a final incubation at 42°C for 50 min. Real-time PCR was performed in the presence of 1x SYBR Green Master Mix, 10 pmol of gene-specific primers, and 1 µl of reverse-transcribed cDNA. PCR mixtures contained 17 µl of SYBR Green Buffer, 10 pmol of gene-specific primers, and 1 µl of diluted (3-fold dilution) reverse transcriptase product in a total volume of 20 µl. Reactions were run in an ABI Prism 7700 Sequence Detector from Applied Biosystems. The samples were subjected to the following conditions: 50°C for 2 min, 95°C for 10 min, 40 cycles of 95°C for 15 s, 62°C for 30 s, and 72°C for 30 s, with a ramping of 19:59 and a final cycle of 95°C for 15 s. The resultant PCR products were electrophoresed on a 3% agarose gel containing ethidium bromide. A standard curve was generated for each primer pair developed from a dilution of the cDNA products. Primer pairs are shown in Table 1. PCR products were quantified by comparison with the linear range of the standard curve. {beta}-Actin was used as an internal control to normalize all unknown sample values. Melting curves produced a single prominent product, which was further verified by agarose gel electrophoresis. This band was not detected in the blank sample, which contained no RNA.


View this table:
[in this window]
[in a new window]
 
TABLE 1 Sequence-specific PCR primers for amplification of mouse CYP2C44 and {beta}-actin for real-time PCR

 

Protein Immunoblotting. A CYP2C44-specific peptide, CRGPLPIIEDSQK, was synthesized by ResGen (Invitrogen) and coupled to keyhole limpet hemocyanin through the terminal cysteine. Custom polyclonal antibodies specific for CYP2C44 were then produced by Covance Research Products Inc. (Princeton, NJ) as follows. At the start of production, a 1 mg/ml suspension of conjugated peptide was diluted 1:1 with Freund's complete adjuvant, and each of two rabbits received 500 µg (1 ml) after prebleed. After 4 weeks, rabbits were each boosted with 250 µg of peptide diluted 1:1 with Freund's incomplete adjuvant, followed with a test bleed after 2 weeks. Rabbits received four additional boosts at 4-week intervals, with production bleeds beginning after the third boost. Rabbits were sacrificed by exsanguination at completion of production. Antibodies used in this study were from the second production bleed.

Microsomes were prepared from frozen mouse tissues by differential centrifugation at 4°C. Microsomes and partially purified recombinant proteins were electrophoresed in SDS-10% (w/v) polyacrylamide gels and transferred to nitrocellulose membranes. Membranes were immunoblotted with rabbit anti-CYP2C44 peptide-specific antibody (1:500) and donkey anti-rabbit IgG conjugated to horseradish peroxidase from Amersham Biosciences Inc. Specific bands were visualized using SuperSignal West Pico Chemiluminescent Substrate from Pierce (Rockford, IL) and a SynGene GeneGnome chemiluminescence detection system from Synoptics (Cambridge, UK).

Tolbutamide Hydroxylation Assays [ring-U-14C]. Tolbutamide stock was evaporated to dryness in a Speed Vac Model SC100 Concentrator (Savant Instruments, Holbrook, NY), resuspended in a small volume of methanol, and combined with unlabeled tolbutamide to obtain the desired concentration and specific activity. The reconstitution mixture consisted of the CYP2C44 partially purified recombinant protein with 0.3 µg/pmol P450 of 1,2-didodecanoyl-sn-glycero-3-phosphocholine, 4 pmol/pmol P450 of recombinant human NADPH-P450 oxidoreductase (POR), and 2 pmol/pmol P450 of human cytochrome b5. This mixture was incubated at 37°C for 5 min and then placed on ice. For single point assays, a reaction volume of 250 µl, which contained 20 pmol of reconstituted enzyme, was combined with 1 mM [ring-U-14C] tolbutamide (8 mCi/mmol) containing 20 mM HEPES (pH 7.4), 0.1 mM EDTA, and 1.25 mM MgCl2. NADPH at a final concentration of 4 mM was added to initiate metabolism after the reaction mixtures were prewarmed for 3 min at 37°C. This reaction proceeded for 45 min until the addition of methanol in a volume equal to reaction volume terminated the reactions. Reactions were centrifuged at 10,000g for 10 min, and aliquots of supernatant were removed for assay of total radioactivity by liquid scintillation (Beckman LS6500 Multi-Purpose Scintillation Counter; Beckman Coulter, Fullerton, CA). Metabolites were examined by HPLC as previously described (Blaisdell et al., 2002Go), with the following modifications: the mobile phase consisted of acetonitrile/0.05% trifluoroacetic acid (40:60),and the standard was nonradioactive tolbutamide. The elution times of the unlabeled hydroxytolbutamide standard (BD Gentest, Woburn, MA) were used to identify the radiolabeled metabolites.

Incubation of Recombinant CYP2C44 with Arachidonic Acid and Linoleic Acid Production Characterization. Purification of the [1-14C]AA and LA was performed by passing it over a 0.5 cm x 2 cm silica gel column (230–400 mesh, average pore diameter 60 Ångstrom units; Sigma-Aldrich) using hexane/0.5% acetic acid as the mobile phase. The fraction containing the radiolabeled AA or LA (0–9 ml) is dried under a nitrogen stream and used within 30 min. Following a previous protocol for regiochemical analysis of the metabolites of AA that were produced by recombinant murine CYP2Cs (Luo et al., 1998Go), partially purified recombinant CYP2C44 protein was preincubated with NADPH-P450 oxidoreductase (POR/P450 ratio, 4:1) and dilauroylphosphatidylcholine (50 µg/ml, final concentration) on ice for 30 min. The enzyme mixtures were then added to reaction mixtures containing 0.05 M Tris-HCl buffer (pH 7.5), 0.15 M KCl, 0.01 M MgCl2, 8 mM sodium isocitrate, 0.5 IU/ml isocitrate dehydrogenase, and either arachidonic acid or linoleic acid (55–56 µCi/µmol; 100 µM final concentration) and constantly stirred at 37°C. A 1 mM final concentration of NADPH was added to initiate the reaction, and incubation continued for 30 min. Control experiments without NADPH, AA, or LA were also included, which yielded no product. The reaction products were then extracted and analyzed by reverse-phase HPLC for regiochemical distribution of EETs, HETEs, HODEs and EOAs as described previously (Luo et al., 1998Go). All products were identified by comparing reverse- and normal-phase HPLC properties with those of authentic EET, HETE, HODE, and EOA standards. For chiral analysis, batchwise collections of EETs were derivatized, purified, and resolved into corresponding antipodes by chiral-phase HPLC as previously described (Hammonds et al., 1989Go).

Immunohistochemistry. Immununohistochemistry was performed on mouse liver and kidney sections using the CYP2C44-specific peptide. Briefly, a 1:500 dilution of the primary CYP2C44 peptide antibody was applied to the sections for 30 min, after the sections had been microwave-treated, cooled, and blocked with normal rabbit serum. Negative controls contained preimmune sera. The bound antibody was visualized by avidin-biotin-peroxidase detection, using a Vectastain Rabbit Elite Kit (Vector Laboratories, Burlingame, CA), following the manufacturer's protocol. Harris hematoxylin was used as the counterstain, and sections were coverslipped with Permount (Fisher, Springfield, NJ). To validate the specificity of the antibody, the specific CYP2C44 peptide (reconstituted to 100 µg/ml), was diluted to 50- or 100-fold and incubated with the antibody overnight at 4°C for maximum binding. The following day, the immunohistochemistry procedure was conducted as described above.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Cloning of Mouse CYP2C44 cDNA. A new full-length member of the mouse CYP2C subfamily was first identified from a murine EST database. The sequences were assembled and a full-length cDNA was cloned by PCR from reverse-transcribed RNA from a C57/BL6 mouse kidney. The amino acid sequence of the new form, aligned with the previously published mouse CYP2Cs, is shown in Fig. 1. The amino acid sequence is a 493-residue sequence that contains a putative heme-binding domain with conserved residues between 432 and 441 and an invariant cysteine at position 438. This polypeptide contains structural features associated with other P450s, including a hydrophobic N-terminal leader and a proline-rich region between residues 33 and 40. Like CYP2C23 (Holla et al., 1999Go), CYP2C44 contains a few extra amino acids at the N-terminus (MELL) with a glutamic acid next to the N-terminal methionine. A comparison of the deduced amino acid sequence of this new cDNA with that of known mouse CYP2Cs and rat CYP2C23 is shown in Fig. 1. CYP2C44 has the lowest sequence homology of all the mouse CYP2Cs, with the closest identity to CYP2C29 (60%) and CYP2C37 (60%) (Table 2).



View larger version (94K):
[in this window]
[in a new window]
 
Fig. 1. Alignment of deduced murine CYP2C (mouse CYP29, 2C37, 2C38, 2C39, 2C40) and rat CYP2C23 cDNA sequences with the CYP2C44 sequence. Consensus amino acids in the corresponding column are indicated by a dark shading as well an asterisk ({star}). If the amino acid sequence is not identical but similar residues form a consensus column, a light gray background is used. Closed circles mark termination codons of CYP2C sequences. The alignment of CYP2C44 amino acid sequences was performed with version 3.21 of BOXSHADE software (http://searchlauncher.bcm.tmc.edu/multialign/multi-align.html).

 

View this table:
[in this window]
[in a new window]
 
TABLE 2 Amino acid identity among the mouse CYP2C subfamily members

 

Distribution of CYP2C44 by Protein Immunoblotting. Western blotting with a peptide antibody that differentiates CYP2C44 from the known mouse CYP2Cs (Luo et al., 1998Go) as well as several new CYP2Cs (Wang et al., 2004Go; Y. Zhao, J. A. Goldstein, and D. C. Zeldin, unpublished data) is shown in Fig. 2A. This antibody detects a single protein band at 55 kDa with recombinant CYP2C44, but does not crossreact with recombinant CYP2C29, CYP2C38, CYP2C39, CYP2C40, CYP2C50, CYP2C54, and CYP2C70. In Fig. 2B, the immunoblot detects an ~52 kDa band in male and female liver microsomes (lane 1 and lane 2). A slight difference in the mobility of the recombinant CYP2C44 and the protein in liver microsomes is due to the alteration in the N terminus of the recombinant protein. Similar effects of the N terminus on mobility have been noted for other recombinant CYP2Cs in our laboratory (Tsao et al., 2000Go). In extrahepatic tissues, this 52-kDa band was detected in female kidney as well as male and female adrenal, although levels were considerably lower than those observed in liver. Female kidneys and adrenals contained higher levels of CYP2C44 than those of males. CYP2C44 could not be detected in a number of other extrahepatic tissues examined, including lung, heart, brain, aorta, skin, eye, colon, testis, epididymis, seminal vesicles, ovary, uterus, and cervix (data not shown). Hepatic content of CYP2C44 protein was not increased by treatment with prototypical cytochrome P450 inducers PB or PCN (data not shown). Moreover, administration of salt in the drinking water did not affect levels of CYP2C44 protein in liver or kidney under the regimen tested (data not shown).



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 2. Specificity of the CYP2C44 peptide antibody. A, partially purified proteins for 10 known mouse CYP2Cs purified in our laboratories (Luo et al., 1998Go; Nelson et al., 2004Go; Wang et al., 2004Go) (0.1 pmol/lane) were electrophoresed on SDS-10% polyacrylamide gel, transferred to nitrocellulose, and immunoblotted with the anti-CYP2C44 antibody as described under Materials and Methods. The CYP2C44 peptide antibody is specific for CYP2C44. B, microsomal fractions prepared from male and female mouse liver (10 µg/lane) and extrahepatic tissues (50 µg/lane): kidney, heart, brain, adrenal, and aorta, were electrophoresed on 10% SDS-polyacrylamide gel, and resolved proteins were transferred to nitrocellulose membranes. The membrane was immunoblotted using mouse CYP2C44 peptide antibody as described under Materials and Methods and visualized using SuperSignal West Pico Chemiluminescent Substrate and a SynGene GeneGnome chemiluminescence detection system. A specific CYP2C44 band with the appropriate mobility was detected in liver >> female kidney >> female adrenal >> male adrenal >> male kidney.

 

Real-Time PCR. Real-time PCR was used to determine the relative mRNA levels of CYP2C44 in both male and female C57/BL6 mice. The mRNA content of CYP2C44 PCR products was normalized to {beta}-actin and then normalized to female small intestine, for which CYP2C44 mRNA was in low abundance. Male and female liver CYP2C44 mRNA content was 2.5 x 105 higher than female small intestine mRNA content (Fig. 3). CYP2C44 mRNA content in female kidney was 0.18 x 105 higher than in female small intestine, and approximately 10-fold lower than in liver. CYP2C44 mRNA content of male kidney was lower than that in female kidney (0.008 x 103-fold higher than female small intestine). CYP2C44 mRNA content in female adrenals was higher than that of male adrenals, with values that were 12 x 103 and 3 x 103 greater than that of female small intestine. All other tissues (lung, heart, brain, aorta, skin, eye, colon, testis, epididymis, seminal vesicle, ovary, uterus, and cervix) showed undetectable levels of CYP2C44 mRNA.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 3. Detection of CYP2C44 mRNA expression in mouse tissues by real-time PCR. Total RNA (200 ng) was used in the real-time PCR assay reaction as described under Materials and Methods. A standard curve was made for each primer pair developed from a dilution of the cDNA products. The PCR products were quantified using the linear range of the standard curve. {beta}-Actin was used as an internal control to normalize all unknown sample values. Melting curves produced a single prominent product, further verified by agarose gel electrophoresis. The mRNA levels of both male and female CYP2C44 PCR products were normalized to {beta}-actin and then normalized to female small intestine, with mRNA showing low but detectable amounts of CYP2C44. Fold abundance indicates the amount of gene detected when comparing with small intestine. The inset shows female and male liver RNA for comparison. Values represent means ± S.E.

 

Metabolism of AA and LA by CYP2C44. The CYP2Cs have previously been shown to produce specific arachidonic acid metabolites (Luo et al., 1998Go; Tsao et al., 2000Go, 2001Go; Wang et al., 2004Go). In this study, recombinant CYP2C44 cDNA was expressed in E. coli at levels of 1.7 to 3.3 nmol/P450 per liter of bacterial culture and partially purified as described under Materials and Methods. After reconstitution with POR, recombinant CYP2C44 metabolized arachidonic acid primarily to EETs with lesser amounts of {omega}-terminal HETEs and mid-chain HETEs (Fig. 4). Specifically, CYP2C44 produced 11,12-EET (45% of total) as well as 8,9-EET (23% of total) and 14,15-EET (14% of total) (Table 3). EETs were produced in a highly stereospecific fashion with 11R,12S-EET (94% optical purity) and 8R,9S-EET (95% optical purity) being the predominant enantiomers. The catalytic turnover number for arachidonic acid was 0.92 nmol/min/nmol P450. Linoleic acid was also metabolized by CYP2C44 to 39% E0As and 61% HODEs. The catalytic number for linoleic acid was 0.15 nmol/nmol/P450.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4. Reverse-phase HPLC chromatograms of products formed from recombinant CYP2C44 with radiolabeled AA (top) and linoleic acid (bottom). Recombinant CYP2C44 was reconstituted with phospholipids and POR as described under Materials and Methods and incubated with radiolabeled AA or linoleic acid. EET and HETE metabolites were identified by coelution with authentic standards as indicated by the bars above the respective peaks. EOAs and HODEs were also identified by coelution with authentic standards as indicated by the bars above the respective peaks. Ordinate, radioactivity (cpm); abscissa, time (min). Results are representative of four different experiments.

 

View this table:
[in this window]
[in a new window]
 
TABLE 3 Regiochemistry and stereochemistry of arachidonic acid metabolites produced by CYP2C44 Recombinant, partially purified CYP2C44 was reconstituted with cytochrome P450 reductase and phospholipids, and incubated with [1-14C]AA as described under Materials and Methods. The regiochemical distribution of EETs and HETEs was quantified by HPLC and liquid scintillation as described under Materials and Methods. Values were representative of four separate experiments.

 

Tolbutamide Metabolism. Tolbutamide is a prototypical drug substrate that is metabolized by all of the human CYP2Cs (Goldstein and de Morais, 1994Go). Therefore, we examined the ability of the mouse CYP2Cs to metabolize this substrate. Partially purified recombinant CYP2C29, CYP2C37, CYP2C38, CYP2C39, CYP2C40, and CYP2C44 were reconstituted with POR and incubated with 1 mM [ring-U-14C]tolbutamide (8 mCi/mmol) as described under Materials and Methods, and turnover numbers are shown in Table 4. CYP2C44 demonstrated no activity toward tolbutamide. In contrast, mouse CYP2C29, CYP2C38, and CYP2C39 exhibited tolbutamide hydroxylase activity with turnover numbers of 1.25 ± 0.02, 0.95 ± 0.13, and 0.74 ± 0.05 nmol/min/nmol P450, respectively, compared with that of human CYP2C9, which had a turnover number of 4.39 ± 0.02 nmol/min/nmol P450.


View this table:
[in this window]
[in a new window]
 
TABLE 4 Tolbutamide metabolism by the recombinant mouse CYP2Cs Recombinant mouse P450 proteins were expressed in E. coli and partially purified as described under Materials and Methods. The purified proteins were reconstituted with phospholipids, and tolbutamide metabolism ([ring-U-14C]tolbutamide) was measured as described under Materials and Methods. Detection limit for the assay was <0.5 nmol/min/nmol P450. Values represent the means ± S.E. of three samples. The turnover number for CYP2C9 is 4.39 ± 0.023 nmol/min/nmol P450.

 

Immunohistochemistry. Sections of formalin-fixed, paraffin-embedded liver, kidney, and adrenals from C57BL/6 mice were immunostained using a specific CYP2C44 peptide antibody. Figure 5A shows a representative liver section detecting cytoplasmic staining of hepatocytes, as well as staining in bile duct epithelial cells. The inset shows a representative negative control. In peptide inhibition studies, (Fig. 5B), the staining in the liver is completely blocked with the addition of the CYP2C44-specific peptide, indicating that the staining is specific for CYP2C44. In a representative kidney section (Fig. 5C), staining is seen in the proximal tubules at the corticomedullary junction, which was appreciably blocked by the addition of the CYP2C44 peptide, indicating that most of this staining represents CYP2C44 (Fig. 5D). Staining was also observed in the arterial walls of the kidney which disappears when the antibody is preincubated with the specific peptide. Much less staining was observed in the collecting ducts. Bowman's capsule, endothelial cells, and the glomeruli of the kidney were negative.



View larger version (156K):
[in this window]
[in a new window]
 
Fig. 5. Immunohistochemical staining of CYP2Cs. A, immunohistochemical analysis shows a representative mouse liver section showing strong cytoplasmic staining in the hepatocytes as well as cells lining the bile duct (20x). The inset demonstrates a representative negative liver control incubated with preimmune sera (20x). The arrow in A points to the hepatobiliary cells. B, staining in the liver and bile acid secretions is completely blocked with peptide inhibition, thereby demonstrating high specificity of this antibody in the liver tissue (20x). C, immunohistochemical analysis of a representative mouse kidney section showing cytoplasmic staining in the proximal tubules at the corticomedullary junction (20x). The inset demonstrates a representative negative kidney control incubated with preimmune sera (20x). The scale is shown by a dark line indicating 1 µm is 0.05 mm. D, staining in the proximal tubules is significantly blocked by incubation with the CYP2C44 peptide, indicating that CYP2C44-specific immunostaining occurs in these tissues. (20x).

 


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, we isolated and characterized a cDNA for a new mouse P450, CYP2C44, from mouse kidney. CYP2C44 is the least homologous to other known mouse CYP2C proteins, but highly (84%) homologous to rat kidney CYP2C23. Like CYP2C23 (Holla et al., 1999Go), CYP2C44 contains a few extra amino acids at the N terminus (MELL), with a glutamic acid next to the N-terminal methionine. In contrast, the amino acid identity of the newly cloned CYP2C44 to mouse CYP2Cs ranged from 60% (for CYP2C29) to 52% (for CYP2C40) (Table 2). From the mouse genomic database in the Celera Discovery System, we determined that the 5 known mouse Cyp2c genes, 10 new Cyp2c genes, and 4 Cyp2c pseudogenes are all located in a 1.5-megabase cluster on chromosome 19, except for Cyp2c44 which is located ~3.8 megabases downstream on this chromosome (Nelson et al., 2004Go). The remote location of the Cyp2c44 from the man cluster of Cyp2c genes would result in a decreased chance of crossover, which presumably accounts for the lower homology of this gene to the other CYP2C genes. Four of the new P450 enzymes have been recently cloned and characterized in our laboratories (Wang et al., 2004Go).

CYP2C44 metabolized arachidonic acid primarily to EETs (77%) and a smaller proportion of HETEs (23%) with a turnover number of 0.92 nmol/min/nmol P450. This compares with other murine CYP2Cs, with the turnover numbers for CYP2C29, CYP2C37, CYP2C38, CYP2C39, CYP2C40, CYP2C50, CYP2C54, and CYP2C55 at 0.34, 1.1, 5.2, 0.15, 0.7, 1.0, and 1.2 nmol/min/nmol P450, respectively (Luo et al., 1998Go; Wang et al., 2004Go). The principal arachidonic metabolite produced by CYP2C44 was 11R,12S-EET. Rat CYP2C23, which is highly homologous to CYP2C44, has been found to be the predominant CYP2C in rat kidney and is also active in the metabolism of AA to 11R,12S-EET (Katoh et al., 1991Go; Karara et al., 1993Go; Holla et al., 1999Go), as well as 14S,15R-EET (Capdevila et al., 1991Go). The 11R,12S metabolites produced by CYP2C23 were found to be the predominant EET enantiomers produced by rat kidney microsomes (Capdevila et al., 1991Go).

Imig et al. (1996aGo) found that 11,12-EET increased the diameters of interlobular and afferent arterioles preconstricted with epinephrine in in vitro blood-perfused juxtamedullary nephron preparations. This response was found to be highly stereoselective for the 11R,12S-EETs; indeed, 11S,12R-EETs did not increase vessel size. 14,15-EET was found to have a lesser effect and 8,9-EET did not increase the diameter of these vessels. This effect appears to involve activation of Ca2+-activated K+ channels. Renal CYP2C23 is up-regulated by dietary salt intake in some strains of rat (Holla et al., 1999Go). This up-regulation is thought to be an important compensatory mechanism in response to dietary salt intake, producing vasodilation and inhibiting the reabsorption of sodium by the proximal tubules. Importantly, inhibition of P450 leads to salt-induced hypertension in rats (Makita et al., 1994Go; Holla et al., 1999Go).

Immunostaining studies showed that CYP2C44 is found in proximal tubules of mouse kidney. Immunochemical localization indicated immunostaining of the proximal tubules and arterial walls of the kidney, but not Bowman's capsule, with much less staining of the collecting ducts. This immunostaining was significantly inhibited by a CYP2C44-specific peptide indicating the specificity of this method. Although CYP2C44 was not up-regulated by dietary salt under the limited set of conditions used in the current study, its localization in mouse proximal tubules and arterial walls is consistent with a possible role of CYP2C44 in vasodilation and sodium transport in the kidney.

Other P450 subfamilies are also found in rodent kidney. The CYP4A family is expressed in kidney and is found in the renal vasculature (Marji et al., 2002Go). The CYP4A family (e.g., CYP4A2, CYP4A2, CYPA3, and CYP4A4) produces predominantly 20-HETE, although some members (CYP4A2, and CYP4A3) also produce smaller amounts of 11,12-EET (Nguyen et al., 1999Go). 20-HETE has been found to be the major AA metabolite in mouse kidney (Honeck et al., 2000Go). Nguyen et al. (1999Go) have suggested that 11,12-EET and 20-HETE have important biologically opposing roles in vasodilation and constriction in the kidney. CYP2J5 is another murine P450 that is also found in renal proximal tubules and collecting ducts of the mouse, and it metabolizes AA to 8,9-, 11,12-, and 1 4,15-EET as ell as 11-HETE (Ma et al., 1999Go).

The extrahepatic distribution of the CYP2C44 enzyme differs from that of other CYP2Cs in the mouse. CYP2C40 was found to be abundant in colon and intestine (Tsao et al., 2000Go). CYP2C29 mRNA was found in a variety of extrahepatic tissues including lung (Luo et al., 1998Go; Tsao et al., 2001Go). CYP2C50, originally identified from a partial clone from heart (Tsao et al., 2001Go), has recently been cloned and the protein detected in the heart as well as the liver (Wang et al., 2004Go). In contrast, CYP2C44 was not detected in colon, small intestine, lung, or heart. There was a sex difference in the extrahepatic distribution of CYP2C44. We have previously reported an abundance of CYP2Cs in female adrenals, particularly in the X-zone, which is present in females but disappears after approximately 9 weeks of age. However, this staining in the X-zone apparently does not represent CYP2C44, since histochemical analysis of the adrenals for CYP2C44 showed none in the X-zone (data not shown).

Immunoblotting and real-time PCR indicated that CYP2C44 was more abundant in liver than in extrahepatic tissues. EETs are known to be endogenous constituents of rat liver (Yoshida et al., 1990Go). EETs have been shown to be important in glycogenolysis in the liver, probably as a consequence of increasing cytosolic calcium and activation of phosphorylase A. Although 14,15-EET was the most active, 11,12-EET also activated phosphorylase A. The stereoselectivity of this effect was not examined. The intense immunostaining of CYP2C44 in the epithelial cells of the bile duct is noteworthy. Ion transport is regulated by specific transporters found in tissues such as kidney and liver. Although effects of EETs on hepatic transport have not been investigated, EETs might conceivably affect transporters in the bile duct, such as the bile acid export pump (BSEP), which transports bile acids (Kullack-Ublick and Becker, 2003Go).

The rate of turnover for CYP2C44 for linoleic acid was low (0.15 nmol/min/nmol P450) compared with that of arachidonic acid (0.92 nmol/min/nmol P450). CYP2C44 metabolized linoleic acid principally to HODEs as major metabolites (61%) and EOAs as minor metabolites (39%). Although the action of HODEs and EOAs has received little study, 9,10-EOA is a hepatic toxin (Ozawa et al., 1986Go), and 9,10-EOA and 12,13-EOA have been associated with death due to severe burns (Kosaka et al., 1994Go).

Unlike mouse CYP2C29, CYP2C44 did not metabolize tolbutamide, a common substrate of the human CYP2Cs (Goldstein and de Morais, 1994Go). In addition, immunoblotting indicated that CYP2C44 was not induced by prototypical P450 inducers such as PB and PCN, although we have recently shown that CYP2C29 and CYP2B10 was induced by this dose of phenobarbital (Jackson et al., 2004Go). Thus, we hypothesize that CYP2C44 may not have a classical role in drug metabolism, but rather may have endogenous functions.

We report the cloning and characterization of a new mouse CYP2C that is found in liver, as well as the extrahepatic tissues, that metabolizes arachidonic acid to the stereospecific products 11R,12S-EETs and 8R,9S-EETs. The unique stereospecificity of this enzyme for 11R,12S-EET, its homology to rat CYP2C23, and its presence in liver and kidney suggests the possibility that it may have unique physiological roles in vasodilation and transport in these tissues. Additional studies will be required to establish its physiological role.


    Acknowledgements
 
We are grateful for the expert advice of Dr. Robert Maronpot of the Experimental Pathology Branch, National Institute of Environmental Health Sciences, in evaluating the immunohistochemical localization of CYP2C44 in sections of liver, kidney, and other tissues.


    Footnotes
 
Article, publication date, and citation information can be found at http://jpet.aspetjournals.org.

doi:10.1124/jpet.104.067819.

ABBREVIATIONS: P450, cytochrome P450; AA, arachidonic acid; POR, NADPH-cytochrome P450 oxidoreductase; EET, cis-epoxyeicosatrienoic acid; EST, expressed sequence tag; PCR, polymerase chain reaction; HETE, hydroxyeicosatetraenoic acid; PB, phenobarbital; HPLC, high-performance liquid chromatography; PCN, pregnenolone-16{alpha}-carbonitrile; HODE, hydroxyoctadecadienoic acid; EOA, epoxyoctadecenoic acid; LA, linoleic acid.

Address correspondence to: Dr. Joyce Goldstein, National Institute of Environmental Health Sciences, P.O. Box 12233, 111 T.W. Alexander Drive, Building 101, Research Triangle Park, NC 27709. E-mail: goldste1{at}niehs.nih.gov


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

Barnes HJ (1996) Maximizing expression of eukaryotic cytochrome P450s in Escherichia coli. Methods Enzymol 272: 3-14.[CrossRef][Medline]

Barnes HJ, Arlotto MP, and Waterman MR (1991) Expression and enzymatic activity of recombinant cytochrome P450 17 alpha-hydroxylase in Escherichia coli. Proc Natl Acad Sci USA 88: 5597-5601.[Abstract/Free Full Text]

Blaisdell J, Mohrenweiser H, Jackson J, Ferguson S, Coulter S, Chanas B, Xi T, Ghanayem B, and Goldstein JA (2002) Identification and functional characterization of new potentially defective alleles of human CYP2C19. Pharmacogenetics 12: 703-711.[CrossRef][Medline]

Campbell WB, Gebremedhin D, Pratt PF, and Harder DR (1996) Identification of epoxyeicosatrienoic acids as endothelium-derived hyperpolarizing factors. Circ Res 78: 415-423.[Abstract/Free Full Text]

Capdevila JH, Dishman E, Karara A, and Falck JR (1991) Cytochrome P450 arachidonic acid epoxygenase: stereochemical characterization of epoxyeicosatrienoic acids. Methods Enzymol 206: 441-453.[Medline]

Daikh BE, Lasker JM, Raucy JL, and Koop DR (1994) Regio- and stereoselective epoxidation of arachidonic acid by human cytochromes P450 2C8 and 2C9. J Pharmacol Exp Ther 271: 1427-1433.[Abstract/Free Full Text]

de Morais SM, Wilkinson GR, Blaisdell J, Meyer UA, Nakamura K, and Goldstein JA (1994) Identification of a new genetic defect responsible for the polymorphism of (S)-mephenytoin metabolism in Japanese. Mol Pharmacol 46: 594-598.[Abstract]

de Waziers I, Cugnenc PH, Yang CS, Leroux JP, and Beaune PH (1990) Cytochrome P 450 isoenzymes, epoxide hydrolase and glutathione transferases in rat and human hepatic and extrahepatic tissues. J Pharmacol Exp Ther 253: 387-394.[Abstract/Free Full Text]

Dey A, Jones JE, and Nebert DW (1999) Tissue- and cell type-specific expression of cytochrome P450 1A1 and cytochrome P450 1A2 mRNA in the mouse localized in situ hybridization. Biochem Pharmacol 58: 525-537.[CrossRef][Medline]

Fasco MJ, Silkworth JB, Dunbar DA, and Kaminsky LS (1993) Rat small intestinal cytochromes P450 probed by warfarin metabolism. Mol Pharmacol 43: 226-233.[Abstract]

Goldstein JA and de Morais SM (1994) Biochemistry and molecular biology of the human CYP2C subfamily. Pharmacogenetics 4: 285-299.[Medline]

Hammonds TD, Blair IA, Falck JR, and Capdevila JH (1989) Resolution of epoxyeicosatrienoate enantiomers by chiral phase chromatography. Anal Biochem 182: 300-303.[CrossRef][Medline]

Holla VR, Makita K, Zaphiropoulos PG, and Capdevila JH (1999) The kidney cytochrome P-450 2C23 arachidonic acid epoxygenase is upregulated during dietary salt loading. J Clin Investig 104: 751-760.[Medline]

Honeck H, Gross V, Erdmann B, Kargel E, Neunaber R, Milia AF, Schneider W, Luft FC, and Schunck WH (2000) Cytochrome P450-dependent renal arachidonic acid metabolism in desoxycorticosterone acetate-salt hypertensive mice. Hypertension 36: 610-616.[Abstract/Free Full Text]

Imig JD, Navar LG, Roman RJ, Reddy KK, and Falck JR (1996a) Actions of epoxygenase metabolites on the preglomerular vasculature. J Am Soc Nephrol 7: 2364-2370.[Abstract]

Imig JD, Zou AP, Stec DE, Harder DR, Falck JR, and Roman RJ (1996b) Formation and actions of 20-hydroxyeicosatetraenoic acid in rat renal arterioles. Am J Physiol 270: R217-R227.

Jackson J, Ferguson S, Moore R, Negishi M, and Goldstein J (2004) The nuclear receptor CAR regulates phenytoin induction of Cyp2c29. Mol Pharmacol, in press.

Karara A, Makita K, Jacobson HR, Falck JR, Guengerich FP, DuBois RN, and Capdevila JH (1993) Molecular cloning, expression and enzymatic characterization of the rat kidney cytochrome P-450 arachidonic acid epoxygenase. J Biol Chem 268: 13565-13570.[Abstract/Free Full Text]

Katoh T, Takahashi K, Capdevila J, Karara A, Falck JR, Jacobson HR, and Badr KF (1991) Glomerular stereospecific synthesis and hemodynamic actions of 8,9-epoxyeicosatrienoic acid in rat kidney. Am J Physiol 261: F578-F586.

Kosaka K, Suzuki K, Hayakawa M, Sugiyama S, and Ozawa T (1994) Leukotoxin, a linoleate epoxide: its implication in the late death of patients with extensive burns. Mol Cell Biochem 139: 141-148.[CrossRef][Medline]

Kullack-Ublick GA and Becker MB (2003) Regulation of drug and bile salt transporters in liver and intestine. Drug Metab Rev 35: 305-313.[CrossRef][Medline]

Leemann TD, Transon C, Bonnabry P, and Dayer P (1993) A major role for cytochrome P450TB (CYP2C subfamily) in the actions of non-steroidal antiinflammatory drugs. Drugs Exp Clin Res 19: 189-195.[Medline]

Legraverend C, Eguchi H, Strom A, Lahuna O, Mode A, Tollet P, Westin S, and Gustafsson JA (1994) Transactivation of the rat CYP2C13 gene promoter involves HNF-1, HNF-3 and members of the orphan receptor subfamily. Biochemistry 33: 9889-9897.[CrossRef][Medline]

Luo G, Zeldin DC, Blaisdell JA, Hodgson E, and Goldstein JA (1998) Cloning and expression of murine CYP2Cs and their ability to metabolize arachidonic acid. Arch Biochem Biophys 357: 45-57.[CrossRef][Medline]

Ma J, Qu W, Scarborough PE, Tomer KB, Moomaw CR, Maronpot R, Davis LS, Breyer MD, and Zeldin DC (1999) Molecular cloning, enzymatic characterization, developmental expression and cellular localization of a mouse cytochrome P450 highly expressed in kidney. J Biol Chem 274: 17777-17788.[Abstract/Free Full Text]

Makita K, Takahashi K, Karara A, Jacobson HR, Falck JR, and Capdevila JH (1994) Experimental and/or genetically controlled alterations of the renal microsomal cytochrome P450 epoxygenase induce hypertension in rats fed a high salt diet. J Clin Investig 94: 2414-2420.

Marji JS, Wang MH, and Laniado-Schwartzman M (2002) Cytochrome P-450 4A isoform expression and 20-HETE synthesis in renal preglomerular arteries. Am J Physiol 283: F60-F67.

Matsunaga T, Watanabe K, Yamamoto I, Negishi M, Gonzalez FJ, and Yoshimura H (1994) cDNA cloning and sequence of CYP2C29 encoding P-450 MUT-2, a microsomal aldehyde oxygenase. Biochim Biophys Acta 1184: 299-301.[Medline]

Murray GI, Barnes TS, Sewell HF, Ewen SW, Melvin WT, and Burke MD (1988) The immunocytochemical localisation and distribution of cytochrome P-450 in normal human hepatic and extrahepatic tissues with a monoclonal antibody to human cytochrome P-450. Br J Clin Pharmacol 25: 465-475.[Medline]

Nelson DR, Koymans L, Kamataki T, Stegeman JJ, Feyereisen R, Waxman DJ, Waterman MR, Gotoh O, Coon MJ, Estabrook RW, et al. (1996) P450 superfamily: update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics 6: 1-42.[Medline]

Nelson DR, Zeldin DC, Hoffman SM, Maltais LJ, Wain HM, and Nebert DW (2004) Comparison of cytochrome P450 (CYP) genes from the mouse and human genomes, including nomenclature recommendations for genes, pseudogenes and alternativesplice variants. Pharmacogenetics 14: 1-18.[CrossRef][Medline]

Nguyen X, Wang MH, Reddy KM, Falck JR, and Schwartzman ML (1999) Kinetic profile of the rat CYP4A isoforms: arachidonic acid metabolism and isoform-specific inhibitors. Am J Physiol 276: R1691-R1700.

Omura T and Sato R (1964) The carbon monoxide-binding pigment of liver microsomes I. Evidence for its hemoprotein nature. J Biol Chem 239: 2370-2378.[Free Full Text]

Ozawa T, Hayakawa M, Takamura T, Sugiyama S, Suzuki K, Iwata M, Taki F, and Tomita T (1986) Biosynthesis of leukotoxin, 9,10-epoxy-12 octadecenoate, by leukocytes in lung lavages of rat after exposure to hyperoxia. Biochem Biophys Res Commun 134: 1071-1078.[CrossRef][Medline]

Peters WH and Kremers PG (1989) Cytochromes P-450 in the intestinal mucosa of man. Biochem Pharmacol 38: 1535-1538.[CrossRef][Medline]

Rettie AE, Korzekwa KR, Kunze KL, Lawrence RF, Eddy AC, Aoyama T, Gelboin HV, Gonzalez FJ, and Trager WF (1992) Hydroxylation of warfarin by human cDNA-expressed cytochrome P-450: a role for P-4502C9 in the etiology of (S)-warfarin-drug interactions. Chem Res Toxicol 5: 54-59.[CrossRef][Medline]

Rich KJ, Sesardic D, Foster JR, Davies DS, and Boobis AR (1989) Immunohistochemical localization of cytochrome P450b/e in hepatic and extrahepatic tissues of the rat. Biochem Pharmacol 38: 3305-3322.[CrossRef][Medline]

Shimizu M, Lasker JM, Tsutsumi M, and Lieber CS (1990) Immunohistochemical localization of ethanol-inducible P450IIE1 in the rat alimentary tract. Gastroenterology 99: 1044-1053.[Medline]

Strom A, Eguchi H, Mode A, Legraverend C, Tollet P, Stromstedt PE, and Gustafsson JA (1994) Characterization of the proximal promoter and two silencer elements in the CYP2C11 gene expressed in rat liver. DNA Cell Biol 13: 805-819.[Medline]

Tsao CC, Coulter SJ, Chien A, Luo G, Clayton NP, Maronpot R, Goldstein JA, and Zeldin DC (2001) Identification and localization of five CYP2Cs in murine extrahepatic tissues and their metabolism of arachidonic acid to regio- and stereoselective products. J Pharmacol Exp Ther 299: 39-47.[Abstract/Free Full Text]

Tsao CC, Foley J, Coulter SJ, Maronpot R, Zeldin DC, and Goldstein JA (2000) CYP2C40, a unique arachidonic acid 16-hydroxylase, is the major CYP2C in murine intestinal tract. Mol Pharmacol 58: 279-287.[Abstract/Free Full Text]

Veronese ME, Mackenzie PI, Doecke CJ, McManus ME, Miners JO, and Birkett DJ (1991) Tolbutamide and phenytoin hydroxylations by cDNA-expressed human liver cytochrome P4502C9 [published erratum appears in Biochem Biophys Res Commun 1991 Nov 14;180(3):1527]. Biochem Biophys Res Commun 175: 1112-1118.[CrossRef][Medline]

Wang H, Zhao Y, Bradbury J, Graves J, Foley J, Blaisdell J, Goldstein J, and Zeldin D (2004) Cloning, expression, and characterization of three new mouse cytochrome P450 enzymes and partial characterization of their fatty acid oxidation activities. Mol Pharmacol 65: 1148-1158.[Abstract/Free Full Text]

Yoshida S, Hirai A, and Tamura Y (1990) Possible involvement of arachidonic acid metabolites of cytochrome P450 monooxygenase pathway in vasopressin-stimulated glycogenolysis in isolated rat hepatocytes. Arch Biochem Biophys 280: 346-351.[CrossRef][Medline]

Zeldin DC (2001) Epoxygenase pathways of arachidonic acid metabolism. J Biol Chem 276: 36059-36062.[Free Full Text]

Zeldin DC, Foley J, Goldsworthy SM, Cook ME, Boyle JE, Ma J, Moomaw CR, Tomer KB, Steenbergen C, and Wu S (1997) CYP2J subfamily cytochrome P450s in the gastrointestinal tract: expression, localization and potential functional significance. Mol Pharmacol 51: 931-943.[Abstract/Free Full Text]

Zhang QY, Raner G, Ding X, Dunbar D, Coon MJ, and Kaminsky LS (1998) Characterization of the cytochrome P450 CYP2J4: expression in rat small intestine and role in retinoic acid biotransformation from retinal. Arch Biochem Biophys 353: 257-264.[CrossRef][Medline]


This article has been cited by other articles:


Home page
FASEB J.Home page
R. A. B. van Waterschoot, R. W. Rooswinkel, E. Wagenaar, C. M. M. van der Kruijssen, A. E. van Herwaarden, and A. H. Schinkel
Intestinal cytochrome P450 3A plays an important role in the regulation of detoxifying systems in the liver
FASEB J, January 1, 2009; 23(1): 224 - 231.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. D. Finn, L. A. McLaughlin, S. Ronseaux, I. Rosewell, J. B. Houston, C. J. Henderson, and C. R. Wolf
Defining the in Vivo Role for Cytochrome b5 in Cytochrome P450 Function through the Conditional Hepatic Deletion of Microsomal Cytochrome b5
J. Biol. Chem., November 14, 2008; 283(46): 31385 - 31393.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
E. M. Awumey, S. K. Hill, D. I. Diz, and R. D. Bukoski
Cytochrome P-450 metabolites of 2-arachidonoylglycerol play a role in Ca2+-induced relaxation of rat mesenteric arteries
Am J Physiol Heart Circ Physiol, May 1, 2008; 294(5): H2363 - H2370.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
R. A. B. van Waterschoot, A. E. van Herwaarden, J. S. Lagas, R. W. Sparidans, E. Wagenaar, C. M. M. van der Kruijssen, J. A. Goldstein, D. C. Zeldin, J. H. Beijnen, and A. H. Schinkel
Midazolam Metabolism in Cytochrome P450 3A Knockout Mice Can Be Attributed to Up-Regulated CYP2C Enzymes
Mol. Pharmacol., March 1, 2008; 73(3): 1029 - 1036.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Pozzi, M. R. Ibanez, A. E. Gatica, S. Yang, S. Wei, S. Mei, J. R. Falck, and J. H. Capdevila
Peroxisomal Proliferator-activated Receptor-{alpha}-dependent Inhibition of Endothelial Cell Proliferation and Tumorigenesis
J. Biol. Chem., June 15, 2007; 282(24): 17685 - 17695.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
J. P. Jackson, S. S. Ferguson, M. Negishi, and J. A. Goldstein
Phenytoin Induction of the Cyp2c37 Gene Is Mediated by the Constitutive Androstane Receptor
Drug Metab. Dispos., December 1, 2006; 34(12): 2003 - 2010.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Pozzi, I. Macias-Perez, T. Abair, S. Wei, Y. Su, R. Zent, J. R. Falck, and J. H. Capdevila
Characterization of 5,6- and 8,9-Epoxyeicosatrienoic Acids (5,6- and 8,9-EET) as Potent in Vivo Angiogenic Lipids
J. Biol. Chem., July 22, 2005; 280(29): 27138 - 27146.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.104.067819v1
310/3/845    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by DeLozier, T. C.
Right arrow Articles by Goldstein, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by DeLozier, T. C.
Right arrow Articles by Goldstein, J. A.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition