QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: jpet.104.067850v1 310/3/1096    most recent Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Wallace, J. L. Articles by Fiorucci, S. Search for Related Content PubMed PubMed Citation Articles by Wallace, J. L. Articles by Fiorucci, S.

INFLAMMATION AND IMMUNOPHARMACOLOGY

Enhanced Anti-Inflammatory Potency of a Nitric Oxide-Releasing Derivative of Flunisolide: Role of Nuclear Factor-B

Mucosal Inflammation Research Group, University of Calgary, Calgary, Alberta, Canada (J.L.W., P.D.S.); Department of Gastroenterology and Hepatology, University of Perugia, Perugia, Italy (G.R., S.F.); and Department of Experimental Pharmacology, University of Naples, Naples, Italy (G.C.)

Received for publication March 2, 2004
Accepted May 5, 2004.

	Abstract

Top Abstract Materials and Methods Results Discussion References

 
Glucocorticoids remain among the most commonly used anti-inflammatory drugs, despite significant adverse effects. Other anti-inflammatory drugs, including aspirin, have been coupled through an ester linkage to a nitric oxide-releasing moiety, resulting in an increase in potency and a decrease in adverse effects. Prednisolone has similarly been modified, with marked improvement of its therapeutic index. In the present study, we have evaluated whether a nitric oxide-releasing derivative of another glucocorticoid, flunisolide, would increase its potency as an anti-inflammatory agent and would decrease its systemic toxicity. To evaluate anti-inflammatory potency and efficacy, the carrageenan-airpouch model in the rat was used. Flunisolide and NCX-1024 (flunisolide-21-[4'-(nitrooxymethyl) benzoate]) were compared across a range of doses, with both direct injection into the airpouch and oral administration. The ability of these agents to protect the stomach against indomethacin-induced damage also was assessed. Effects of oral administration of the two drugs on body weight gain and adrenal suppression were also evaluated. With direct application into the airpouch, NCX-1024 was found to be 41 times more potent than flunisolide in reducing leukocyte accumulation and prostaglandin E₂ generation. The increased potency may be related to an enhanced ability of NCX-1024 to prevent nuclear factor-B activation. When given orally, the two compounds exhibited similar potency. However, orally administered NCX-1024 was more potent at protecting against indomethacininduced gastric damage, caused less reduction of body weight, and, unlike flunisolide, did not cause adrenal atrophy. These studies suggest that NCX-1024 may be an attractive alternative to conventional glucocorticoids, particularly for applications involving topical administration.

In the present study, we have examined the effect of a different NO-releasing glucocorticoid to determine whether the enhanced potency observed in NO-releasing prednisolone is extendable to other members of this class of drugs. Thus, the effects of NO-releasing flunisolide (NCX-1024, flunisolide-21-[4'-(nitrooxymethyl) benzoate]) and flunisolide itself have been tested in the rat carrageenan-airpouch model. We also compared the potency of these two compounds in a model of glucocorticoid-induced protection against indomethacin-induced gastric damage. The systemic toxicity of these compounds in terms of impact on body weight and on adrenal integrity was evaluated. Moreover, we examined the possibility that differential effects on NF-B activation may underlie any observed differences in the potency of NCX-1024 versus flunisolide.

	Materials and Methods

Top Abstract Materials and Methods Results Discussion References

 
Animals. Male Wistar rats (175–200 g) were obtained from Charles River Canada (Montreal, PQ, Canada). The rats were housed in the Animal Care Service of the University of Calgary and were fed standard laboratory chow and water ad libitum. In all experiments described herein, the minimum sample size per group was five. All experimental procedures were approved by the Animal Care Committee of the University of Calgary and were in accordance with the guidelines of the Canadian Council on Animal Care.

Carrageenan-Airpouch Model. An airpouch was produced in each rat by the subcutaneous injection of 20 ml of air on the back of the rats on the first day (Edwards et al., 1981; Wallace et al., 1999). On the third day, an additional 10 ml of air was injected into the airpouch. Five days after the first injection, another 10 ml of air was injected at the same site. On the sixth day, 2 ml of either saline or a 1% (w/v) solution of carrageenan was injected into the pouch. All injections were performed under 5% (v/v) halothane anesthesia. One hour before the carrageenan injection, one of the test drugs (flunisolide or NCX-1024) at doses ranging from 0.007 to 23 µmol/kg, or the vehicle (1% dimethyl sulfoxide; DMSO), was injected directly into the airpouch (1 ml/kg). We have previously demonstrated that this amount of DMSO does not significantly affect the recruitment of leukocytes or the generation of inflammatory mediators in the airpouch (Turesin et al., 2003). The direct injection of the test drugs into the airpouch was selected as the route of administration to eliminate the possibility of different bioavailability within the airpouch if delivered via another route, which would confound direct comparisons of drug potency. However, we also performed a study in which the test drugs were given orally, at doses ranging from 0.023 to 2.3 µmol/kg, 1 h before carrageenan administration. In all studies, samples were collected 6 h after the carrageenan injection. The rats were killed by an overdose of sodium pentobarbital (MTC Pharmaceuticals, Cambridge, ON, Canada). A small incision was performed on the airpouch, and samples of the exudate were collected into sterile tubes.

The volume of the exudate was measured. An aliquot of the exudate was used to quantify the number of leukocytes using a Coulter particle counter (Beckman Coulter, Inc., Fullerton, CA). Finally, the rest of the exudate was centrifuged at 1000g for 10 min. The supernatants were also collected and stored at – 80°C for subsequent measurement of prostaglandin E₂ (PGE₂) using a specific, commercially available enzyme-linked immunosorbent assay (Turesin et al., 2003).

Protection of the Stomach from Indomethacin-Induced Damage. Glucocorticoids have previously been shown to protect the stomach from acute damage induced by indomethacin (Filaretova et al., 2002). We compared the effects of NCX-1024 and flunisolide in this regard. Rats (n = 6/group) were fasted for 18 h and then given flunisolide (0.07 or 0.23 µmol/kg), equimolar doses of NCX-1024, or vehicle orally or intraperitoneally. Two hours later, the rats were given indomethacin orally at a dose of 20 mg/kg. Three hours later, the rats were killed by an overdose of sodium pentobarbital, and the stomach was removed, opened by an incision along the greater curvature, and pinned out on a wax block. An observer unaware of the treatments the rats had received measured the lengths of any hemorrhagic erosions (in millimeters). The sum the lengths of all such lesions in a stomach was taken as the "gastric damage score" (Wallace et al., 1990).

Systemic Toxicity. Groups of five rats each were treated orally each day with flunisolide or NCX-1024 (each at a dose of 0.23 µmol/kg), or with vehicle. Body weight was recorded at the start and end of the study. Three hours after the final dose of the test drugs or vehicle, the rats were sacrificed by an overdose of sodium pentobarbital, and the adrenal glands were excised, placed in a drying oven (60°C) for 24 h, and then weighed.

Electrophoretic Mobility Shift Analysis (EMSA). Human monocytic THP-1 cells (American Type Culture Collection, Manassas, VA) were grown in RPMI 1640 medium (Invitrogen, Carlsbad, CA), with 4.5 g/l glucose, 10 mM HEPES, 1 mM sodium pyruvate, and 50 µM 2-mercaptoethanol supplemented with 10% fetal bovine serum (Equitech-Bio, Ingram, TX), were cultured under a humidified 5% CO₂ atmosphere at 37°C. After stimulation with endotoxin (from Escherichia coli 055:B5; 10 µM), alone or in combination with 1 µM of flunisolide or NCX-1024 for 18 h, the THP-1 cells were washed three times with ice-cold phosphate-buffered saline (pH 7.4), harvested, and resuspended in 0.5 ml of buffer A (20 mM HEPES, pH 7.4, 10 mM KCl, 1.5 mM MgCl₂, 0.1 mM EDTA, 1 mM dithiothreitol, and 1 mM PMSF) and a protease inhibitor cocktail (5 µg/ml aprotinin, 5 µg/ml pepstatin A, and 5 µg/ml leupeptin). After 10-min incubation on ice, 23 µl of 10% Nonidet P-40 was added and vigorously mixed for 15 s. Nuclei were separated from cytosol by centrifugation at 13,000g for 10 s. The cytosolic proteins contained in the supernatant fraction were separated from membrane by centrifugation 10' at 13,000g (Haglund and Rothblum, 1987). The pellet containing a nuclear protein fraction was resuspended in 50 µl of buffer B (20 mM HEPES, pH 7.4, 1.5 mM MgCl₂, 0.42 M NaCl, 1 mM EDTA, 1 mM dithiothreitol, 1 mM PMSF, and 10% glycerol), and the same volume of protease inhibitor cocktail (as described above). After 30 min at 4°C, the samples were centrifuged (13,000g; 30 s), and the supernatant containing the nuclear proteins was transferred to new vials. The protein concentration was measured using a protein dye reagent (Bio-Rad, Richmond, CA), with bovine serum albumin used as the standard.

Probes used for EMSAs were radiolabeled with [-³²P]ATP end labeling with T4 polynucleotide kinase. Briefly, 10 pM of doublestrand oligonucleotide CAGTTGAGGGGACTTTCCCAGGC was endlabeled with [-³²P]ATP for 60 min at room temperature before the kinase was inactivated at 95°C for 5 min. The labeled probe was purified from unincorporated nucleotides by using a QuickSpin column (G-25; Invitrogen) following the manufacturer's instructions. The specific activities of ³²P-labeled oligoprobe were measured by beta counter. For EMSAs, aliquots of nuclear extracts (the same amount of protein in each sample in a given assay) were incubated in a total volume of 20 to 25 µl of binding buffer [50 mM NaCl, 10 mM Tris, pH 7.4, 0.5 mM EDTA, 1 mM PMSF, 1 µg of poly(dI-dC), and 5% glycerol] for 20 min at room temperature with 50,000 cpm (50 fmol) of labeled probe. For competition assays, a 20-fold excess of unlabeled oligonucleotides was preincubated for 15 min before the addition of the radiolabeled probe. For antibody-mediated supershift assays, extracts were preincubated with 5 µl of NF-B subunit anti-p50 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) at room temperature for 10 min before the addition of the radiolabeled probe. The reactions were loaded on a 6% polyacrylamide nondenaturing gel in 0.5x Tris borate-EDTA, electrophoresed for2hat170V before drying (1 h at 80°C), and exposed to autoradiographic film.

COX-1 and COX-2 mRNA Expression. Experiments were performed as describe above for the EMSA measurements. After incubation with endotoxin and the test drugs for 18 h, the cells were lysed and total RNA was isolated using TRIzol reagent (Invitrogen, Milan, Italy) as described previously (Fiorucci et al., 2002b). Reverse transcription-PCR was performed using specific primers. The sense and antisense primers were obtained from Sigma Genosys (Lid, UK) and are as follows (sense primer followed by the antisense primer): -actin (540 bp), 5'-TGT GAT GGT GGG AAT GGG TCA G-3' and 5'-TTT GAT GTC ACG CAC GAT TTC C-3'; COX-1 (391 bp), 5'-TTT TTT TTC ATG TAA CAT CTT C-3' and 5'-TTA AAA CTG AAC TTG GAC CC-3'; COX-2 (420 bp), 5'-CAT GGG TGT GAA GGG AAA TAA G-3' and 5'-GGC ATA CAT CAT CAG ACC AG-3'). The cDNA was amplified with a "hot start" reaction (20 µl) containing 5 µl of cDNA product, 2 µl of PCR buffer (200 mM Tris-HCl, pH 8.4, and 500 mM KCl), 200 µM dNTPs, 1 µM each of sense and anti-sense primers, 1.5 mM MgCl₂, 1 U of Platinum Taq polymerase (Invitrogen), and water in a Hybaid PCR Sprint thermocycler (Celbio, Milan, Italy). PCR was carried out for 35 cycles (30 for amplification of -actin) as follows: 94°C for 30 s, 60°C for 15 s, and 72°C for 30 s, with a final extension at 72°C for 5 min. PCR products were separated on a 1.5% agarose gel and band intensity quantified using Kodak Digital Science ID Image Analysis Software (Kodak Co., Milan, Italy). Each assay was carried out in triplicate. The -actin primers were used as a control for both reverse transcription and the PCR reaction itself.

Materials. DMSO was obtained from Merck (Darmstadt, Germany). NCX-1024 and flunisolide were synthesized by NicOx S.A. (Sophia Antipolis, France). -Carrageenan and the endotoxin were obtained from Sigma-Aldrich (St. Louis, MO). The enzyme-linked immunosorbent assay kits for PGE₂ were obtained from Neogen (Medicorp, PQ, Canada). The protease inhibitor cocktail was obtained from Roche Molecular Biochemicals (Monza, Italy). All other chemicals and supplies were obtained from Fisher Scientific (Edmonton, AB, Canada).

Statistical Analysis. Data are expressed as the mean ± S.E.M. Comparisons among groups were made using a one-way analysis of variance followed by the Student-Newman-Keuls test. A p value of less than 5% was considered as significant.

	Results

Top Abstract Materials and Methods Results Discussion References

 
Airpouch Model. Injection of carrageenan into the airpouch resulted in accumulation of fluid and leukocytes (>90% neutrophils). As shown in Fig. 1A, there was an average of 50 to 60 million leukocytes in the pouch 6 h after carrageenan injection. Pretreatment with flunisolide, injected directly into the pouch, resulted in a dose-dependent inhibition of leukocyte accumulation. NCX-1024 also dose dependently inhibited leukocyte and fluid accumulation in the pouch in response to injection of carrageenan. As shown in Fig. 1B, NCX-1024 was 41-times more potent than flunisolide in this regard (the EC₅₀ for NCX-1024 was 3 nmol/kg, whereas that for flunisolide was 124 nmol/kg). NCX-1024 and flunisolide also dose dependently reduced leukocyte recruitment into the airpouch when the drugs were given orally (Fig. 1C). However, unlike the situation in which the drugs were given directly into the airpouch, there was no difference in the potency when the drugs were given orally.

View larger version (22K): [in this window] [in a new window]   Fig. 1. A, inhibition of carrageenan-induced leukocyte recruitment by flunisolide and NCX-1024, injected directly into the airpouch 1 h before instillation of carrageenan. Each bar represents the mean ± S.E.M. for at least five rats. **, p < 0.01 versus the vehicle-treated group. , p < 0.05 versus the corresponding flunisolide-treated group. B, dose-response curves for inhibition of carrageenan-induced leukocyte infiltration into the rat airpouch by flunisolide and NCX-1024, injected directly into the airpouch. Each point represents the mean for at least five rats. C, inhibition of carrageenan-induced leukocyte recruitment by flunisolide and NCX-1024, administered orally. ***, p < 0.001 versus the vehicle-treated group.

At doses of greater than 23 nmol/kg injected directly into the airpouch, flunisolide and NCX-1024 also produced a small, but significant reduction of fluid accumulation in the pouch, (i.e., with flunisolide and NCX-1024 at a dose of 23 nmol/kg, the mean volume of fluid was 1.89 ± 0.17 and 1.81 ± 0.13 ml, respectively, compared with 2.73 ± 0.08 ml in the vehicle-treated group). Higher doses of the test drugs did not produce any further reduction in the volume of fluid recovered from the pouch. It should be noted that the volume of the carrageenan solution injected into the airpouch was 2 ml.

Prostaglandin E₂ levels in the exudate were measured as an index of inflammatory mediator production. Both flunisolide and NCX-1024, when injected directly into the airpouch, significantly inhibited accumulation of PGE₂ in the pouch, but again, the effects of NCX-1024 were much more potent than those of flunisolide (Fig. 2). Indeed, there was a highly significant correlation (r² = 0.95; p < 0.01) between the inhibitory effects of the test drugs on exudate PGE₂ levels and their effects on exudate leukocyte numbers.

View larger version (18K): [in this window] [in a new window]   Fig. 2. Inhibition of carrageenan-induced prostaglandin E2 production by flunisolide and NCX-1024, injected directly into the airpouch 1 h before instillation of carrageenan. Each bar represents the mean ± S.E.M. for at least five rats. **, p < 0.01 versus the vehicle-treated group. , p < 0.05 versus the corresponding flunisolide-treated group.

COX Expression. Incubation of human monocyte THP-1 cells with endotoxin (LPS) resulted in a robust up-regulation of COX-2 mRNA expression but no effect on COX-1 mRNA expression (Fig. 3). Coincubation of the cells with flunisolide (1 µM) and LPS did not significant affect the up-regulation of COX-2 compared with the cells exposed only to LPS. However, coincubation with NCX-1024 (1 µM) and LPS led to a significantly lower up-regulation of COX-2 than was seen with LPS alone.

View larger version (28K): [in this window] [in a new window]   Fig. 3. Bacterial endotoxin (LPS)-induced expression of COX-1 and COX-2 mRNA in human monocytic (THP-1) cells. Top, reverse transcription-PCR for COX-1, COX-2, and -actin. The lanes represent the following conditions: lane 1, untreated cells; lane 2, LPS alone; lane 3, flunisolide (1 µM) + LPS; and lane 4, NCX-1024 + LPS. Bottom, COX-2 mRNA expression in THP-1 cells, normalized to the expression of -actin. *, p < 0.05 versus LPS alone. Each bar represents the mean of at least four experiments.

NF-B Activation. Given the differential effects of the two test drugs on airpouch inflammation and on COX-2 expression, we examined whether flunisolide or NCX-1024 modulate NF-B activation induced by LPS. As shown in Fig. 4, treatment with LPS alone induced NF-B DNA binding activity of both the p50/p50 homodimer and the p50/p65 heterodimer. This was substantially inhibited by treating cells with NCX-1024 (1 µM), whereas flunisolide (1 µM) was ineffective.

View larger version (35K): [in this window] [in a new window]   Fig. 4. Top, NCX-1024 inhibits NF-B binding to DNA. NF-B DNA binding activity was measured in nuclear lysates of THP-1 cells after 18 h of treatment with bacterial endotoxin (LPS; 10 µM) alone or in combination with flunisolide or NCX-1024 (1 µM). Treatment with LPS alone induced the specific NF-B (p50/p50 and p50/65) DNA binding activity. This induction was partially reduced by flunisolide and to a greater extent by NCX-1024. Control indicates the DNA binding in untreated cells. The specificity of binding was examined by competition with the addition of unlabeled oligonucleotides, in 20-fold excess. The same amount of protein was loaded on each lane (10 µg). The sample shown is representative of a total of four such experiments. Bottom, densitometric analysis of EMSA studies. Data are presented as the mean ± S.E.M. of four experiments, showing NF-B p50/p50 binding to DNA in the presence or absence of flunisolide or NCX-1024 (each at 1 µM). NCX-1024, but not flunisolide, significantly (*, p < 0.05) reduced NF-B binding to DNA.

Gastroprotection. Indomethacin administration resulted in the formation of hemorrhagic erosions along the crests of rugal folds in the stomach. In the vehicle-treated group, the mean damage score was 50 (Fig. 5). Oral pretreatment with flunisolide at a dose of 70 nmol/kg did not significantly affect the severity of indomethacin-induced gastric damage. However, at a dose of 230 nmol/kg, flunisolide significantly reduced the severity of indomethacin-induced damage (by 70%). Orally administered NCX-1024 markedly reduced indomethacin-induced gastric damage at both doses tested (by 80% at the lower dose). Moreover, the effects of NCX-1024 were significantly greater than those of the corresponding doses of flunisolide.

View larger version (24K): [in this window] [in a new window]   Fig. 5. Gastroprotective effects of flunisolide and NCX-1024 versus indomethacin-induced damage. Rats were orally treated with one of the test drugs or vehicle 2 h before oral administration of indomethacin at 20 mg/kg. The extent of gastric damage was scored blindly 3 h after indomethacin administration. **, p < 0.01 versus the vehicle-treated group. , p < 0.05 versus the corresponding flunisolide-treated group.

To determine whether NCX-1024 could also reduce the severity of indomethacin-induced gastric damage when administered systemically, rats were pretreated intraperitoneally with NCX-1024 (230 nmol/kg) or vehicle 2 h before oral indomethacin (20 mg/kg) administration. As with oral pretreatment, intraperitoneal pretreatment with NCX-1024 (230 nmol/kg) resulted in a profound reduction of the severity of indomethacin-induced gastric damage (mean score of 7.2 ± 2.7 versus 58.6 ± 15.5 in the vehicle-treated group; p < 0.001), significantly greater than the reduction seen with flunisolide (18.5 ± 3.1).

Systemic Toxicity. Daily oral administration of flunisolide (230 nmol/kg) for 5 days resulted in a significant decrease in body weight (40 g), whereas rats treated with vehicle gained weight (20 g) (Fig. 6). Likewise, treatment with NCX-1024 resulted in a significant decrease in body weight gain but significantly less than that seen with flunisolide.

View larger version (20K): [in this window] [in a new window]   Fig. 6. Systemic toxicity of flunisolide versus NCX-1024. Rats were treated orally each day for 5 days with flunisolide or NCX-1024 at a dose of 0.23 µmol/kg. Top, changes in body weight over the 5-day treatment period. Bottom, dry weight of adrenal glands at the end of the study. *, p < 0.05; ***, p < 0.001 versus the vehicle-treated group. , p < 0.05 versus the flunisolide-treated group.

Treatment with flunisolide resulted in a significant decrease in the dry weight of the adrenal glands. In contrast, daily treatment with NCX-1024 for 5 days did not significantly affect adrenal gland weight compared with the vehicle-treated group.

Neither flunisolide nor NCX-1024 caused detectable gastric damage when given orally (230 nmol/kg) for 5 days.

	Discussion

Top Abstract Materials and Methods Results Discussion References

 
Flunisolide is a glucocorticoid used in the treatment of airway inflammation and is administered primarily as an aerosol (nasally or orally). In the present study, we demonstrated that the anti-inflammatory potency of flunisolide could be markedly increased (40-fold) by addition, through an ester linkage, of a NO-releasing moiety. This increase in potency is consistent with previous studies in which NO-releasing derivatives of prednisolone have been examined in experimental inflammation models (Paul-Clark et al., 2000, 2002; Fiorucci et al., 2002a; Turesin et al., 2003). NCX-1024 was found to be more active in suppressing endotoxin-induced up-regulation of COX-2 mRNA expression and NF-B activation, which may contribute to the observed increase in anti-inflammatory potency. We also observed a significant reduction in systemic toxicity of the NO-releasing derivative of flunisolide versus the parent drug; thus, adrenal atrophy and the reduction of body weight gain associated with daily administration of flunisolide were substantially reduced in rats treated with NCX-1024. In studies of NO-releasing prednisolone, Paul-Clark et al. (2002) observed a significant reduction of collagen-induced arthritis associated bone and cartilage erosion in comparison with that seen in rats treated with prednisolone.

What is the mechanism underlying the increased potency of NCX-1024 versus flunisolide? Based on previous studies, it is reasonable to assume that the NO that is generated from NCX-1024 accounts for the increased potency. Paul-Clark et al. (2000) showed that an NO-releasing derivative of prednisolone exhibited substantially increased anti-inflammatory potency compared with the parent drug. They further showed that a similar derivatization of prednisolone, but without the NO-releasing (ONO₂) group, did not affect antiinflammatory potency. Turesin et al. (2003) demonstrated that coadministration of prednisolone with a DETA-NONO-ate, an NO donor, resulted in a significantly greater reduction of leukocyte infiltration and inflammatory mediator production in a rat airpouch model than was observed with either drug alone. NO can exert many anti-inflammatory effects, including reduction of leukocyte adherence to the vascular endothelium (Gauthier et al., 1994) and suppression of production of various chemotactic factors (Walford and Loscalzo, 2003). Thus, the release of NO from NCX-1024 is likely to have accounted for the improved potency of this drug. However, the question remains as to the molecular target of the NO in producing this effect. The in vitro studies with human monocytic cells (THP-1) suggest that enhanced activation of NF-B may account, at least in part, for the enhanced potency of NCX-1024 versus flunisolide. NF-Bisa transcriptional activator of genes involved in inflammation, including numerous cytokines, cytokine receptors, and adhesion molecules (Barnes and Karin, 1997). NF-B transcription is sensitive to oxidative and nitrosative stress (Stamler et al., 1992). An oxidizing cytoplasmic environment is typically associated with NF-B activation, yet oxidation or nitrosation of the NF-B heterodimer (p50-p65) prevents DNA binding (Stamler et al., 1992). Cysteine residue 62 of the p50 monomer of NF-B has been identified as the primary site of S-nitrosylation, an event that leads to an inability of p50 to bind to DNA (Marshall et al., 2000). Matthews et al. (1996) found that S-nitrosylation of the cysteine 62 residue results in inhibition of p50 homodimer and p50-p65 heterodimer binding to its consensus DNA target sequence, resulting in a 4-fold decrease in the equilibrium binding constant. Glucocorticoids, such as flunisolide, can inhibit activation of NF-B. NCX-1024 would therefore be able to regulate NF-B activation in two ways: via nitrosylation and via the actions of its glucocorticoid moiety. Interestingly, Paul-Clark et al. (2003) have recently reported that NO-releasing prednisolone, through nitration of the glucocorticoid receptor, results in an enhancement of downstream anti-inflammatory events. This nitration resulted in accelerated binding of the glucocorticoid to the glucocorticoid receptor, accelerated dissociation of the receptor from heat shock protein 90, and accelerated translocation of the receptor to the nucleus. Nitration of glucocorticoid receptors therefore represents another possible mechanism to explain the enhanced anti-inflammatory potency of NCX-1024 in the present study.

The majority of the experiments we performed involved direct injection of the test drugs into the airpouch. This was done for two reasons. First, we were interested in comparing the potencies of these two drugs, so direct injection to the site of inflammation removes several confounding factors, such as differences in absorption had the drugs been given orally. Second, in a clinical setting flunisolide is mainly used topically, so we wanted to mimic that condition. The increased potency of NCX-1024 versus flunisolide was observed when the drug was administered directly into the airpouch but not when administered orally. The reasons for this difference are not clear. Both drugs were far less potent in terms of reducing airpouch inflammation when given orally as opposed to the direct injection, so it is possible that differences in absorption or metabolism accounted for the reduced potency after oral administration. It is also possible that the NO-releasing group is cleaved shortly after oral administration and that this accounts for the absence of the enhanced antiinflammatory potency in the airpouch model. It is important to note that the studies of systemic toxicity were performed using flunisolide and NCX-1024 at a dose that, with oral administration, was effective in reducing airpouch inflammation.

Glucocorticoids are likely to remain as one of the most important classes of drugs for treating a wide range of inflammatory conditions, in particular when they can be used topically to avoid systemic toxicity. NO-releasing glucocorticoids, such as NCX-1024, seem to represent an attractive alternative to existing glucocorticoids for such uses, given their marked increase in potency over the parent drugs, and the reduced systemic toxicity.

	Acknowledgements

 
We are grateful to Michael Dicay, Webb McKnight, and Fusun Turesin for assistance in performing these studies.

	Footnotes

 
The work described in this article was supported by research grants from the Canadian Institutes of Health Research. J.L.W. is an Alberta Heritage Foundation for Medical Research Scientist.

Article, publication date, and citation information can be found at http://jpet.aspetjournals.org.

doi:10.1124/jpet.104.067850.

ABBREVIATIONS: NSAID, nonsteroidal anti-inflammatory drug; NO, nitric oxide; COX, cyclooxygenase; NF-B, nuclear factor-B; DMSO, dimethyl sulfoxide; PGE₂, prostaglandin E₂; PMSF, phenylmethylsulfonyl fluoride; PCR, polymerase chain reaction; LPS, lipopolysaccharide.

Address correspondence to: Dr. John L. Wallace, Department of Pharmacology and Therapeutics, University of Calgary, 3330 Hospital Dr. NW, Calgary, Alberta, T2N 4N1, Canada. E-mail: wallacej{at}ucalgary.ca

	References

Top Abstract Materials and Methods Results Discussion References

 

Barnes PJ and Karin M (1997) Nuclear factor-kappaB: a pivotal transcription factor in chronic inflammatory diseases. N Engl J Med 336: 1066-1071.[Free Full Text]
Buckingham JC, Loxley HD, Taylor AD, and Flower RJ (1994) Cytokines, glucocorticoids and neuroendocrine function. Pharmacol Res 30: 35-42.[CrossRef][Medline]
Cicala C, Ianaro A, Fiorucci S, Calignano A, Bucci M, Gerli R, Santucci L, Wallace JL, and Cirino G (2000) NO-naproxen reduces inflammation, pain and downregulates T cell responses in rat Freund's adjuvant arthritis. Br J Pharmacol 130: 1399-1405.[CrossRef][Medline]
Davies NM, Roseth AG, Appleyard CB, McKnight W, Del Soldato P, Calignano A, Cirino G, and Wallace JL (1997) NO-naproxen vs. naproxen: ulcerogenic, analgesic and anti-inflammatory effects. Aliment Pharmacol Ther 11: 69-79.[CrossRef][Medline]
Edwards JW, Sedgwick AD, and Willoughby DA (1981) The formation of a structure with features of synovial lining by subcutaneous injection of air: an in vivo tissue culture system. J Pathol 134: 147-156.[CrossRef][Medline]
Filaretova L, Tanaka A, Miyazawa T, Kato S, and Takeuchi K (2002) Mechanisms by which endogenous glucocorticoid protects against indomethacin-induced gastric injury in rats. Am J Physiol 283: G1082-G1089.
Fiorucci S, Antonelli E, Distrutti E, Del Soldato P, Flower RJ, Clark MJ, Morelli A, Perretti M, and Ignarro LJ (2002a) NCX-1015, a nitric-oxide derivative of prednisolone, enhances regulatory T cells in the lamina propria and protects against 2,4,6-trinitrobenzene sulfonic acid-induced colitis in mice. Proc Natl Acad Sci USA 99: 15770-15775.[Abstract/Free Full Text]
Fiorucci S, Mencarelli A, Palazzetti B, Sprague AG, Distrutti E, Morelli A, Novobrantseva TI, Cirino G, Koteliansky VE, and de Fougerolles AR (2002b) Importance of innate immunity and collagen binding integrin 11 in TNBS-induced colitis. Immunity 17: 769-780.[CrossRef][Medline]
Fiorucci S, Santucci L, Cirino G, Mencarelli A, Familiari L, Soldato PD, and Morelli A (2000) IL-1 beta converting enzyme is a target for nitric oxide-releasing aspirin: new insights in the antiinflammatory mechanism of nitric oxide-releasing nonsteroidal antiinflammatory drugs. J Immunol 165: 5245-5254.[Abstract/Free Full Text]
Gauthier TW, Davenpeck KL, and Lefer AM (1994) Nitric oxide attenuates leukocyte-endothelial interaction via P-selectin in splanchnic ischemia-reperfusion. Am J Physiol 267: G562-G568.
Haglund RE and Rothblum LI (1987) Isolation, fractionation and reconstitution of a nuclear extract capable of transcribing ribosomal DNA. Mol Cell Biochem 73: 11-20.[Medline]
Marshall HE, Merchant K, and Stamler JS (2000) Nitrosation and oxidation in the regulation of gene expression. FASEB J 14: 1889-1900.[Abstract/Free Full Text]
Matthews JR, Botting CH, Panico M, Morris HR, and Hay RT (1996) Inhibition of NF-kappaB DNA binding by nitric oxide. Nucleic Acids Res 24: 2236-2242.[Abstract/Free Full Text]
Paul-Clark M, Del Soldato P, Fiorucci S, Flower RJ, and Perretti M (2000) 21-NO-prednisolone is a novel nitric oxide-releasing derivative of prednisolone with enhanced anti-inflammatory properties. Br J Pharmacol 131: 1345-1354.[CrossRef][Medline]
Paul-Clark MJ, Mancini L, Del Soldato P, Flower RJ, and Perretti M (2002) Potent antiarthritic properties of a glucocorticoid derivative, NCX-1015, in an experimental model of arthritis. Proc Natl Acad Sci USA 99: 1677-1682.[Abstract/Free Full Text]
Paul-Clark MJ, Roviezzo F, Flower RJ, Cirino G, Soldato PD, Adcock IM, and Perretti M (2003) Glucocorticoid receptor nitration leads to enhanced antiinflammatory effects of novel steroid ligands. J Immunol 171: 3245-3252.[Abstract/Free Full Text]
Stamler JS, Simon DI, Osborne JA, Mullins ME, Jaraki O, Michel T, Singel DJ and Loscalzo J (1992) S-nitrosylation of proteins with nitric oxide: synthesis and characterization of biologically active compounds. Proc Natl Acad Sci USA 89: 444-448.[Abstract/Free Full Text]
Turesin F, Del Soldato P, and Wallace JL (2003) Enhanced anti-inflammatory potency of a nitric oxide-releasing derivative of prednisolone in the rat. Br J Pharmacol 139: 966-972.[CrossRef][Medline]
Walford G and Loscalzo J (2003) Nitric oxide in vascular biology. J Thromb Haemost 1: 2112-2118.[CrossRef][Medline]
Wallace JL (1997) Nonsteroidal anti-inflammatory drugs and gastroenteropathy: the second hundred years. Gastroenterology 112: 1000-1016.[CrossRef][Medline]
Wallace JL, Chapman K, and McKnight W (1999) Limited anti-inflammatory efficacy of cyclooxygenase-2 inhibition in carrageenan-airpouch inflammation. Br J Pharmacol 126: 1200-1204.[CrossRef][Medline]
Wallace JL and Del Soldato P (2003) The therapeutic potential of NO-NSAIDs. Fundam Clin Pharmacol 17: 11-20.[CrossRef][Medline]
Wallace JL, Ignarro LJ, and Fiorucci S (2002) Potential cardioprotective actions of nitric oxide-releasing aspirin. Nat Rev Drug Discov 1: 375-382.[CrossRef][Medline]
Wallace JL, Keenan CM, and Granger DN (1990) Gastric ulceration induced by nonsteroidal anti-inflammatory drugs is a neutrophil-dependent process. Am J Physiol 259: G462-G467.

This Article Abstract Full Text (PDF) All Versions of this Article: jpet.104.067850v1 310/3/1096    most recent Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Wallace, J. L. Articles by Fiorucci, S. Search for Related Content PubMed PubMed Citation Articles by Wallace, J. L. Articles by Fiorucci, S.