QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: jpet.104.065532v1 310/2/808    most recent Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Shimada, M. Articles by Yamazoe, Y. Search for Related Content PubMed PubMed Citation Articles by Shimada, M. Articles by Yamazoe, Y.

ABSORPTION, DISTRIBUTION, METABOLISM, AND EXCRETION

Unique Properties of a Renal Sulfotransferase, St1d1, in Dopamine Metabolism

Division of Drug Metabolism and Molecular Toxicology, Graduate School of Pharmaceutical Sciences, Tohoku University, Aramaki Aoba, Aoba-ku, Sendai, Japan

Received February 1, 2004; accepted April 14, 2004.

	Abstract

Top Abstract Materials and Methods Results Discussion References

 
Although catecholamine sulfation is higher in the kidney than in the liver of mice, no detectable amounts of previously reported sulfotransferases (STs) such as St1a, St1b, St1c, and St1e were expressed in mouse kidney cytosols. A new sulfotransferase (St1d1) cDNA was isolated from kidney cDNA library of BALB/c strain by reverse transcription-polymerase chain reaction (RTPCR) using information from expressed sequence tags (EST) database. The cDNA sequence resembled that of cDNA reported previously (AA238910 [GenBank] ) (Sakakibara et al., 1998) but differed in two amino acids, ²⁰⁶Q/K and ²¹⁶Y/F, in the deduced amino acid sequence. The St1d1 expressed had unique substrate specificities for catecholamine derivatives, which preferred their deaminated metabolites rather than their parent amines. St1d1 showed the highest activity toward 3,4-dihydroxyphenylacetic acid (230.2 ± 2.69 nmol/mg/min) among the examined substrate. St1d1 protein was abundant in kidney, followed by liver, lung, and uterus. Furthermore, an addition of anti-St1d1 serum in the cytosolic reaction mixture resulted in complete inhibition of the sulfotransferase activity suggesting a major role of St1d1 on catecholamine sulfations. No human ST1D ortholog was detected at both mRNA and protein levels, although ST1A5 selectively catalyzing parent amine sulfation was detected in human kidney. These results indicate the functional basis of sulfation and the clear species difference on renal catecholamine metabolisms in mice and humans.

Cytosolic enzymes mediating sulfation of various endobiotics and xenobiotics have been identified and are now known to constitute a gene superfamily, ST (SULT) 1-5 (Nagata and Yamazoe, 2000). Phenol and estrogen sulfotransferases, including the ST1 family, are detected in livers of humans as well as rodents. Four different cDNAs of arylsulfotransferases have been isolated from mouse cDNA libraries of liver: St1a4 (Kong et al., 1993) and St1b3 (Saeki et al., 1998), olfactory (St1c4) (Tamura et al., 1998), and testis (St1e4) (Song et al., 1995), although substrate specificities of these forms were not yet identified except for St1a4 (Honma et al., 2001). Furthermore, limited amounts of information are available on kidney sulfotransferase form(s). Therefore, kidney sulfotransferase has been investigated to assess the possible role for metabolism of catecholamines. In the present study, we have identified a sole expression of St1d1 among arylsulfotransferases in mouse kidney and characterized the unique substrate specificity.

	Materials and Methods

Top Abstract Materials and Methods Results Discussion References

 
Materials
Restriction endonucleases, DNA modifying enzymes, and Takara Ex Taq were purchased from Takara Shuzo (Kyoto, Japan). Enterokinase was obtained from Biozyme Laboratories, Ltd. (Gwent, UK). Thermo Sequenase cycle sequencing kit was obtained from Shimadzu Co. (Kyoto, Japan). 2-Amino-1-methyl-6-(4-hydroxyphenyl)-imidazo[4,5-b]pyridine (4'-OH-PhIP) was kindly donated by Dr. K. Wakabayashi (National Cancer Center Research Institute, Tokyo, Japan). Isopropyl--D-thiogalactopyranoside (IPTG) was purchased from Nacalai Tesque Inc. (Kyoto, Japan). Dithiothreitol (DTT), alkaline phosphatase-conjugated goat anti-rabbit IgG, 5-bromo-4-chloro-3-indolylphosphate, nitro blue tetrazolium, and phenolic chemicals used as substrates were purchased from Sigma-Aldrich (St. Louis, MO). 3'-Phosphoadenosine-[³⁵S]-5'-phosphosulfate ([³⁵S]PAPS) (2000 mCi/mmol) was obtained from PerkinElmer Life and Analytical Sciences (Boston, MA). QIAexpress and nickel-nitrilotriacetic acid agarose were obtained from Qiagen (Chatsworth, CA). Bio-Rad protein assay kit and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) molecular weight standards (low range) were purchased from Bio-Rad (Richmond, CA). All other chemicals used were of the highest grade available.

Human kidney cytosols were obtained from BioChain Institute, Inc. (Hayward, CA). Human livers were from the Department of Anatomic Pathology (School of Medicine, Tohoku University, Sendai, Japan). Experiments on human livers were approved by the Ethics Committee in Tohoku University. BALB/c mice (8-week-old) and Japanese White rabbits (female, 3.0 kg) were obtained from Japan SLC (Shizuoka, Japan).

Methods
Preparation of Cytosols from Mouse Kidney and Liver. Renal and hepatic cytosols were prepared from 8-week-old male and female BALB/c mice. Kidneys and livers were rinsed with phosphate-buffered saline (PBS) and homogenized with a buffer containing 0.075 M potassium phosphate (pH 7.4), 0.075 M KCl, and 1 mM DTT. The homogenates were centrifuged at 9000g for 20 min, and the supernatants were centrifuged at 105,000g for 60 min. The resultant supernatants were used as cytosols. The protein concentration was determined by the method of Bradford (1976) with bovine serum albumin (BSA) as the standard.

Assays of Sulfotransferase Activities. Sulfotransferase activities were determined by the radioactivities of the metabolites using [³⁵S]PAPS as a sulfate donor after thin-layer chromatography. The incubation mixture (final volume of 10 µl) consisted of 100 mM Tris-HCl buffer (pH 7.4), 0.3 mM MgCl₂, 2 mM DTT, 1 mg/ml bovine serum albumin, 125 µM [³⁵S]PAPS, 10 or 100 µM substrate dissolved in 1% dimethyl sulfoxide, 2.5 µg of cytosolic protein from male mouse kidney or liver, or 50 ng of 6xHis-St1d1 protein. The reaction was initiated by addition of [³⁵S]PAPS incubated at 37°C for 20 min and then terminated by addition of 5 µl of acetonitrile. Aliquots of the reaction mixture (10 µl) were applied to a thin-layer plate (thin-layer chromatography aluminum plate silica gel 60; Merck, Darmstadt, Germany; or chromatogram sheet 13255; Eastman Kodak, Rochester, NY). Metabolites on the chromatogram were developed with a solvent system of n-propanol/28% aqueous ammonia/water (6:3:1) (Fujita et al., 1999). The radioactive spots were analyzed by FLA-3000 image analyzer (Fuji Film, Tokyo, Japan). The apparent kinetic parameters, K_m and V_max, were calculated from double-reciprocal Lineweaver-Burk plots using linear regression analyses. The substrate concentrations used are ranging from 5 to 300 µM for 3,4-dihydroxyphenylacetic acid (DOPAC) and 10 µM to 10 mM for dopamine.

Isolation of St1d1 cDNA. St1d1 cDNA fragment was obtained by the PCR from mouse kidney or liver cDNA library using oligonucleotides as the primers (St1d1-5': CGGCATGCGATGACGATGACAAAATGGATAACAAACTGGATGTC and St1d1-3': CGCAAGCTTCAACTCTCCCTAGATCTC) containing SphI/HindIII restriction sites, respectively. A 5'-region from the initiation codon of St1d1 cDNA fragment contained nucleotides encoding seven additional amino acid residues (AlaCysAspAspAspAspLys) as enterokinase cleavage site. The PCR mixture consisted of 1 µl of the template cDNA, 3 µl each of dATP, dCTP, dGTP, and dTTP, 1.5 units of Takara Ex Taq, 20 pmol of St1d1-5' and St1d1-3' primers, and the Ex Taq buffer in a final volume of 30 µl. After an initial denaturation at 94°C for 2 min, the amplification was performed for 30 cycles with 1 min at 94°C for denaturation, 30 s at 55°C for annealing, 2 min at 72°C for extension, and a final extension period of 7 min at 72°C.

Sequencing. DNA sequence was determined by using fluorescent-labeled primers and DSQ2000-L DNA sequencer (Shimadzu Co., Kyoto, Japan) according to the dideoxy method (Shimada et al., 2002). The PCR mixture (8 µl) contained 5 µg of the template DNA, 1.25 pmol of the fluorescent-labeled primer, and 2 µl of the reagent containing ddATP, ddGTP, ddTTP, or ddCTP. After an initial denaturation at 98°C for 5 min, the amplification was performed for 25 cycles, with 1 min at 98°C for denaturation, 45 sec at 50°C for annealing, 1.5 min at 72°C for extension, and a final extension period of 1 min at 72°C. After addition of 8 µl of the formamide loading dye for termination of the reaction, denaturation was performed at 98°C for 5 min. These samples were applied to the gel and then electrophoresed for 24 h.

Expression and Purification of St1d1. The cDNA obtained (St1d1) was ligated into an expression vector, pQE30 (Qiagen, Tokyo, Japan). The constructed plasmid DNA was transformed into Escherichia coli, M15 [pREP4] strain. Recombinant St1d1 (6xHis-St1d1) was expressed and purified from bacterial cytosols by nickel-nitrilotriacetic acid affinity chromatography (Fujita et al., 1997). 6xHis-St1d1 was eluted with the buffer containing 300 mM NaCl, 10% glycerol, 0.025% Tween 20, 50 mM sodium phosphate (pH 6.0), and 200 mM imidazole. St1a4 and St1b3 were also expressed as histidine-tagged proteins.

Preparation of Antibody. A Japanese White rabbit (3.0 kg, female) was immunized intradermally with 100 µg of purified 6xHis-St1d1 in Titer Max GOLD (CytRx, Atlanta, GA) and immunized intravenously 4 weeks later with 100 µg of the protein. After 1 week, 40 ml of the blood was obtained and centrifuged. The resultant supernatant was used as the St1d1 antibody. In Western blotting anti-St1d1 antibody serum recognized only one band in kidney and liver cytosols and did not immunocross with other known arylsulfotransferases examined.

Electrophoresis and Western Blotting. Cytosolic proteins (10-100 µg/lane) from mouse kidney or liver were separated by SDS-PAGE using a 10.5% gel and electrophoretically transferred to a nitrocellulose membrane. STs on the membrane were reacted with the antibody (1:1000 dilution) and with alkaline phosphatase-conjugated goat anti-rabbit IgG (1:3000 dilution), 5-bromo-4-chloro-3-indolylphosphate, and nitro blue tetrazolium. The stained sheets were scanned with EPSON Calario GT-8700 (Epson, Tokyo, Japan), and their intensities were measured by use of the NIH Image (version 1.59) software. The contents in each sample were determined using the corresponding recombinant proteins cleaved 6x His by enterokinase (6xHis) as the standards.

	Results

Top Abstract Materials and Methods Results Discussion References

 
Sulfotransferase Activities toward Catecholamines in Cytosols from Mouse Kidney and Liver. Sulfotransferase activities toward catecholamines at 100 µM substrate concentration were compared between kidney and livers (Fig. 1). Renal and hepatic cytosols mediated dopamine sulfation at the rate of 745 ± 36.0 and 220 ± 10.4 pmol/mg/min, respectively. Three-fold higher sulfating rates were also observed in kidney than in liver toward norepinephrine and epinephrine.

View larger version (31K): [in this window] [in a new window]   Fig. 1. Cytosolic sulfotransferase activities of mouse kidneys and livers. Each value represents the mean ± S.D. of three different male mice. Sulfotransferase activities were assayed using [35S]PAPS as a sulfate donor. The assays were performed at pH 7.4 in the presence of 100 µM substrates and 2.5 µg of cytosolic protein from kidneys and livers of male mice.

Western Blot Analyses of Arylsulfotransferase in Mouse Kidney and Liver. To identify which form(s) of sulfotransferase mediates sulfation of catecholamines in mouse kidney, renal cytosols were subjected to Western blotting analyses as shown in Fig. 2. St1a4 and St1b3 were not detected in kidney, although both forms were detected in livers of male and female mice. Anti-rat ST1B1 sera recognized an unknown band at about 33 kDa, which is distinct from authentic St1b3 and St1a4 protein. In addition, neither St1c4 nor St1e5 proteins were detected in kidney and liver (data not shown).

View larger version (25K): [in this window] [in a new window]   Fig. 2. Western blot analysis using anti-St1A or -St1B antibody. Proteins were subjected to SDS-PAGE on a 10.5% gel and electrically transferred to a nitrocellulose membrane. Sulfotransferases on the membrane were reacted with anti-ST1A1 (rat) (A) or anti-ST1B1 (rat) (B) antisera as the first antibody. Lane: 6xHis St1a4 (A1), 6xHis St1b3 (B1), 6xHis/(6xHis) St1a4 (A2), 6xHis/(6xHis) St1b3 (B2), liver (male) (3), kidney (male) (4), liver (female) (5), kidney (female) (6). Lane 1: 20 ng, and lane 2: 290 ng of protein. Lanes 3 to 6: 20 µg of mouse cytosolic proteins. (6xHis) was prepared from 6xHis-tagged form after the cleavage of 6xHis-tagged by enterokinase. Both St1c4 and St1e5 were not detected in liver and kidney (data not shown).

Structure of a New Renal ST cDNA. The cDNA prepared from BALB/c strain of mice was explored to identify the renal sulfotransferase mediating catecholamine sulfation. A possible sulfotransferase cDNA was isolated and the nucleotide and deduced amino acid sequences of a renal ST are shown in Fig. 3. The identified renal ST mRNA contained an open reading frame of 888 bp, which encoded 295 amino acids with a molecular weight of 35,081 Da. The renal sulfotransferase was closely related to sulfotransferase found in EST database (accession no. AA238910 [GenBank] ), except for ²⁰⁶Q/K (⁶¹⁶C/A) and ²¹⁶Y/F (⁶²⁹A/T) in the deduced amino acid sequences. Only one fragment of mRNA (AA238910 [GenBank] ) from EST database exactly matched part of the previously reported sequence (Sakakibara et al., 1998). On the contrary, this newly isolated cDNA was exactly matched in three EST fragments (AA245085 [GenBank] , 109895, and 109782) and thus judged to correspond to St1d1 in BALB/c mice. These two closely related St1d1 forms are possible to exist in mouse liver and kidney cytosols.

View larger version (55K): [in this window] [in a new window]   Fig. 3. Nucleotide and deduced amino acid sequences of St1d1 cDNA. The initiation and termination codons are underlined and the restriction enzyme sites are boxed.

Characterization of General Substrate Specificity of St1d1. To characterize the substrate specificity of the renal St1d1, Stld1 was expressed in E. coli as a fused protein. As shown in Table 1, recombinant St1d1 catalyzed sulfation of dopamine, in addition to p-nitrophenol, triiodothyronine, and estradiol among phenolic chemicals.

St1d1 also mediate sulfation of 2-methylbenzyl alcohol, but showed only marginal activities toward other alcohols including corticosterone, dehydroepiandrosterone, cholesterol, lithocholic acid, and 1-pyrenemethanol. No sulfating activity toward amines such as aniline and desipramine was detected with recombinant St1d1.

Sulfotransferase Activity of St1d1 for Catecholamine and Their Metabolites. Due to the high activity toward dopamine, substrate specificity of St1d1 was investigated further on catecholamines and their metabolites at 10 µM substrate concentration (Fig. 4). St1d1 had no sulfating activity on 3,4-dihydroxy-L-phenylalanine (L-DOPA), a precursor of catecholamine.

View larger version (30K): [in this window] [in a new window]   Fig. 4. Sulfotransferase activities toward catecholamines and their metabolites by recombinant St1d1. Each value represents the mean ± S.D. of at least three determinations. Data are shown as nanomoles per milligram of protein per minute. The assays were performed at pH 7.4 in the presence of 10 µM substrate and 50 ng of recombinant St1d1 proteins. N.D., not detected (<0.15 nmol/mg of protein/min). COMT, catechol-O-methyltransferase; MAO, monoamine oxidase; AO, aldehyde oxidase; AR, aldehyde reductase. DL-mixtures of normethanephrine, vanillylmandelic acid, metanephrine, or 3,4-dihydroxyphenyletylene glycol were used in this experiment. Other catecholamines and their metabolites were used as natural L-forms.

Other catecholamines such as norepinephrine (6.04 ± 1.59 nmol/mg/min) and epinephrine (1.40 ± 0.07 nmol/mg/min) are also sulfated, in spite of the high activity toward dopamine (22.8 ± 3.14 nmol/mg/min) by St1d1. St1d1 had no sulfating activity with 3-methoxytyramine, normethanephrine, and methanephrine, which were formed from the parent amine by catechol O-methyltransferase. St1d1, however, showed markedly high activities toward DOPAC (230.2 ± 9.21 nmol/mg/min), 3,4-dihydroxymandelic acid (20.3 ± 2.69 nmol/mg/min), and 3,4-dihydroxyphenylene glycol (209.3 ± 13.7 nmol/mg/min). These metabolites are formed from their parent amines by MAO followed by aldehyde oxidase or aldehyde reductase. St1d1 also catalyzed sulfation of homovanillic acid (116.9 ± 7.04 nmol/mg/min) and 4-hydroxy3-methoxyphenylethylene glycol (72.4 ± 7.00 nmol/mg/min), except for vanillylmandelic acid (VMA).

Kinetic parameters were examined for dopamine and DOPAC sulfations (Table 2). Apparent K_m and V_max values of St1d1 were 713.2 ± 14.2 µM and 1474 ± 9.03 nmol/mg of protein/min, respectively, for dopamine sulfation, whereas 35.02 ± 1.13 µM and 1678 ± 159 nmol/mg of protein/min were for DOPAC sulfation. The values of V_max/K_m for dopamine and DOPAC sulfations were 2.07 and 47.9, respectively.

Distribution and Quantification of Cytosolic St1d1 Protein. St1d1 protein was detected in kidney and liver at about 33 kDa and comigrated with corresponding to 6xHis-St1d1. The levels are higher in kidney than in liver, followed by lung and uterus (Fig. 5). The protein levels in lung and uterus were calculated about 10% of the liver level. Cytosolic contents of St1d1 in kidney and livers were determined. Mean contents of renal St1d1 were 5.1 and 3.4 µg/mg cytosolic protein in three different male and female mice, respectively. On the contrary, hepatic St1d1 content was rather higher in female mouse (2.0 µg/mg cytosolic protein) than in males (2.5 µg/mg cytosolic protein). To know whether St1d1 is a major form in liver, we also determined the contents of St1a4 and St1b3. St1a4 content was 2.3 and 4.4 µg/mg cytosolic protein in male and female livers, respectively. St1b3 content was 0.5 and 0.4 µg/mg hepatic cytosol from male and female, respectively.

View larger version (16K): [in this window] [in a new window]   Fig. 5. Western blot analysis using anti-St1d1 antibody. Proteins are subjected to SDS-PAGE on a 10.5% gel and electrically transferred to a nitrocellulose membrane. Sulfotransferase forms on the membrane were reacted with anti-St1d1 as the first antibody. Lane: 6xHis/(6xHis) St1d1 (1), male liver (2), female liver (3), male lung (4), female lung (5), testis (6), uterus (7), male brain (8), female brain (9), male kidney (10), and female kidney (11). Lane 1: 200 ng of protein. Lanes 2, 3, 10, and 11: 10 µg; lanes 4, 5, 6, 7, 8, and 9: 100 µg of mouse cytosolic protein.

Role of St1d1 on Renal Dopamine and DOPAC Sulfations. To assess the role of St1d1 on renal catecholamine sulfation, anti-St1d1 antisera were added in the incubation mixture containing DOPAC and renal cytosols. To verify the form-specificity of anti-St1d1 antiserum, the antiserum was added to an incubation system containing recombinant St1d1 or St1a4 for p-nitrophenol sulfation (Fig. 6A). Addition of anti-St1d1 antisera (15 µg) resulted in the decreased St1d1-meditated p-nitrophenol sulfation to 17% of the control, but not the St1a4-mediated sulfation. Addition of 15 µg of anti-St1d1 antisera caused the decrease of kidney cytosolic dopamine and DOPAC sulfations below the 5% level for the control values (addition of preimmunized serum) as similar to the St1d1-mediated sulfation (Fig. 6, B and C).

View larger version (27K): [in this window] [in a new window]   Fig. 6. Inhibitory effect of anti-St1d1 antiserum on St1d1-mediated p-nitrophenol, dopamine, and DOPAC sulfation. A, effects of anti-St1d1 antiserum on St1d1- or St1a4-mediated p-nitrophenol sulfation. Data are shown as the relative percentage of the respective controls (no addition of serum). Anti-St1d1 antiserum (15 µg) was added to the incubation mixture containing 50 ng of recombinant protein and 5 µM p-nitrophenol. B, effects of addition of anti-St1d1 antiserum on St1d1-mediated (A) or renal cytosolic (B) catecholamine sulfation. Open and closed circles indicated the relative percentage of the controls (no addition of serum) by the addition of preimmunized and anti-St1d1 antiserum, respectively. The incubation mixture contains 12.5 ng of recombinant St1d1 or 2.5 µg of renal cytosols and 10 µM dopamine or DOPAC. Other experimental details are described under Materials and Methods.

Detection of Human Renal Catecholamine Sulfotransferase mRNA and Protein. To ascertain the possible expression of human ST1D form, the specific mRNA was detected with RT-PCR using human ST1D primers generated from the ST1D genome sequence found in human genome database. As shown in Fig. 7A, neither a human ST1D mRNA containing open reading frame nor the fragment of 353 bp was detected in human kidney cDNA library. Instead, a dopamine sulfotransferase, ST1A5 cDNA, was isolated from human kidney cDNA library (Fig. 7B). The nucleotide sequence was identical with that of cDNA reported previously (L19956 [GenBank] ).

View larger version (40K): [in this window] [in a new window]   Fig. 7. Detection of catecholamine sulfotransferase in humans. A, detection of St1a4 and St1d1 mRNA in mouse kidney by RT-PCR. First-strand cDNA, as a template for PCR, was synthesized from total RNA of mouse kidney, using Ready-to-Go You-prime First-Strand Beads (Pharmacia Biotech, Piscataway, NJ). After an initial denaturation at 94°C for 2 min, the amplification was performed for 25 cycles with 30 s at 94°C for denaturation, 30 s at 58°C for annealing, 90 s at 72°C for extension, and a final extension period of 7 min at 72°C. Lane 1: detection of St1a4 mRNA. Primers were St1a4-5': GCGGATCCGATGACAAAATGGCTCAGAACCCCAGC and St1a4-3': GCGTCGACCAGTGTTAGGACTGATGGC. Lane 2, detection of St1d1 mRNA. Primers were St1d1-5': CGGCATGCGATGACGATGACAAAATGGATAACAAACTGGATGTC and St1d1-3': CGCAAGCTTCAACTCTCCCTAGATCTC. B, detection of ST1A mRNA in human kidney by RT-PCR. Human kidney 5'-STRETCH PLUS cDNA, as a template for PCR, pooled from eight male/female Caucasians (age 24-55) was purchased from BD Biosciences Clontech (Palo Alto, CA). After an initial denaturation at 94°C for 10 min, the amplification was performed for 35 cycles, with 30 s at 94°C for denaturation, 30 s at 55°C for annealing, 90 s at 72°C for extension, and a final extension period of 7 min at 72°C. Lane 1: detection of ST1A mRNA. Primers were ST1A-5': GCGGATCCGATGACGATGACAAAATGGAGCTGATCCAGGAC and ST1A-3': GCAAGCTTCCCCTCTCACAGCTCAGAGCGG. Lane 2: detection of ST1D mRNA. Primers were ST1D-5': ATGGACAATGAGCAGCGTGTC and ST1D-3': AATTTTCCTTTACCAAACACAGG. Lane 3, detection of ST1D mRNA (338 bp). Primers were ST1D633-5': GGAGAAAGACAAGCCAGAAACAATT and ST1D-3'. M represents 1-kbp marker. C, Western blot analysis using anti-ST1A5 antibody. Proteins were subjected to SDS-PAGE on a 10.5% gel and electrically transferred to a nitrocellulose membrane. ST forms on the membrane were reacted with anti-ST1A5 antibody. Lane 1: 20 ng of each (6xHis) ST1A3 and (6xHis) ST1A5, lane 2: 200 µg of human kidney cytosolic protein, and lane 3: 20 µg of human liver cytosolic protein.

Further ST1A5 protein was detected in human kidney cytosols (Fig. 7C). The amount was very low and estimated about l% of the level in liver cytosols.

	Discussion

Top Abstract Materials and Methods Results Discussion References

 
In the present study, St1d1 is shown to be a major arylsulfotransferase in mouse kidney, and no other St1 forms, like St1a4 and St1b3, were detected in contrast to their high expression in livers.

These data indicate the primary role of St1d1 for catecholamine sulfation in this tissue. Unique properties of St1d1, which showed higher activities toward the deaminated derivatives of catecholamine, such as DOPAC, 3,4-dihydroxymandelic acid, and 3,4-dihydroxyphenylene glycol, rather than parent amines, are characterized by the use of the recombinant protein.

From kinetic parameters of St1d1, the value of V_max/K_m for DOPAC is 20-fold higher than that for dopamine. These data suggest that DOPAC is a selective substrate for St1d1. The substrate specificity of St1d1 was distinct from those of a human catecholamine sulfotransferase, ST1A5 form (Honma et al., 2001). As shown in our previous report, ST1A5 have the higher activity toward parent catecholamines rather than the deaminated derivatives.

Chemicals containing acidic carboxyl groups are rather poor substrates for previously known sulfotransferases included in the ST1 family. St1d1, however, catalyzes sulfation of phenol-carboxylic acids such as DOPAC and homovanillic acid, except for VMA. The latter is consistent with reported data that VMA is excreted mainly in urine as unconjugated in rodents. Presence of methylether moieties in catecholamines seems to have complex influences on the St1d1-mediated sulfations. The substrate specificities are unlikely to be determined only by regioselectivity, chemico-physical properties such as acidity and/or hydrophobicity. The sole expression of St1d1 in kidney among ST1 forms was observed in the present study. This phenomenon is in contrast to the expression of multiple families of sulfotransferase in liver. Recently, another sulfotransferase form, which is an ortholog to human SULT1C2 (ST1C2), was detected in kidney (Sugimura et al., 2002). The recombinant protein showed only p-nitrophenol sulfation, and the functional role of mouse SULT1C2 in kidney was not reported.

In rodents, plasma concentration of dopamine was ca. 5 µM (Tsunoda et al., 2001), and renal concentrations of dopamine and DOPAC were reported at 200 and 20 nM, respectively (Shoaf and Elchisak, 1983; Eldrup and Richter, 2000). These values were estimated to be 1/1000 1/100 of K_m values for recombinant St1d1 in the presence of 125 µM PAPS as shown in Table 2. Any reason for this discrepancy remained obscure.

These are few reports on urinary excretion of catecholamines in rodents. DOPAC sulfate is a major urinary excretion in rats. Renal St1d1, in our preliminary experiment, was stained immunohistochemically at proximal and distal tubule and collecting duct. The presence of organic cation transporter (OCT) is reported in rats and human kidneys (Inui et al., 2000). Combined with the information, it is possible that dopamine and DOPAC are taken into the renal tubule by transporters like OCT1/2 and then sulfated with St1d1 in mice. The sulfate esters are excreted in urine through transporters. These results suggest that renal St1d1 is also involved in excretion of catecholamines to maintain the homeostasis of the whole body.

During the preparation of this study, a recent report showed that the expression of canine SULT1D (ST1D) is expressed in kidney and shown the sulfotransferase activity toward dopamine (Tsoi et al., 2001). Rat ST1D2 cDNA is also isolated, although the substrate specificity has not yet been characterized.

Human SULT1D (ST1D) is suggested to be a pseudogene because of the existence of mutated splice donors/acceptors site and in-frame stop codons (Meinl and Glatt, 2001). These data, together with our present result, suggest that ST1D form is not expressed as a functional protein in human kidney. Thus ST1A5, instead of ST1D form, has a primary role in controlling catecholamine sulfation in human kidney.

In the present study, St1d1 (mouse) and ST1A5 (human) are first identified as renal neurotransmitter sulfotransferases and suggest the involvement in the excretion profile of the sulfoconjugated catecholamines in urine.

	Footnotes

 
DOI: 10.1124/jpet.104.065532.

ABBREVIATIONS: MAO, monoamine oxidase; ST, St, or SULT, sulfotransferase; 4'-OH-PhIP, 2-amino-1-methyl-6-(4-hydroxyphenyl)-imidazo[4,5-b]pyridine; DTT, dithiothreitol; PAPS, 3'-phosphoadenosine-5'-phosphosulfate; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis; RT-PCR, reverse transcription-polymerase chain reaction; DOPAC, 3,4-dihydroxyphenylacetic acid; bp, base pair(s); kbp, kilobase pair; VMA, vanillylmandelic acid.

Address correspondence to: Dr. Miki Shimada, Division of Drug Metabolism and Molecular Toxicology, Graduate School of Pharmaceutical Sciences, Tohoku University, Aramaki Aoba, Aoba-ku, Sendai, 980-8578, Japan. E-mail: shimada{at}mail.pharm.tohoku.ac.jp.

	References

Top Abstract Materials and Methods Results Discussion References

 

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254.[CrossRef][Medline]

Eldrup E and Richter EA (2000) DOPA, dopamine and DOPAC concentrations in the rat gastrointestinal tract decrease during fasting. Am J Physiol Endocrinol Metab 279: E815-E822.[Abstract/Free Full Text]

Fujita K, Nagata K, Ozawa S, Sasano H, and Yamazoe Y (1997) Molecular cloning and characterization of rat ST1B1 and human ST1B2 cDNAs, encoding thyroid hormone sulfotransferases. J Biochem (Tokyo) 122: 1052-1061.[Abstract/Free Full Text]

Fujita K, Nagata K, Yamazaki T, Watanabe E, Shimada M, and Yamazoe Y (1999) Enzymatic characterization of human cytosolic sulfotransferases; identification of ST1B2 as a thyroid hormone sulfotransferase. Biol Pharm Bull 22: 446-452.[Medline]

Gorboulev V, Ulzheimer JC, Akhoundova A, Ulzheimer-Teuber I, Karbach U, Quester S, Baumann C, Lang F, Busch AE, and Koepsell H (1997) Cloning and characterization of two human polyspecific organic cation transporters. DNA Cell Biol 16: 871-881.[Medline]

Honma W, Kamiyama Y, Yoshinari K, Sasano H, Shimada M, Nagata K, and Yamazoe Y (2001) Enzymatic characterization and interspecies difference of phenol sulfotransferases, ST1A forms. Drug Metab Dispos 29: 274-281.[Abstract/Free Full Text]

Inui K, Masuda S, and Saito H (2000) Cellular and molecular aspects of drug transport in the kidney. Kidney Int 58: 944-958.[CrossRef][Medline]

Kong AN, Ma M, Tao D, and Yang L (1993) Molecular cloning of cDNA encoding the phenol/aryl form of sulfotransferase (mSTp1) from mouse liver. Biochim Biophys Acta 1171: 315-318.[Medline]

Kopin IJ (1985) Catecholamine metabolism: basic aspects and clinical significance. Pharmacol Rev 37: 333-364.[Medline]

Meinl W and Glatt H (2001) Structure and localization of the human SULT1B1 gene: neighborhood to SULT1E1 and a SULT1D pseudogene. Biochem Biophys Res Commun 288: 855-862.[CrossRef][Medline]

Nagata K and Yamazoe Y (2000) Pharmacogenetics of sulfotransferase. Annu Rev Pharmacol Toxicol 40: 159-176.[CrossRef][Medline]

Saeki Y, Sakakibara Y, Araki Y, Yanagisawa K, Suiko M, Nakajima H, and Liu MC (1998) Molecular cloning, expression and characterization of a novel mouse liver SULT1B1 sulfotransferase. J Biochem (Tokyo) 124: 55-64.[Abstract/Free Full Text]

Sakakibara Y, Yanagisawa K, Takami Y, Nakayama T, Suiko M, and Liu MC (1998) Molecular cloning, expression and functional characterization of novel mouse sulfotransferases. Biochem Biophys Res Commun 247: 681-686.[CrossRef][Medline]

Shimada M, Kamiyama Y, Sato A, Honma W, Nagata K, and Yamazoe Y (2002) A hydroxysteroid sulfotransferase, st2b2, is a skin cholesterol sulfotransferase in mice. J Biochem (Tokyo) 131: 167-169.[Abstract/Free Full Text]

Shoaf SE and Elchisak MA (1983) Distribution of free and conjugated dopamine in rats and mice. Life Sci 33: 625-630.[CrossRef][Medline]

Song WC, Moore R, McLachlan JA, and Negishi M (1995) Molecular characterization of a testis-specific estrogen sulfotransferase and aberrant liver expression in obese and diabetogenic C57BL/KsJ-db/db mice. Endocrinology 136: 2477-2484.[Abstract]

Sugimura K, Tanaka T, Tanaka Y, Takano H, Kanagawa K, Sakamoto N, Ikemoto S, Kawashima H, and Nakatani T (2002) Decreased sulfotransferase SULT1C2 gene expression in DPT-induced polycystic kidney. Kidney Int 62: 757-762.[CrossRef][Medline]

Tamura HO, Harada Y, Miyawaki A, Mikoshiba K, and Matsui M (1998) Molecular cloning and expression of a cDNA encoding an olfactory-specific mouse phenol sulphotransferase. Biochem J 331: 953-958.

Tsoi C, Falany CN, Morgenstern R, and Swedmark S (2001) Identification of a new subfamily of sulphotransferases: cloning and characterization of canine SULT1D1. Biochem J 356: 891-897.[CrossRef][Medline]

Tsunoda M, Takezawa K, Yanagisawa T, Kato M, and Imai K (2001) Determination of catecholamines and their 3-O-methyl metabolites in mouse plasma. Biomed Chromatogr 15: 41-44.[CrossRef][Medline]

Wong KP and Yeo T (1982) Importance of extrahepatic sulphate conjugation. Biochem Pharmacol 31: 4001-4003.[CrossRef][Medline]

This article has been cited by other articles:

				L. Senggunprai, K. Yoshinari, M. Shimada, and Y. Yamazoe Involvement of ST1B Subfamily of Cytosolic Sulfotransferase in Kynurenine Metabolism to Form Natriuretic Xanthurenic Acid Sulfate J. Pharmacol. Exp. Ther., December 1, 2008; 327(3): 789 - 798. [Abstract] [Full Text] [PDF]

				Y. Alnouti and C. D. Klaassen Tissue Distribution and Ontogeny of Sulfotransferase Enzymes in Mice Toxicol. Sci., October 1, 2006; 93(2): 242 - 255. [Abstract] [Full Text] [PDF]

				A. L. Niklaus and J. W. Pollard Mining the Mouse Transcriptome of Receptive Endometrium Reveals Distinct Molecular Signatures for the Luminal and Glandular Epithelium Endocrinology, July 1, 2006; 147(7): 3375 - 3390. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: jpet.104.065532v1 310/2/808    most recent Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Shimada, M. Articles by Yamazoe, Y. Search for Related Content PubMed PubMed Citation Articles by Shimada, M. Articles by Yamazoe, Y.