![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TOXICOLOGY
(PPAR)-Regulated Genes and Is Ameliorated by PPAR Activation
Department of Pathology and Laboratory Medicine, University of Pennsylvania Medical Center, Philadelphia, Pennsylvania (A.A.N.); Department of Medicine, Weill Medical College of Cornell University and Nutrition Center at Strang Cancer Prevention Center, New York, New York (A.J.D.); Research Unit of Alcohol Diseases, Helsinki University Central Hospital, Helsinki, Finland (K.J.); and Department of Medicine, University of California, San Francisco, California (N.M.B.)
Received for publication
December 19, 2003
Accepted
March 10, 2004.
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
(PPAR), and peroxisomal fatty acyl CoA oxidase (FACO). Four groups of rats (n = 5) were fed intragastrically, a liquid diet with or without ethanol (10–16 g/kg/day) for 4 weeks. Pair-fed controls received isocaloric amounts of dextrose. The source of fat was either corn oil or fish oil. Ethanolfed rats developed fatty liver, necrosis, and inflammation; the changes were more severe in the fish oil-ethanol (FE) rats. PPAR mRNA levels were not different between groups, although there was a trend toward increased levels in ethanol-fed rats. We calculated L-FABP/PPAR and FACO/PPAR ratios as a measure of FACO and L-FABP up-regulation relative to PPAR expression. Both FACO/PPAR and L-FABP/PPAR ratios were significantly decreased in FE rats. However, only L-FABP/PPAR was decreased in corn oil plus ethanol rats. Also, the level of L-FABP/mRNA correlated inversely with the degree of fatty liver in ethanol-fed rats. Since expression of PPAR response genes was impaired in ethanol-fed rats, we determined whether activation of PPAR would normalize the PPAR response and prevent the pathological changes in ethanol-fed rats. Treatment with clofibrate, a PPAR-activating ligand, led to a marked decrease in fatty liver and complete abrogation of necroinflammatory changes in FE rats. Also, nuclear factor 
B activation and up-regulation of tumor necrosis factor- and cyclooxygenase-2 was also abolished in clofibrate-treated rats. We conclude that adaptive gene regulation of FACO and L-FABP by PPAR is impaired in ethanol-fed rats and that treatment with clofibrate, a PPAR ligand, prevents alcohol-induced pathological liver injury, possibly by reversing the above changes.
-oxidation pathway (Lieber and Schmid, 1961
; Reitz, 1979; Fromenty and Pessayre, 1995; Eaton et al., 1996). The importance of fatty acid utilization pathways in the maintenance of cellular lipid homeostasis in alcoholfed rats is underscored by the dramatic pathological consequences in the liver that characterize alcoholic liver disease. Inhibition of mitochondrial fatty acid metabolism, particularly in the face of enhanced fatty acid mobilization, results in enhanced oxidation of fatty acids by extramitochondrial pathways in the endoplasmic reticulum and peroxisomes (Guzman and Geelan, 1993; Lieber, 1994). The oxidation of fatty acids in the endoplasmic reticulum involves the initial formation of 
-hydroxy or (-1)-hydroxy fatty acids catalyzed by microsomal cytochromes P450, mainly those of the 4A (CYP4A) subfamily (Sharma et al., 1989; Mortenson, 1990) and CYP2E1 (Amet et al., 1994; Fukuda et al., 1994). Dicarboxylic fatty acids, derived from -hydroxy fatty acids, are increased in states of impaired mitochondrial fatty acid -oxidation (Mortensen, 1990; Bass et al., 1993b; Ma et al., 1993). Also, microsomal -hydroxylatiuon via CYP2E1 and CYP4A1 is increased in alcohol-fed rats (Amet et al., 1994, 1998; French et al., 1997). Importantly, increased generation of dicarboxylic acids because of enhanced lauryl -hydroxylase activity and failure of ethanol to induce acyl-CoA oxidase leads to augmented production of the potentially toxic dicarboxylic acids in both rats and man (Wan et al., 1995; Ma et al., 1999).
Considerable evidence points to the fact that fatty acids (Forman et al., 1997; Kliewer et al., 1997) and their -oxidation products (Gibson, 1992; Bass, 1996) activate peroxisome proliferator-activated receptors (PPARs). PPARs are members of the nuclear receptor superfamily that includes steroid, thyroid hormone, and retinoid receptors (Vamecg and Lautruffe, 1999; Kersten et al., 2000). PPARs are ligandactivated transactivating factors that enhance the transcription of a variety of target genes involved in key steps of lipid metabolism (Vanden-Heuvel, 1999). RXR is the required heterodimeric partner of PPAR; thus, RXR and PPAR are actively involved in regulating genes in fatty acid metabolism, which include enzymes of the extramitochondrial fatty acid oxidation pathways such as peroxisomal fatty acyl CoA oxidase (FACO), CYP4A1, and liver fatty acid binding protein (L-FABP) (Kaikaus et al., 1993a; Vanden-Heuvel, 1999; Wan et al., 2000). The PPAR isoform PPAR predominates in the liver (Braissant et al., 1996). The induction of hepatic extramitochondrial pathways of fatty acid oxidation via PPAR serves to provide the liver cell with alternative means for the catabolism of fatty acids under conditions of marked increased fatty acid flux and fatty acid "overload". L-FABP is clearly integral to this response and may act to reduce the toxicity of long-chain unesterified fatty acids by binding them in the cytosolic compartment and facilitating their intracellular diffusion and utilization (Bass, 1993; Bass et al., 1993a,b; Glatz and van der Vusse, 1996; Weisiger, 1996). Thus, PPAR appears to act as a cellular transducer that senses the presence of fatty acid overload states and directs the appropriate adaptive hepatocellular gene response.
In this study, we initially investigated the expression of PPAR, L-FABP, and FACO in alcohol-fed rats. For this purpose, we used the intragastric feeding rat model of alcoholic liver disease in which feeding dietary polyunsaturated fatty acids with ethanol results in the development of fatty liver, necrosis, and inflammation (Nanji and French, 1989; Nanji et al., 1989, 1994a). In particular, feeding fish oil as the source of polyunsaturated fatty acids causes more severe liver injury than when corn oil is fed with ethanol (Nanji et al., 1994b). We observed that expression of PPAR response genes was impaired in animals exhibiting pathological liver damage. We reasoned that strong activation of PPAR would normalize the PPAR-mediated gene response and prevent the pathological changes associated with liver injury in alcohol-fed rats. We used clofibrate, a potent PPAR ligand/activator, to test this hypothesis. Our findings indicate that pharmacological PPAR activation can prevent not only the pathological manifestations of alcohol-induced perturbations in fatty acid metabolism but also alcohol-induced biochemical and histological inflammatory changes in liver.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
; Tsukamoto et al., 1990). The diets contained corn oil plus dextrose (CD) or ethanol (CE) or fish oil plus dextrose (FD) or ethanol (FE). Dietary fatty acids contributed 35% of total calories. The diet also contained protein, minerals, and vitamins as described previously (French et al., 1986; Tsukamoto et al., 1990). The amount of ethanol administered was initially 10 g/kg/day and increased up to 16 g/kg/day as tolerance developed. Blood alcohol levels were maintained between 150 and 350 mg/dl. All animals were killed 4 weeks after the start of feeding. The care of animals and euthanasia procedures were in accordance with the National Institutes of Health criteria for use of laboratory animals. In the second part of the study, four groups of rats (six rats/group) were studied to evaluate the effect of clofibrate on the pathological and biochemical changes. Rats in the first group were fed FE for 4 weeks, the second group was administered FE plus clofibrate, and the third group received fish oil dextrose plus clofibrate. The control group was fed fish oil and dextrose. Clofibrate (given as clofibric acid, dissolved in 2% Tween 80) was given daily via intragastric tube at a dose of 100 mg/kg body weight. After killing, a portion of the liver was obtained for histopathological analysis, and the remainder was placed in liquid nitrogen and stored at -80°C until analysis.
Histopathology. A small sample of the liver was obtained and formalin-fixed when the rats were killed. Hematoxylin and eosin stain was used for light microscopy. The severity of liver pathology was assessed as follows: steatosis (the percentage of liver cells containing fat) was scored 1+ with <25% of the cells containing fat; 2+, with 26 to 50% of the cells containing fat; 3+, with 51 to 75% of the cells containing fat; and 4+, with >75% of the cells containing fat. Necrosis was quantified as the number of necrotic foci per square millimeter, and inflammation was scored as the number of inflammatory cells per square millimeter. At least three different sections were examined per sample liver. The pathologist evaluating the sections was unaware of the treatment groups when assessing the histology.
RNA Preparation and Northern Blots. [-32P]dCTP (3000 Ci/mol) was obtained from Amersham Biosciences Inc. (Piscataway, NJ). The cRNA probe for L-FABP was prepared from plasmid pTZ 18R-L-FABP as previously described (Kaikus et al., 1993). For transcription of the cRNA for ribosomal protein S14, the cDNA for human ribosomal protein S14 was excised from plasmid pCS14-19 (Rhoads et al., 1986) with PstI and ligated in sense orientation into the unique PstI site in vector pGEM-4Z (Promega, Madison, WI). For the synthesis of cRNA probes for rat FACO and PPAR, the following plasmids were constructed. A 501-base pair fragment of the rat peroxisomal fatty acyl CoA oxidase cDNA encompassing bases 268 to 769 from the transcription start site was synthesized by reverse transcription-polymerase chain reaction (RT-PCR) as previously described (Kaikus et al., 1993) and directly cloned into pCRII (Invitrogen, Carlsbad, CA) using the protocol suggested by the manufacturer. A 568-base pair rat PPAR cDNA encoding the ligand-binding domain of the receptor (Gottlicher et al., 1992) was synthesized from total rat liver RNA by reverse transcription-PCR for 30 cycles in a 9600 Thermocycler (PerkinElmer Life and Analytical Sciences, Boston, MA), using primers GCCAGTGCATGTCCGTGGACA (upstream, nucleotides 993-1016) and TCTGTAGATCTCTTGCAACAGTGG (downstream, nucleotides 1561–1538). The cDNA was purified by gel electrophoresis, blunted with Klenow fragment, end-adapted with EcoRI linkers, and ligated into the EcoRI site of plasmid pGEM-11Zf(+) (Promega) as previously described (Rhoads et al., 1986). Following amplification of plasmid constructs in Escherichia coli JM101, orientation was determined by restriction mapping, and the antisense [-32P]dCTP-labeled cRNA probes were transcribed from the linearized plasmids using either T7 or SP6 DNA polymerase, depending on cDNA orientation, using a MAXIscript in vitro transcription kit (Ambion, Austin, TX) as described (Enoch et al., 1986; Wang et al., 1989).
Total RNA was extracted from 0.05- to 0.1-g pieces of liver following homogenization in 5 volumes of Trizol reagent (Invitrogen) according to the method of Chomczynski and Sacchi (1997). Total cellular RNA (10–20 µg) was fractionated on a 0.8% agarose-2.2 M formaldehyde gel and blotted on nylon membranes (Hybond-N; Amersham Biosciences Inc.) by capillary transfer. Hybridization to cRNA probes was performed as previously described (Enoch et al., 1986; Kaikaus et al., 1993c). Hybridizations with RNA blots were carried out overnight at 50°C except in the case of the L-FABP probe for which hybridizations were conducted at 65°C, and the final wash was also at 65°C. Membranes were washed once for 15 min at room temperature in 2x SSC and 0.1% SDS and then for 15 min at room temperature in 1x SSC and 0.1% SDS. Normalization for input RNA was done by rehybridizing the blots with the ribosomal protein S14 cRNA probe. Prior to reprobing, membranes were stripped by washing with H2Oat100°C. Autoradiography was performed by exposing hybridized blots to Kodak X-OMAT AR for 24 h (Eastman Kodak, Rochester, NY). Signal densities for each mRNA were quantified by densitometric analysis of the autoradiograms. Complete removal of probes was confirmed autoradiographically.
Determination of Thiobarbituric Acid-Reactive Substances and Conjugated Dienes. Levels of liver thiobarbituric acid-reactive substances (TBARS) were measured according to the method of Ohkawa et al. (1979). Conjugated dienes in the total lipid extracted from liver homogenates were identified by optical density between 220 and 300 nm as previously described (Nanji et al., 1995).
Determination of NF-B Binding Activity and IB- Protein Levels in Liver. Electrophoretic mobility shift assays were used to determine the binding activity of NF-B and were performed essentially as described in prior studies (Liu et al., 1995; Lin et al., 1997; Nanji et al., 1999). Equal amounts of nuclear protein were incubated with a 5' 32P-labeled oligonucleotide containing the NF-B consensus site. The incubation mixtures were separated in a 7% nondenaturing polyacrylamide gel, and bands were detected by autoradiography. The specificity of binding was determined by prior addition of 100-fold excess of unlabeled competitor consensus oligonucleotide and supershift analysis (Nanji et al., 1999).
Western blot analysis for IB- was conducted using 50 µg of cytosolic protein. Samples were electrophoresed on a 10% sodium dodecyl sulfate-polyacrylamide gel, and proteins were then electroblotted onto polyvinyldine diflouride membranes (Sigma-Aldrich, St. Louis, MO). Membranes were incubated with the primary antibody against IB- (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) at a dilution of 1:500 in 1% nonfat milk Tween phosphate-buffered saline. Membranes were then incubated with a secondary antibody (horse-radish peroxidase-conjugated goat anti-rabbit immunoglobulin G) at a dilution of 1:10,000.
Determination of mRNA Levels for TNF-, COX-2, COX-1, and -Actin. To examine the expression of COX-1, COX-2, TNF-, and -actin in liver tissue, total RNA was isolated according to the guanidinium isothiocyanate method (Chomczynski and Sacchi, 1997). The integrity of RNA was assessed by agarose gel electrophoresis and ethidium bromide staining. RT-PCR was performed as previously described (Nanji et al., 1997a,b). The sequences of primer pairs, 5' and 3', and predicted sizes of the amplified PCR fragments of COX-1, COX-2, TNF-, and -actin have been reported (Nanji et al., 1994b,c, 1997a,b; Kono et al., 2000). PCR products and molecular size markers were subjected to electrophoresis on 1% agarose gels and visualized by means of ethidium bromide staining. Each experiment included a negative control (sample RNA that had not been subjected to RT). This sample did not yield a PCR product confirming the absence of extraneous genomic DNA or PCR products contaminating the samples. Varying the number of PCR cycles did not change the relative differences between the samples, indicating that the PCR conditions were not within the plateau phase of amplification. All amplification reactions of one experiment were performed in parallel in the same heating block to ensure compatible conditions.
Statistical Analysis. Data are presented as mean ± S.D. Statistical comparison between different groups was done using analysis of variance using the Student-Newman-Keuls or Bonferroni multiple comparison post hoc tests as applicable. For comparison of pathological scores, the Mann-Whitney test was used. A p value of <0.05 was considered significant.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
Alterations in the Expression of PPAR and PPAR-Regulated Genes. Changes in the mRNA levels for PPAR, CYP4A1, FACO, and L-FABP, corrected for ribosomal S14 mRNA levels, are shown in Fig. 2. Neither PPAR nor FACO showed any significant changes between groups, although there were trends toward increased PPAR in the alcohol-fed animals and toward increased FACO in the CE rats. CYP4A1 mRNA levels were significantly higher in the CE, FD, and FE groups compared with the CD group. L-FABP mRNA was significantly reduced in FE rats compared with the FD group (p < 0.05).
|
Expression of L-FABP in Relationship to the Severity of Fatty Liver. L-FABP, by promoting cellular transport and utilization of fatty acids, may affect the amount of fat accumulation in the liver in response to ethanol feeding. To assess a role for L-FABP in the pathogenesis of fatty liver, the level of L-FABP mRNA was correlated with the severity of fatty liver in ethanol-fed rats. The lowest level of L-FABP expression was seen in FE rats, the group that developed the most severe degree of fatty liver (Fig. 3). For all the ethanol-fed animals, a significant inverse correlation was seen between the degree of fatty liver and L-FABP mRNA (r = 0.86, p < 0.01) (Fig. 3). Dextrose-fed animals were not included in the correlation analysis since none of the animals in these groups developed fatty liver.
|
Relationship between PPAR, FACO, and L-FABP Expression. Since the expression of FACO and L-FABP is regulated by PPAR, we calculated FABP/PPAR and FACO/PPAR ratios in the different experimental groups to determine the relative magnitude of FACO and L-FABP mRNA responses to changes in PPAR mRNA abundance (Fig. 4). The lowest FACO/PPAR ratio was seen in the FE group, which was significantly decreased compared with the other (p < 0.05) groups. The L-FABP/PPAR ratios were decreased in both ethanol-fed groups, with a significant reduction in both the CE and FE groups compared with dextrose-fed controls (Fig. 4). Thus, in the corn oil-ethanol group, only the L-FABP/PPAR ratio was decreased, whereas in the fish oil-ethanol groups, both the L-FABP/PPAR and FACO/PPAR ratios were decreased.
|
Clofibrate Treatment Significantly Reduced the Severity of Fatty Liver and Lipid Peroxidation in Ethanol-Fed Rats. As shown in the first part of the study, feeding the fish oil-ethanol diet caused severe fatty liver, necrosis, and inflammation (Table 2). Treatment with clofibrate led to a marked decrease in the severity of fatty liver and inflammation (Fig. 5). Additionally, clofibrate treatment decreased levels of conjugated dienes and TBARS in ethanolfed rats (Table 2). There were no pathological changes seen in the fish oil-dextrose- and fish oil-dextrose-clofibrate-treated rats. We have also previously shown that Tween 80 does not induce liver pathology in rats and has no ameliorating effect on liver pathology in fish oil-ethanol-fed rats (unpublished data).
|
|
Clofibrate Treatment Abrogates Necroinflammatory Changes, NF-B Activation, and Up-Regulation of TNF- and COX-2. Rats fed fish oil and ethanol developed necrosis and inflammation, which was prevented in rats treated with clofibrate (Table 2). To evaluate activation of NF-B, electrophoretic mobility shift assay of nuclear extracts from whole liver were carried out. NF-B activation was increased in fish oil-ethanol-fed rats; activation was absent in the clofibrate and dextrose-fed groups (Fig. 6). To confirm the specificity of the protein/DNA complex, a 100-fold excess of unlabeled NF-B or STAT oligonucleotide was added to the electrophoretic mobility shift assay binding reaction (Nanji et al., 1999). Addition of NF-B oligonucleotide abrogated complex formation, and addition of STAT3 oligonucleotide had no effect (data not shown).
|
Effect of Clofibrate on COX-2 and TNF-. We have previously proposed that COX-2 and TNF- contribute to alcohol-induced pathological changes in the liver (Nanji et al., 1994c, 1997a). Thus, we also measured the effect of clofibrate on levels of mRNA for TNF-, COX-2, COX-1, and -actin. Since the levels of mRNA are too low to be detected by Northern blot or ribonuclease protection assay (Nanji et al., 1994c), we used RT-PCR for these measurements. Rats fed fish oil and ethanol showed increased levels of COX-2 and TNF- mRNA, and treatment with clofibrate down-regulated their expression (Fig. 6B). The level of COX-1 mRNA, the constitutive isoform of COX, was similar in all groups.
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
). It has been suggested that impaired mitochondrial oxidation of long-chain fatty acid results in "fatty acid overload", whereby fatty acids that accumulate in the cell are diverted into esterification (triglyceride synthesis) and extramitochondrial fatty acid oxidation pathways (Kaikaus et al., 1993b; Ockner et al., 1993). The latter consists of -oxidation in the endoplasmic reticulum and -oxidation in the peroxisomes. The fatty acid overload hypothesis indicates a role for long-chain fatty acids in producing the hepatotoxic sequelae associated with conditions such as alcoholism that cause impaired fatty oxidation.
Effect of Alcohol on PPAR-Regulated Genes. or -1 hydroxylation of fatty acids is catalyzed by CYP4A1 and CYP2E1 (Amet et al., 1994). Both CYP2E1 and CYP4A1 are increased in rats fed ethanol and polyunsaturated fatty acids and are expressed in a predominantly perivenular distribution (Tsutsumi et al., 1989; Bell et al., 1992), which is also the site at which the most severe pathological injury occurs in alcoholic liver disease (Lieber, 1994). Therefore, alcohol-induced perturbations in cytochrome P450-dependent metabolism of fatty acids are of considerable interest because metabolites of fatty acids generated via P450-dependent oxidative pathways, such as dicarboxylic acids and other long-chain fatty acid metabolites, are potential regulators of gene expression (Duplus et al., 2000).
A key mechanism by which fatty acids and fatty acid metabolites affect gene expression is via the activation of PPARs, which are members of the nuclear receptor superfamily of transactivating factors that mediate the pleiotropic hepatic response to peroxisome proliferator xenobiotics (Vamecg and Lautruffe, 1999; Vanden-Heuvel, 1999; Kersten et al., 2000). Several lines of evidence suggest that PPAR, the major isoform in liver, induces enzymes of the peroxisomal -oxidation pathway and L-FABP (Duplus et al., 2000). Thus, PPAR acts as a cellular "lipostat" that transduces alterations in levels of cellular fatty acids to regulation of genes involved in the utilization of fatty acids. In alcohol-fed rats, therefore, PPAR-mediated up-regulation of FACO and L-FABP would appear to be an appropriate and important adaptive response in the prevention of cell toxicity resulting from the accumulation of free fatty acids. Scrutiny of the FACO/PPAR and L-FABP/PPAR mRNA ratios in the ethanol-fed rats provides evidence for an impaired PPAR-mediated up-regulation of FACO and L-FABP (Fig. 4). In particular, rats that had the most severe liver injury (fish oil and ethanol) had decreased ratios of both FACO/PPAR and L-FABP/PPAR. In contrast, rats fed corn oil and ethanol had less severe liver injury and had a decreased FACO/PPAR ratio only. Furthermore, an inverse correlation between L-FABP and degree of fatty liver was observed (Fig. 3). L-FABP is believed to facilitate the intracellular transport and utilization of long-chain fatty acids and protects cells from the deleterious effects of free fatty acids (Bass, 1996; Fan et al., 1998). Furthermore, L-FABP may serve to increase the threshold for fatty acid and fatty acyl metabolite activation of PPAR and thus prevent chronic induction of the peroxisomal -oxidation pathway and generation of toxic oxygen species (Bass, 1996).
In support of the interpretation of the results of this study, reduced expression of genes controlled by PPAR is seen in PPAR-null mice (Lee et al., 1995), which also show markedly increased liver fat accumulation with fasting (Hashimoto et al., 2000) and aging (Costet et al., 1998). In addition, mice with homozygous disruption of the gene expressing FACO develop steatohepatitis at an early age (Fan et al., 1998). Our data point to a similar scenario in alcohol-fed rats where a failure of up-regulation (or even down-regulation) of PPAR-responsive genes under conditions of alcohol-related increased fatty acid flux in the liver may contribute to the observed pathological changes in the liver. The recent finding that ethanol impairs induction of PPAR-controlled genes in hepatoma cells (Galli et al., 2001) is consistent with our in vivo observations. Also consistent with our observations is the study by Fischer et al. (2003) who evaluated the effect of ethanol feeding on PPAR-mediated responses in C57BL/6J mice. Ethanol decreased PPAR/retinoid X receptor binding in electromobility shift assays in liver nuclear extracts. mRNA levels for PPAR-regulated genes such as long-chain and medium-chain acyl CoA dehydrogenases were reduced or failed to be induced in the rate of fatty oxidation. The mice showed development of fatty liver only, which is in contrast to the presence of fatty liver necrosis inflammation and fibrosis seen in the rat intragastric feeding model used in the current study.
Effect of Clofibrate on Fatty Liver Alcohol-Fed Rats. Based on the observation in the present study that decreased levels of PPAR-responsive genes contribute or are at least permissive to alcoholic liver injury, it was of interest to determine whether administration of clofibrate, a potent activator of PPAR, would ameliorate the adverse effects of alcohol on the liver. Clofibrate, in addition to being a PPAR ligand, also stimulates the transport of fatty acids in hepatocytes (Milliano and Luxon, 2001) and increases levels of L-FABP (Kaikaus et al., 1993c). Clofibrate administration to ethanol-fed rats led to a marked decrease in the degree of fatty liver (Table 2; Fig. 5). Although we did not directly evaluate PPAR-regulated gene expression in the clofibrate-treated rats, it is reasonable to assume in light of our previous and other studies (Bass et al., 1989; Kaikaus et al., 1993a; Luxon et al., 2000; Milliano and Luxon, 2001) that clofibrate treatment restored the parameters such as L-FABP and FACO that are down-regulated by ethanol.
Effect of Clofibrate on Inflammatory Changes in Liver. It has been shown that PPAR may also be involved in modulating the inflammatory response. Mice lacking PPAR display a prolonged response to inflammation, indicating that PPAR has an anti-inflammatory action (Kersten et al., 2000). Oxidant stress in alcoholic liver injury results in activation of NF-B and up-regulation of pro-inflammatory mediators such as TNF- and COX-2 (Nanji et al., 1999). The studies presented herein demonstrated that administration of a specific PPAR activator reduced the ethanol-induced inflammatory changes, elevation in NF-B activity and expression of TNF- and COX-2. Activation of PPAR has previously been shown to decrease activation of NF-B and inflammatory cytokine production as a result of oxidative stress (Poynter and Daynes, 1998). Fibrates inhibit activation of NF-B by inducing IB- expression (Delerive et al., 2000). The results in the present study show that a reduction in NF-B activity in clofibrate-treated-rats was accompanied by stabilization of IB; whether the absence of changes in the amount IB in the livers of clofibrate-treated rats is due to failure of degradation or increased synthesis cannot be deduced from these experiments. Down-regulation of NF-B activation was accompanied by a decrease in the NF-B-regulated genes, TNF- and COX-2.
Relevance to Human Alcoholic Liver Disease. The relevance of our findings to human alcoholic liver disease needs to be considered. Human and rodent responses to inhibition of mitochondrial fatty acid oxidation are different (Vamecg and Lautruffe, 1999; Galli and Crabb, 2000). For example, in rodents, the initial insult is counteracted by strong peroxisomal and moderate mitochondrial induction of -oxidation pathways (Vamecg and Lautruffe, 1999). In humans, strong induction of mitochondrial -oxidation occurs, but peroxisomal -oxidation is not induced (Vamecg and Lautruffe, 1999). A marked difference between rodents and humans in the response of hepatocyte genes to PPAR activation is well recognized (Chevalier and Roberts, 2000). Reasons for the lack of responsiveness of human liver to potent PPAR activators include an order of magnitude lower level of PPAR expression in liver (Palmer et al., 1998), and, at least in the case of FACO, an inactive peroxisome proliferator response element motif within the gene promoter (Lambe et al., 1999). There is also evidence for an increased frequency of a functional PPAR mutation in humans with nonalcoholic steatohepatitis (Merrimen et al., 2001). Thus, available evidence, including the results of the present study, supports a protective role for the PPAR-mediated gene response in liver under conditions of fatty acid overload. This adaptive transcriptional pathway may be less robust in humans than in rodents, whereas varying degrees of impairment of this mechanism may be a determinant of individual susceptibility to fatty liver disease. The role of impaired peroxisomal -oxidation and disturbances in PPAR-inducible genes in steatosis and steatohepatitis has been reviewed recently (Reddy, 2001).
In summary, we have shown that peroxisomal -oxidation and L-FABP responses to PPAR are impaired in ethanol-fed rats and that the severity of fatty liver correlates inversely with the level of L-FABP. Treatment with clofibrate, a potent PPAR-activating ligand, prevented ethanol-induced oxidative stress, fat accumulation, and inflammatory changes in the liver. If the results shown here for rats hold true for humans, the pharmacological manipulation of PPAR might allow for the treatment of alcoholic liver disease.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
ABBREVIATIONS: PPAR, peroxisome proliferator-activated receptor; RXR, retinoid X receptor; FACO, fatty acyl CoA oxidase; L-FABP, liver fatty acid binding protein; CD, corn oil plus dextrose; CE, corn oil plus ethanol; FD, fish oil-dextrose; FE, fish oil-ethanol; RT, reverse transcription; PCR, polymerase chain reaction; TBARS, thiobarbituric acid-reactive substances; NF-B, nuclear factor B; TNF, tumor necrosis factor; COX, cyclooxygenase.
Address correspondence to: Dr. Amin A. Nanji, Department of Pathology and Laboratory Medicine, University of Pennsylvania Medical Center, 3400 Spruce Street, Founders 7.103, Philadelphia, PA 19104-4283. E-mail: amin.nanji{at}uphs.upenn.edu
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Amet Y, Adas F, and Nanji AA (1998) Fatty acid omega-and (omega-1)–hydroxylation in experimental alcoholic liver disease: relationship to different dietary fatty acids. Alcohol Clin Exp Res 22: 1493-1500.[Medline]
Amet Y, Berthou F, Goasduff T, Salaun JP, Breton L, and Menez JF (1994) Evidence that cytochrome P450 2E1 is involved in the (omega-1)-hydroxylation of lauric acid in rat liver microsomes. Biochem Biophys Res Commun 203: 1168-1174.[CrossRef][Medline]
Bass NM (1993) Cellular binding proteins for fatty acids and retinoids: similar or specialized functions? Mol Cell Biochem 123: 191-202.[CrossRef][Medline]
Bass NM (1996) Interaction of fatty-acid binding-proteins (FABP) with the peroxisome proliferator-activated receptor alpha (PPAR): evidence for FABP modulation of the gene response to fatty acid overload, in Frontiers in Bioactive Lipids (Vanderhoek JY ed). XXVI Washington International Spring Symposium on Bioactive Lipids, 1995, Washington, DC, pp 67-72, Plenum Press, New York.
Bass NM, Barker ME, Manning JA, Jones AL, and Ockner RK (1989) Acinar heterogeneity of fatty acid binding protein expression in the livers of male female and clofibrate-treated rats. Hepatology 9: 12-21.[Medline]
Bass NM, Kaikaus RM, and Ockner RK (1993a) Physiology and molecular biology of hepatic cytosolic fatty acid-binding protein, in Hepatic Transport and Bile secretion: Physiology and Pathophysiology (Tavaloni N and Berk PD eds) pp 421-446, Raven Press, New York.
Bass NM, Sadovsky Y, Appel RA, and Kushner PJ (1993b) Dicarboxylic fatty acids activate the peroxisome-proliferator-activated receptor (PPAR) in rat HTC hepatoma cells. Hepatology 18: 125A.
Bell DR, Bars RG, and Elcombe CR (1992) Differential tissue-specific expression and induction of cytochrome P450IVA1 and acyl-CoA oxidase. Eur J Biochem 206: 979-986.[Medline]
Braissant O, Foufelle F, Scotto C, Dauca M, and Wahli W (1996) Differential expression of peroxisome proliferator-activated receptors (PPARs): tissue distribution of PPAR-alpha, -beta, and -gamma in the adult rat. Endocrinology 137: 354-366.[Abstract]
Chevalier S and Roberts RA (2000) Perturbation of rodent hepatocyte growth control by nongenotoxic hepatocarcinogens: mechanism and lack of relevance for human health. Oncol Res 5: 1319-1327.
Chomczynski P and Sacchi N (1997) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chlofoform extraction. Anal Biochem 162: 156-159.[CrossRef]
Costet P, Legendre C, More J, Edgar A, Galtier P, and Pineau T (1998) Peroxisome proliferator-activated receptor alpha-isoform deficiency leads to progressive dyslipidemia with sexually dimorphic obesity and steatosis. J Biol Chem 273: 29577-29585.
Delerive P, Gervois P, Fruchart JC, and Staels B (2000) Induction of IkappaBalpha expression as a mechanism contributing to the anti-inflammatory activities of peroxisome proliferator-activated receptor-alpha activators. J Biol Chem 275: 36703-36707.
Duplus E, Glorian M, and Forest C (2000) Fatty acid regulation of gene transcription. J Biol Chem 275: 30749-30752.
Eaton S, Zaitoun AM, Record CO, and Bartlett K (1996) -Oxidation in human alcoholic and non-alcoholic hepatic steatosis. Clin Sci 90: 307-313.[Medline]
Enoch T, Zinn K, and Maniatis T (1986) Activation of the human beta-interferon gene requires an interferon-inducible factor. Mol Cell Biol 6: 801-810.
Fan CY, Pan J, Ususa N, Yeldandi AV, Rao MS, and Reddy JK (1998) Steatohepatitis, spontaneous peroxisome proliferation and liver tumors in mice lacking peroxisomal fatty acyl-CoA oxidase: implications for peroxisome proliferator-activated receptor alpha natural ligand metabolism. J Biol Chem 273: 15639-15646.
Fischer M, You M, Matsumoto M, and Crabb DW (2003) Peroxisome proliferator-activated receptor (PPAR) agonist treatment reverses PPAR dysfunction and abnormalities in hepatic lipid metabolism in ethanol-fed mice. J Biol Chem 278: 27997-28004.
Forman BM, Chen J, and Evans RM (1997) Hypolipidemic drugs, polyunsaturated fatty acids and eicosanoids are ligands for peroxisome proliferator-activated receptors alpha and delta. Proc Natl Acad Sci USA 94: 4312-4317.
French SW, Miyamoto K, and Tsukamoto H (1986) Ethanol-induced fibrosis in the rat: role of the amount of dietary fat. Alcohol Clin Exp Res 10: 13S-19S.[Medline]
French SW, Morimoto M, Reitz RC, Koop D, Klopfenstein B, Estes K, Clot P, Ingelman-Sundberg M, and Albano E (1997) Lipid peroxidation, CYP E21 and arachidonic acid metabolism in alcoholic liver disease in rats. J Nutr 127: 9075-9115.
Fromenty B and Pessayre D (1995) Inhibition of mitochondrial beta-oxidation as a mechanism of hepatoxicity. Pharmacol Ther 67: 101-154.[CrossRef][Medline]
Fukuda T, Imai Y, Komori M, Nakamura M, Kusunose E, Satouchi K, and Kususnose M (1994) Different mechanisms of regioselection of fatty acid hydroxylation by laurate (-1) hydroxylating P450s P450 2C2 and P450 2EI. J Biochem 115: 338-344.
Galli A, Pinnaire J, Fischer M, Dorris R, and Crabb DW (2001) The transcriptional and DNA binding activity of peroxisome proliferator-activated receptor is inhibited by ethanol metabolism. J Biol Chem 276: 68-75.
Galli EL and Crabb D (2000) The role of hepatic peroxisome proliferator-activated receptors (PPARs) in health and disease. Liver 20: 191-199.[CrossRef][Medline]
Gibson GG (1992) Co-induction of cytochrome P450 IV A1 and peroxisome proliferation: a causal or casual relationship? Xenobiotica 22: 1101-1109.[Medline]
Glatz JF and van der Vusse GJ (1996) Cellular fatty acid-binding proteins: their function and physiological significance. Prog Lipid Res 35: 243-282.[CrossRef][Medline]
Gottlicher M, Widmark E, Li Q, and Gustafsson JA (1992) Fatty acids activate a chimera of the clofibric acid-activated receptor and the glucocorticoid receptor. Proc Natl Acad Sci USA 89: 4653-4657.
Guzman M and Geelan MJ (1993) Regulation of fatty acid oxidation in mammalian liver. Biochem Biophys Acta 1167: 227-241.[Medline]
Hashimoto T, Cook WS, Qi C, Yeldani AV, Reddy JK, and Rao MS (2000) Defect in peroxisome-proliferator activated receptor -inducible fatty acid oxidation determines the severity of hepatic steatosis in response to fasting. J Biol Chem 275: 28918-28928.
Kaikaus RM, Chan WK, Lysenko N, Ray R, Ortiz de Montellano PR, and Bass NM (1993a) Induction of peroxisomal fatty acid -oxidation and liver fatty acid-binding protein by peroxisome proliferators: mediation via the cytochrome P450 IV A1 -hydroxylase pathway. J Biol Chem 268: 9593-9603.
Kaikaus RM, Chan WK, Ortiz de Montellano PR, and Bass NM (1993b) Mechanisms of regulation of liver fatty acid-binding protein. Mol Cell Biochem 123: 93-100.[CrossRef][Medline]
Kaikus RM, Sui Z, Lysenko N, Wu NY, Ortiz de Montellano P, Ockner RK, and Bass NM (1993c) Regulation of pathways of extramitochondrial fatty acid oxidation and liver fatty acid binding protein by long chain monocarboxylic fatty acids in hepatocytes: effect of inhibition of carnitine palmitoyltransferase. J Biol Chem 268: 26866-26871.
Kersten S, Desvergne B, and Wahli W (2000) Roles of PPARs in health and disease. Nature (Lond) 405: 421-424.[CrossRef][Medline]
Kliewer SA, Sundseth SS, Jones SA, Brown PJ, Wisely GB, Koble CS, Devchand P, Wahli W, Wilson TM, Lenhard JM, et al. (1997) Fatty acids and eicosanoids regulate gene expression through direct interactions with peroxisome proliferator-activated receptors alpha and gamma. Proc Natl Acad Sci USA 94: 4318-4323.
Kono H, Wheeler MD, Rusyn I, Lin M, Seabra V, Rivera CA, Bradford BU, and Thurman RG (2000) Gender differences in early alcohol-induced liver injury: role of CD14, NF-B and TNF-. Am J Physiol Gastrointest Liver Physiol 278: G652-G661.
Lambe KG, Woodyatt NJ, Macdonald N, Chevalier S, and Roberts RA (1999) Species differences in sequence and activity of the peroxisome proliferator response element (PPRE) with the acyl CoA oxidase gene promoter. Toxicol Lett 110: 119-127.[CrossRef][Medline]
Lee SS, Pineau T, Drago J, Lee EJ, Owens JW, Kroetz DL, Fernandez-Salguero PM, Westphal H, and Gonzalez FJ (1995) Targeted disruption of the alpha isoform of the peroxisome proliferator-activated receptor gene in mice results in abolishment of the pleiotropic effects of peroxisome proliferators. Mol Cell Biol 15: 3012-3022.[Abstract]
Lieber CS and Schmid R (1961) The effect of ethanol on fatty acid metabolism: stimulation of hepatic fatty acid synthesis in vitro. J Clin Investig 40: 394-399.
Lieber CS (1994) (1997) Alcohol and the liver: 1994 update. Gastroenterology 106: 1085-1105.[Medline]
Lin M, Rippe RA, Niemela O, Britteham G, and Tsukamoto GH (1997) Role of iron in NF-B activation and cytokine gene expression by rat hepatic macrophages. Am J Physiol 272: G1355-G1364.
Liu SL, Espositi SD, Yao L, Diehl AM, and Zern MA (1995) Vitamin E therapy for acute CC14-induced hepatic injury is associated with inhibition of nuclear factor kappa B binding. Hepatology 22: 1474-1481.[CrossRef][Medline]
Luxon BA, Milliano M, and Weisinger RA (2000) Induction of hepatic cytosolic fatty acid binding protein with clofibrate accelerants both membrane and cytoplasmic transport of palmitate. Biochem Biophys Acta 1487: 309-318.[Medline]
Ma X, Baraona E, Goozner BG, and Lieber CS (1999) Gender differences in medium chain dicarboxylic aciduria in alcoholic men and women. Am J Med 106: 70-75.[CrossRef][Medline]
Ma XL, Baraona E, and Lieber CS (1993) Alcohol consumption enhances fatty acid omega-oxidation with a greater increase in male than in female rats. Hepatology 18: 1247-1253.[CrossRef][Medline]
Merrimen RB, Aouizerat BE, Molly MJ, Kane JP, Bacon B, and Bass NM (2001) A genetic mutation in the peroxisome proliferator-activated receptor alpha gene in patients with non-alcoholic steatohepatitis. Hepatology 34: 441A.[CrossRef]
Milliano M and Luxon BA (2001) The peroxisomal proliferator clofibrate enhances the hepatic cytoplasmic movement of fatty acids in rats. Hepatology 33: 413-418.[CrossRef][Medline]
Mortensen PB (1990) Mechanism of dicarboxylic aciduria and dicarboxylic acid metabolism, in Fatty Acid Oxidation: Clinical Biochemical and Molecular Aspects (Tanaka K and Coats PM eds) pp 249-264, Liss, New York.
Nanji AA and French SW (1989) Dietary linoleic acid is required for development of experimental alcoholic liver disease. Life Sci 44: 223-227.[CrossRef][Medline]
Nanji AA, Jokelainen K, Rahemtulla A, Miao L, Fogt F, Matsumoto H, Tahan SR, and Su GL (1999) Activation of nuclear factor kappa B and cytokine imbalance in experimental alcoholic liver disease in the rat. Hepatology 30: 934-943.[CrossRef][Medline]
Nanji AA, Khwaja S, Tahan SR, and Sadrzadeh SMH (1994a) Plasma levels of a novel noncyclooxygenase-derived prostanoid (8-isoprostane) correlates with a severity of liver injury in experimental alcoholic live disease. J Pharmacol Exp Ther 269: 1280-1285.
Nanji AA, Mendenhall CL, and French SW (1989) Beef fat prevents alcoholic liver disease in the rat. Alcohol Clin Exp Res 13: 15-19.[CrossRef][Medline]
Nanji AA, Miao L, Thomas P, Rahemtulla A, Khwaja S, Zhao S, Peters D, Tahan SR, and Dannenberg AJ (1997a) Enhanced cyclooxygenase-2 gene expression in alcoholic liver disease in the rat. Gastroenterology 112: 943-951.[CrossRef][Medline]
Nanji AA, Sadrzadeh SMH, Yang EK, Fogt F, Meydani M, and Dannenberg AJ (1995) Dietary saturated fatty acids: a novel treatment for alcoholic liver disease. Gastroenterology 109: 547-554.[CrossRef][Medline]
Nanji AA, Zakim D, Rahemtulla A, Daly T, Miao L, Zhao S, Khwaja S, Tahan SR, and Dannenberg AJ (1997b) Dietary saturated fatty acids down-regulate cyclooxygenase-2 and tumor necrosis factor- and reverse fibrosis in alcoholic liver disease in the rat. Hepatology 26: 1538-1545.[CrossRef][Medline]
Nanji AA, Zhao S, Sadrzadeh SM, Dannenberg AJ, Tahan SR, and Waxman DJ (1994b) Markedly enhanced cytochrome P450 2E1 induction and lipid peroxidation is associated with severe liver injury in fish oil-ethanol fed rats. Alcohol Clin Exp Res 18: 1280-1285.[CrossRef][Medline]
Nanji AA, Zhao S, Sadrzadeh SM, and Waxman DJ (1994c) Use of reverse transcription PCR to evaluate in-vivo cytokine gene expression in rats fed ethanol for long periods of time. Hepatology 19: 1483-1487.[CrossRef][Medline]
Ockner RK, Kaikaus RM, and Bass NM (1993) Fatty-acid metabolism and the pathogenesis of hepatocellular carcinoma: review and hypothesis. Hepatology 18: 669-676.[CrossRef][Medline]
Ohkawa H, Ohisis N, and Yagi K (1979) Assay for lipid peroxidation in animal tissues by thiobarbituric acid reaction. Anal Biochem 95: 351-358.[CrossRef][Medline]
Palmer CN, Hsu MH, Griffin KJ, Raucy JL, and Johnson EF (1998) Peroxisome proliferator activated receptor-alpha expression in human liver. Mol Pharmacol 53: 14-22.
Poynter ME and Daynes RA (1998) Peroxisome proliferator-activated receptor alpha activation modulates cellular redox status represses nuclear factor-kappaB signaling and reduces inflammatory cytokine production in aging. J Biol Chem 273: 32833-32841.
Reddy J (2001) Non alcoholic steatosis and steatohepatitis: III. Peroxisomal -oxidation PPAR and steatohepatitis. Am J Physiol Gastrointest Liver Physiol 281: G1333-G1339.
Reitz RC (1979) The effects of ethanol ingestion on lipid metabolism. Prog Lipid Res 18: 87-115.[CrossRef][Medline]
Rhoads DD, Dixit A, and Roufa DJ (1986) Primary structure of human ribosomal protein S14 and the gene that encodes it. Mol Cell Biol 2774-2783.
Sharma RK, Doig MV, Lewis DF, and Gibson GG (1989) Role of hepatic and renal cytochrome P450 IV A1 the metabolism of lipid substrates. Biochem Pharmacol 38: 3621-3629.[CrossRef][Medline]
Tsukamoto H, Gaal K, and French SW (1990) Insights into the pathogenesis of alcoholic liver necrosis and fibrosis: status report. Hepatology 12: 599-608.[Medline]
Tsutsumi M, Lasker J, Simizu M, Rosmen A, and Lieber CS (1989) The intralobular distribution of ethanol-inducible P450 IIE1 in rat and human liver. Hepatology 10: 437-446.[Medline]
Vamecg J and Lautruffe N (1999) Medical significance of peroxisome proliferator-activated receptors. Lancet 354: 141-148.[CrossRef][Medline]
Vanden-Heuvel JP (1999) Peroxisome proliferator-activated receptors: a critical link among fatty acids gene expression and carcinogenesis. J Nutr 129: 5758-5808.
Wan YJ, Morimoto M, Thurman RG, Bojes HK, and French SW (1995) Expression of peroxisome proliferator activated receptor gene is decreased in experimental alcoholic liver disease. Life Sci 56: 307-317.[CrossRef][Medline]
Wan YY, Cai Y, Lungo W, Fu P, Locker J, French S, and Sucow HM (2000) Peroxisome proliferator-activated receptor -mediated pathways are altered in hepatocytes-specific retinoid X receptor deficient mice. J Biol Chem 275: 28285-28290.
Wang AM, Doyle MV, and Mark DF (1989) Quantitation of mRNA by the polymerase chain reaction. Proc Natl Acad Sci USA 86: 9717-9721.
Weisiger RA (1996) Cytoplasmic transport of lipids: role of binding proteins. Comp Biochem Physiol B 115: 319-331.[CrossRef]
This article has been cited by other articles:
|
|
 |
|
  M. You and C. Q. Rogers Adiponectin: A Key Adipokine in Alcoholic Fatty Liver Experimental Biology and Medicine, August 1, 2009; 234(8): 850 - 859. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Okada, F. Sano, I. Ikeda, J. Sugimoto, S. Takagi, H. Sakai, and T. Yanai Fenofibrate-Induced Muscular Toxicity Is Associated with a Metabolic Shift Limited to Type-1 Muscles in Rats Toxicol Pathol, June 1, 2009; 37(4): 517 - 520. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Anderson and J. Borlak Molecular Mechanisms and Therapeutic Targets in Steatosis and Steatohepatitis Pharmacol. Rev., September 1, 2008; 60(3): 311 - 357. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Sozio and D. W. Crabb Alcohol and lipid metabolism Am J Physiol Endocrinol Metab, July 1, 2008; 295(1): E10 - E16. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|
 |
 |
 |
, p < 0.05.
