![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
INFLAMMATION AND IMMUNOPHARMACOLOGY
Clinica di Gastroenterologia ed Epatologia, Dipartimento di Medicina Clinica e Sperimentale, Università degli Studi di Perugia, Perugia, Italy (S.F., E.D., A.Me., G.R., A.R.D.L., M.B., A.Mo.); Nicox SA, Sophia Antipolis, France (P.d.S.); and Mucosal Inflammation Research Group, Faculty of Medicine, University of Calgary, Calgary, Alberta, Canada (J.L.W.)
Received for publication
November 29, 2003
Accepted
February 3, 2004.
 |
Abstract |
|---|
 Top Abstract Editorial Expression of ConcernMaterials and MethodsResultsDiscussionReferences |
|---|
70%, antiadhesive effects of NCX-4016 were only marginally
affected (30%) by COX inhibitors and Boc-1, implying that COX-independent
mechanisms mediate the antiadhesive properties of NCX-4016. Indeed, NCX-4016
causes a long-lasting (up to 12 h) release of NO and cGMP accumulation in
HUVEC. Scavenging NO with 10 mM hemoglobin, in the presence of celecoxib,
reduced the antiadhesive properties of NCX-4016 by 80%. Confirming a role
for NO, the NO donor diethylenetriamine-NO also inhibited PMN/HUVEC adhesion
by 80%. NCX-4016, but not aspirin, decreased DNA binding of nuclear
factor-
B (NF-B) on gel shift analysis and HUVEC's overexpression
of CD54 and CD62E induced by LPS/IL-1β. Reduction of binding of the two
NF-B subunits p50-p50 and p50-p65 was reversed by dithiothreitol,
implying S-nitrosylation as mechanism of inhibition. In summary, our
results support that ATL and NO are formed at the PMN/HUVEC interface after
exposure to NCX-4016 and mediate the antiadhesive properties of this
compound.
|
Editorial Expression of Concern |
|---|
|
TopAbstractEditorial Expression of ConcernMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
Adhesive interactions between leukocytes and endothelial cells and
transmigration through the endothelium junctions represent early events in
physiological (e.g., innate immune response) as well as pathological
responses, such as ischemia/reperfusion injury, atherosclerosis, transplant
rejection, and various inflammatory disorders
(Cotran and Mayadas-Norton,
1998
). Adhesion of polymorphonuclear leukocytes (PMN) to the
endothelium increases vascular permeability and favors cell transmigration
into surrounding tissues (Carlos and
Harlan, 1994; Gimbrone,
1995). Cyclooxygenase (COX)-derived lipid mediators regulate many
aspects of adhesive interactions in vascular inflammation and represent a
major target for the therapeutic actions of aspirin and nonsteroidal
anti-inflammatory drugs (NSAID) (Patrono,
1994; Alpin et al.,
1998; Pillinger et al.,
1998; Fitzgerald and Patrono,
2001). In contrast to NSAID, aspirin not only inhibits
prostaglandin (PG) generation but also can trigger lipoxin (LX) production
(Claria and Serhan, 1995).
Thus, COX-2 acetylation by aspirin modifies its activity to generate
15R-hydroxyeicosatetraenoic acid, which can be oxygenated to produce
15(R)-epi-LXA4, also termed aspirin-triggered LX or ATL
(Claria and Serhan, 1995;
Serhan and Oliw, 2001;
Serhan, 2002). Similarly to
LXA4, ATL exerts potent anti-inflammatory actions acting as a
braking signal to limit PMN chemotaxis and transmigration across endothelial
cell layers (Lecomte et al.,
1994; Serhan and Oliw,
2001; Schottelius et al.,
2002; Serhan,
2002).
Nitric oxide (NO), synthesized from L-arginine by a family of
constitutive and inducible NO synthases, is a small, diffusible, highly
reactive molecule that serves a variety of functions in the cardiovascular
system and accounts for most of the endothelium-dependent vasodilation
(Ignarro, 1990). In addition
to controlling vascular tone, NO also regulates adhesive interactions at the
endothelium surface (Ignarro,
1990). Thus, exposure of endothelial cells to NO inhibits
E-selectin, intercellular adhesion molecule (ICAM)-1, and vascular cell
adhesion molecule-1 expression (Kubes et
al., 1994; De Caterina et al.,
1995; Khan et al.,
1996; Spiecker et al.,
1997); limits the release of secretable cytokines IL-6 and IL-8
(Persoons et al., 1996); and
prevents nuclear translocation of nuclear factor (NF)-B
(De Caterina et al., 1995;
DelaTorre et al., 1997),
suggesting that similar to LXA4 and ATL, NO might act as a braking
signal in regulating vascular inflammation.
2-(Acetyloxy)benzoic acid 3-(nitrooxymethyl)phenyl ester (NCX-4016)
(Fig. 1a) is the prototype of a
new class of antiplatelet and anti-inflammatory drugs obtained by coupling a
NO-releasing moiety to acetylsalicylic acid (Wallace et al.,
1999,
2002; Fiorucci et al.,
2000,
2002b, 2003;
Fiorucci and Del Soldato,
2003). NCX-4016 inhibits COX-1 and COX-2 activity (Wallace et al.,
1999,
2002;
Fiorucci et al., 2002a;
Fiorucci and Del Soldato,
2003) and triggers ATL formation in vivo (Fiorucci et al., 2003).
Previous studies in rodents have shown that NCX-4016 is more effective than
aspirin in preventing myocardial infarction and restenosis after carotid
angioplasty (Wallace et al.,
2002). In contrast to aspirin, but similarly to NO donors,
NCX-4016 modulates the expression of tissue factor on monocytes
(Fiorucci et al., 2002a) as
well as cytokine secretion from activated macrophages
(Fiorucci et al., 2000),
thereby suggesting that both the aspirin and the NO moiety contribute to its
pharmacological activity.
|
B activity, we have examined whether
NCX-4016 has the ability to interfere with the binding of this transcription
factor to DNA in activated endothelial cells. |
Materials and Methods |
|---|
|
TopAbstractEditorial Expression of ConcernMaterials and MethodsResultsDiscussionReferences |
|---|
-nitro-L-arginine methyl ester
(L-NAME), and
N-t-butoxycarbonyl-methionine-leucine-phenylalanine (Boc-1) were from
Sigma-Aldrich (St. Louis, MO). Celecoxib was synthesized as described
previously (Fiorucci et al.,
2003a). Rofecoxib
(Nicoll-Griffith et al., 2000)
was synthesized by Dr. Stefan Laufer (Department fur Pharmazie-Zentrum fur
Pharmaforschung, University of Tubingen, Germany)
(Fiorucci et al., 2003a).
Culture media and fetal bovine serum were from Invitrogen (Milan, Italy).
Mouse anti-human monoclonal antibodies anti-CD62E and anti-CD54 were from
Immmunotech (Marseille, France). Interleukin-1β was from R&D Systems
(Minneapolis, MN). DETA-NO,
(z)-1-[2-(2-aminoethyl)-N-(2-ammonio-ethyl)amino] diazen-1-ium-1,2
diolate, and 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one
(ODQ) were from Alexis (Milan, Italy).
Human Umbilical Endothelial Cells (HUVEC). Primary cultures of HUVEC
were from Istituto Zooprofilattico of Brescia (Brescia, Italy). HUVEC were
grown in endothelial basal medium supplemented with bovine brain extract (12
µg/ml), human epithelial growth factor (10 ng/ml), hydrocortisone (1
µg/ml), penicillin (100 units/ml), streptomycin (100 µg/ml), and
gentamicin (5 µg/ml), at 37°C in a humidified atmosphere containing 5
and 2% fetal bovine serum. Cells were used between passages 2 to 5 as
described previously (Fiorucci et al.,
2003a).
PMN Isolations. Fresh peripheral blood was isolated from healthy donors who had refrained from taking anti-inflammatory drugs or other medications for at least 2 weeks. PMN were isolated using standard dextran sedimentation and gradient separation on Histopaque-1077 (Sigma-Aldrich) as described previously. This procedure yields a PMN population that is 95 to 98% viable (trypan blue exclusion) and 98% pure (acetic acid-crystal violet staining).
PMN-HUVEC Cocultures. HUVEC were seeded on gelatin-coated, 24-well
plates for 48 h. Confluence was confirmed by microscopical inspection before
each experiment. Confluent cells were then incubated for 24 h in the presence
of 10 ng/ml IL-1β and 10 ng/ml LPS (Claria and Serhan, 1996). For
eicosanoid generation experiments, 2 x 105 HUVEC were
preincubated with 100 µM aspirin or NCX-4016 for 5 h and then for 30 min
with 5 µM A23187
[GenBank]
and 20 µM arachidonic acid and then coincubated with 2
x 106 PMN for further 30 min (Claria and Serhan, 1996). To
inhibit COX-2 activity, 100 µM celecoxib, 10 µM rofecoxib, and 100 µM
naproxen were added directly to HUVEC, and cells were preincubated for 20 min
before addition of PMN. In experiments were Boc-1 was used, this agent was
added directly to PMN/HUVEC cocultures
(Perretti et al., 2001;
Fiorucci et al., 2003a).
PMN-HUVEC Adhesion Assay. Freshly isolated PMN were washed twice with labeling medium (RPMI 1640 medium plus 1% fetal bovine serum) and then incubated for 1 h (37°C, 5% CO2) with 51CrO4 (sodium salt; PerkinElmer Life and Analytical Sciences, Boston, MA; 3–5 µCi/5 x 107 cells). The labeled leukocytes were washed four times with labeling medium and then resuspended in fresh labeling medium. For static adhesion assays, 50 µl of labeled neutrophil suspension (1 x 107 cells) was added to each well of endothelial cells (10:1 ratio of leukocytes to endothelial cells) and incubated for 30 min at 37°C on an orbital shaker at 90 rpm in the presence of aspirin or NCX-4016. At the end of the incubation period, the medium from each well was aspirated and saved for radioactive counting. The monolayer was gently washed three times with cold PBS to remove loosely adherent or unattached neutrophils; collected washes were combined with medium and counted, yielding a measure of nonadherent leukocytes. After the final wash, monolayers were lysed for 1 h with 1 M NaOH; counting of the lysate (in cpm) yielded a measure of adherent leukocytes. Adhesion was quantified as follows: %PMN adherence = lysate (cpm)/[supernatant (cpm) + wash (cpm) + lysate (cpm)].
CD54 (ICAM-1) and CD62E (E-Selectin) Expression. Surface expression
of adhesion molecules was quantified by flow cytometry. To investigate the
expression of CD54 and CD62E, activated HUVEC (18 h in culture with
LPS/IL-1β) were incubated for 5 h with aspirin or NCX-4016 with or
without Hb, whereas celecoxib was added 30 min cell harvesting by extensive
wash and culture trypsinization (Fiorucci
et al., 2003a). HUVEC were identified by size (forward and side
scatter). After staining with specific antibodies, cells were washed twice and
incubated with fluorescein isothiocyanate-conjugated sheep anti-mouse
F(ab')2 secondary antibody (1: 400 dilution; Sigma-Aldrich)
for 45 min at 4°C. Stained cells were washed once and fixed in 1% (v/v)
formaldehyde in PBS. Flow cytometry was performed on an Epics XL instrument
(Beckman Coulter Inc., Milan, Italy). After gating out small-sized (i.e.,
noncellular) debris, 50,000 events were collected for each analysis. The
levels of CD54 and CD62E for each experiment were normalized against the value
of the isotype-matched control antibody (background).
ATL and PGE2 Assay. ATL concentrations were measured
using a commercially available assay (Neogen Corporation, Lansing, MI)
following manufacturer's instructions. The antibody used in this assay
specifically recognizes 15(R)-epi-LXA4 and has been
characterized previously by us and others
(Chiang et al., 1998;
Fiorucci et al., 2002b). The
PGE2 assay of cell supernatants was carried out in duplicate using
a commercially available enzyme-linked immunosorbent kit (Cayman Chemical,
Milan, Italy).
NO Generation and Nitrite/Nitrate Assay. NO formation was measured using a 2-mm NO-sensitive electrode connected to the ISO-NO Mark II meter (WPI, Sarasota, FL). The NO electrode was calibrated by addition of known concentrations of NaNO2 under reducing conditions (Kl/H2SO4). The nitrite/nitrate concentrations in cell supernatants were measured using a commercially available enzyme immunoassay kit (Cayman Chemical).
Preparation of Nuclear Extracts. After stimulation with LPS, cells
were washed three times with ice-cold PBS, harvested, and resuspended in 0.5
ml of buffer A (20 mM HEPES pH 7.4, 10 mM KCl, 1.5 mM MgCl2, 0.1 mM
EDTA, 1 mM DTT, and 1 mM PMSF) and protease inhibitors: 5 µg/ml aprotinin,
5 µg/ml pepstatin A, 5 µg/ml leupeptin, or 1x Protease inhibitor
cocktail (Roche Diagnostics, Milan, Italy). After 10-min incubation on ice, 23
µl of 10% Nonidet P-40 was added and vigorously mixed for 15 s. Nuclei were
separated from cytosol by centrifugation at 13,000g for 10 s. The
cytosolic proteins contained in the supernatant fraction were separated from
membrane by centrifugation 10' at 13,000g
(Haglund and Rothblum, 1987).
The pellet containing a nuclear proteins fraction has resuspended in 50 µl
of buffer B (20 mM HEPES pH 7.4, 1.5 mM MgCl2, 0.42 M NaCl, 1 mM
EDTA, 1 mM DTT, 1 mM PMSF, and 10% glycerol) and 1x Protease inhibitor
cocktail (Roche Diagnostics). After 30 min at 4°C, lysates were separated
by centrifugation (13,000g; 30 s), and supernatant containing nuclear
proteins were transferred to new vials. The protein concentration was measured
using a protein dye reagent (Bio-Rad, Hercules, CA) with bovine serum albumin
as standard, and samples were used directly or stored at –80°C.
Electrophoretic Mobility Shift Analysis (EMSA). Probes used for
EMSAs were radiolabeled by [
-32P]ATP end labeling with T4
polynucleotide kinase. Briefly, 10 pM double-strand oligonucleotide
CAGTTGAGGGGACTTTCCCAGGC was end labeled with [-32P]ATP for
60 min at room temperature before the kinase was inactivated at 95°C for 5
min. The labeled probe was purified from unincorporated nucleotides by using a
QuickSpin column (G-25; Invitrogen) following the manufacturer's instructions.
The specific activities of 32P-labeled oligoprobe were measured by
beta-counter. For EMSAs, 6 to 10 µg of nuclear extracts was incubated in a
total volume of 20 to 25 µl of binding buffer [50 mM NaCl, 10 mM Tris, pH
7.4, 0.5 mM EDTA, 1 mM PMSF, 1 µg of poly(dI-dC), and 5% glycerol] for 20
min at room temperature with 50,000 cpm (50 fmol) of labeled probe. For
competition assays, 20 times excess of unlabeled oligonucleotides was
preincubated for 15 min before the addition of the radiolabeled probe. For
antibody-mediated supershift assays, extracts were preincubated with 5 µl
of NF-B subunit anti-p50 (Santa Cruz Biotechnology, Inc., Santa Cruz,
CA) at room temperature for 10 min before the addition of the radiolabeled
probe. The reactions were loaded on a 6% polyacrylamide nondenaturing gel in
0.5x Tris borate-EDTA, electrophoresed for 2 h at 170 V before drying (1
h at 80°C), and exposed to autoradiographic film.
Statistical Analysis. All data are presented as the mean ± S.E.M. Comparisons of groups of data were performed using a one-way analysis of variance followed by the Tukey post hoc test. An associated probability (P value) of less than 5% was considered significant.
|
Results |
|---|
|
TopAbstractEditorial Expression of ConcernMaterials and MethodsResultsDiscussionReferences |
|---|
Exposure of HUVEC to LPS/IL-1β for 24 h induced COX-2 expression as
assessed by RT-PCR (Fig. 2a)
and significantly enhanced generation of PGE2 in comparison with
untreated cells (n = 8; P < 0.001). Aspirin and NCX-4016
(100 µM reduced PGE2 concentrations by 80% and triggered the
formation of ATL; Fig. 2, b and
c; n = 8; P < 0.01 versus LPS/IL-1β
alone). Treatment of the PMN/ HUVEC coculture with 100 µM celecoxib, 10
µM rofecoxib, or 100 µM naproxen abrogated ATL generation induced by
aspirin and NCX-4016 (n = 8; P < 0.01 versus aspirin and
NCX-4016 alone) and further inhibited PGE2 synthesis (n =
8; P < 0.01 versus aspirin and NCX-4016 alone). The role of ATL in
mediating antiadhesive effects of NCX-4016 and aspirin was further
investigated using Boc-1, an LXA4 receptor antagonist
(Perretti et al., 2001;
Fiorucci et al., 2002b,
2003a). Thus, as shown in
Fig. 2d, exposure of PMN/HUVEC
cocultures to Boc-1 reduced antiadhesive effect of aspirin by 60%
(n = 8; P < 0.01 versus aspirin alone), whereas it was
only partially effective in modulating antiadhesive properties of NCX-4016
(n = 8; P < 0.05 versus NCX-4016 alone).
As shown in Fig. 3, a–c, culturing HUVEC with LPS/IL-1β increased NO2/NO3 release in cell supernatants, a measure of NO formation, as well as intracellular cGMP concentrations (n = 8; P < 0.01 versus basal). Whereas 5-h incubation with 100 µM aspirin had no effect on the rate of NO formation, addition of 100 µM NCX-4016 significantly enhanced NO2/NO3 generation (Fig. 3, a and b; n = 8; P < 0.01 versus LPS/IL-β). This finding was further confirmed by assessing NO formation with a NO-sensitive electrode. Thus, as shown in Fig. 3c, exposure to 100 µM NCX-4016 resulted in a long-lasting (up to 12 h) release of NO (n = 8; P < 0.01 versus LPS/IL-β).
|
20%, reduced antiadhesive effects of
aspirin (n = 8; P > 0.05 versus aspirin alone), ODQ was
not effective (n = 8; P > 0.05 versus aspirin alone).
L-NAME and ODQ also failed to reverse inhibition of PMN/HUVEC
adhesion caused by NCX-4016 (n = 8; P > 0.05 versus
NCX-4016 alone), indicating that cGMP is not involved. In contrast
(Fig. 4b), hemoglobin (10 mM),
a NO scavenger, significantly (50%) attenuated the antiadhesive properties
of NCX-4016, but not of aspirin, and when added in combination with celecoxib,
or Boc-1 (Fig. 4c), it reversed
the antiadhesive properties of NCX-4016 by 70% (n = 8; P
< 0.01 versus NCX-4016 alone). Confirming a role for NO, DETA-NO (100
µM) also reversed in a Hb-dependent manner PMN/HUVEC adhesion triggered by
LPS/IL-1β (Fig. 4d;
n = 6; P < 0.01 versus LPS/IL-1β).
|
Exposure of HUVEC to LPS/IL-1β significantly up-regulated the expression of CD54 and CD62E (Fig. 5a; n = 8; P < 0.01 versus control cells). This effect was curtailed by 100 µM NCX-4016 (n = 8; P < 0.01 versus LPS/IL-1β). In contrast to NCX-4016, aspirin was effective in reducing CD54 expression, but not CD62E (n = 8; P < 0.05 versus LPS/IL-1β). Data shown in Fig. 5, b and c, demonstrated that celecoxib abrogates the effect of aspirin on CD54 expression (n = 8; P < 0.05 versus aspirin). Once again, scavenging NO with 10 mM hemoglobin, in the presence of celecoxib, reversed the effect of NCX-4016 on LPS/IL-β-induced CD54 and CD62E expression by 70 to 80% (n = 8; P < 0.05 versus NCX-4016). As shown in Fig. 6a, NCX-4016, but not aspirin, reduced CD54 and CD62E mRNA up-regulation induced by LPS/IL-1β, suggesting that modulation of CD54 and CD62E expression was, at least partially, due to the inhibition of gene transcription.
|
B in regulating the expression of CD54
and CD62E is well established (Roebuck and
Finnegan, 1999), we then examined whether aspirin and NCX-4016
modulate NF-B activation induced by LPS/IL-1β. As shown in
Fig. 6b, treatment of HUVEC
with LPS/IL-1β alone induced the specific NF-B DNA binding
activity of the p50-p50 homodimer and the p50-p65 heterodimer. This effect was
inhibited by treating HUVEC with 100 µM NCX-4016, whereas aspirin at this
concentration was ineffective. We have then examined whether the
NCX-4016-induced suppression of the NF-B binding activity cells could
be reversed by the thiol-reducing agent DTT, and, as shown in
Fig. 6c, we found that
incubation of the NCX-4016-treated nuclear extract with 10 mM DTT gave 70%
recovery of DNA binding activity of the p50-p50 homodimer under the
experimental conditions used (n = 4; P < 0.01 versus
NCX-4016 alone). In contrast, DTT has no effect on aspirin-treated cells
(Fig. 6c). |
Discussion |
|---|
|
TopAbstractEditorial Expression of ConcernMaterials and MethodsResultsDiscussionReferences |
|---|
).
ATL exerts inhibitory effects on several inflammatory mechanisms, including
cytokine and chemokine generation (Gronert
et al., 2001; Serhan and Oliw,
2001; Serhan,
2002), leukocyte responses to cytokines or to microbial
stimulation (Takano et al.,
1997), neutrophil and eosinophil migration, and cell surface
expression of adhesion molecules P-selectin and lymphocyte function associated
antigen-1 (Filep et al., 1999).
ATL is generated by PMN and endothelial cells in response to aspirin,
particularly after these cells have been exposed to IL-1β, tumor necrosis
factor-
, or endotoxin (Claria and
Serhan, 1995; Serhan and Oliw,
2001; Serhan,
2002). In this proinflammatory setting, aspirin acethylates both
COX-1 and COX-2 (Patrono,
1994), and COX-1 acetylation results in irreversible inhibition,
acetylation of COX-2 leads to an enzyme that performs an incomplete reaction
transforming arachidonic acid into 15R-hydroxyeicosatetraenoic acid
(Fig. 7), which is released and
transformed via transcellular routes to form ATL by leukocytes in proximity
(Claria and Serhan, 1995;
Serhan and Oliw, 2001;
Serhan, 2002). In the present
study, we have demonstrated that, similar to aspirin, NCX-4016 inhibits
cell-to-cell adhesion and triggers the formation of ATL from human PMN/HUVEC
cocultures. Thus, despite the fact that NCX-4016 carries an ester substitution
at its carboxylic acidic moiety, this molecule maintains the ability to
acetylate COX-2.
|
We have previously shown that selective COX-2 inhibitors celecoxib and
rofecoxib abrogate ATL synthesis (Fiorucci et al., 2003) and reverse
antiadhesive effects of aspirin. We now demonstrated that not only celecoxib
and rofecoxib but also naproxen, a nonselective COX-2 inhibitor, block ATL
formation, confirming that selective and nonselective NSAID are equally
effective in inhibiting the acetylated and the nonacetylated form of COX-2
(Mancini et al., 1997). In
parallel with inhibition of ATL formation, selective and nonselective COX-2
inhibitors reduced by 60 to 70% the antiadhesive activity of aspirin,
establishing a mechanistic link between ATL formation and antiadhesive
properties of aspirin. Consistent with this view, Boc-1, a selective
LXA4 receptor antagonist
(Perretti et al., 2001), also
markedly attenuated the antiadhesive effects of aspirin.
In contrast to aspirin, COX-2 inhibition and ATL antagonism failed to
inhibit the adhesive properties of NCX-4016, suggesting that inhibition of
COX-independent, NO-mediated mechanisms are operational in cells exposed to
this drug. Indeed, the findings that exposure of HUVEC to NCX-4016 results in
NO formation and that antiadhesive properties of NCX-4016 were significantly
reduced by hemoglobin support this view
(Wallace et al., 2002;
Fiorucci and Del Soldato,
2003). Antiadhesive properties of NCX-4016 were insensitive to
L-NAME and ODQ, suggesting that endogenously formed NO and cGMP
were not involved. In contrast, L-NAME partially reduced the
antiadhesive properties of aspirin, supporting the notion that NO is released
by activated endothelial cells, providing an antiadhesive background to limit
cell-to-cell adhesion. NCX-4016 contains two active moieties, i.e., an
aspirin-like and an NO-releasing moiety that contribute to its activity (for
review, see Wallace et al.,
2002). However, the finding that Hb reverses antiadhesive
properties of NCX-4016, whereas celecoxib did not, indicates that most of the
antiadhesive effects it exerts are mediated by its NO-releasing moiety.
Although, our data support the notion that NCX-4016 causes COX-2 acetylation
(as measured by ATL formation), in vitro data indicate that the kinetic of
acetylation differs from that of aspirin, suggesting that NCX-4016 requires an
extensive metabolism to generate free acetyl salicylic acid (Del Soldato,
unpublished data).
Similarly to NO, NCX-4016 reduces the expression of adhesion molecules on
endothelial cells (Kubes et al.,
1994; De Caterina et al.,
1995; Khan et al.,
1996; Spiecker et al.,
1997; Zampolli et al.,
2000) and down-regulates the expression of CD54 and CD62E on
activated HUVEC. This effect was only partially reversed by celecoxib but
fully inhibited by the combination of a coxib with hemoglobin, suggesting an
NO-mediated pathway. The mechanisms through which NO regulates adhesion
molecule expression has not been completely elucidated. Experimental evidence
suggest that NO may inhibit the expression of adhesion molecules through its
interaction with NF-B (De Caterina
et al., 1995; DelaTorre et al.,
1997). NF-B is a transcription factor involved in
inflammation that regulates synthesis of cytokines, cytokine receptors, and
adhesion molecules (Barnes and Karin,
1997). NF-B transcription is sensitive to oxidative and
nitrosative stress (Stamler et al.,
1992). An oxidizing cytoplasmic environment is typically
associated with NF-B activation, yet oxidation or nitrosation of the
NF-B heterodimer (p50-p65) prevents DNA binding
(Stamler et al., 1992).
Matthews et al. (1995) have
found that S-nitrosylation of the redox-sensitive NF-B p50 C62
residue is associated with inhibition of p50 homodimer and p50-p65 heterodimer
binding to their consensus DNA target sequence, resulting in a 4-fold decrease
in the equilibrium binding constant. We have now provided evidence that,
similar to NO, NCX-4016 inhibits NF-B activity. At 100 µM, a
concentration that can be reached in vivo after a therapeutic dose of this
compound (Fiorucci et al.,
2003b), NCX-4016 reduce p50-p65 and p50-p50 binding to DNA,
suggesting that modulation of CD54 and CD62E expression could be, at least in
part, mediated by NF-B inhibition. Inhibition of p50-p50 DNA binding is
due to S-nitrosylation, as demonstrated by the fact that removing NO
by incubation of nuclear extract with the thiol-reducing agent DTT abrogates
the inhibitory effect of NCX-4016
(Fiorucci et al., 2000).
Aspirin has previously been shown to inhibit NF-B binding to DNA
(Kopp and Ghosh, 1994;
Pillinger et al., 1998) at
millimolar concentrations (5–10 mM). Thus, the observation that NCX-4016
inhibits NF-B binding at micromolar concentrations adds to the concept
that NO and/or NO cooperating with ATL mediates the effect of NCX-4016 on the
transcription factor.
The expression of adhesion molecules after cytokine stimulation is
time-dependent, requiring 2 to 4 h for CD62E and 6 to 8 h for ICAM-1
(De Caterina et al., 1995).
Thus, one might expect that prolonged NO release is necessary for an effective
inhibition of gene transcription for such molecules. Indeed, we demonstrated
that exposure to NCX-4016 results in a prolonged release of NO, which
generates a long-lasting "clamp" of NO at the endothelial cell
interface.
In conclusion, this study demonstrates that NCX-4016 acetylates COX-2 and
switches prostanoid metabolism from PGE2 to ATL. NCX-4016 inhibits
nuclear binding of NF-B and suppresses CD54 and CD62E expression on
activated HUVEC. We propose that the ability of NCX-4016 to limit endothelial
activation is due to COX-dependent and -independent, NO-mediated
mechanisms.
|
Footnotes |
|---|
ABBREVIATIONS: PMN, polymorphonuclear neutrophils; COX,
cyclooxygenase; NSAID, nonsteroidal anti-inflammatory drug; PG, prostaglandin;
LX, lipoxin; LXA4, lipoxin A4; ATL, aspirin-triggered
lipoxin or 15-epi-LXA4; NO, nitric oxide; ICAM, intercellular
adhesion molecule; IL, interleukin; NF, nuclear factor; DTT,
1,4-dithio-DL-threitol; LPS, lipopolysaccharide; L-NAME,
N-nitro-L-arginine methyl ester; Boc-1,
N-t-butoxycarbonyl-methionine-leucine-phenylalanine;
DETA-NO, diethylenetriamine-nitric oxide; ODQ,
1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one; HUVEC, human
umbilical vein endothelial cells; PBS, phosphate-buffered saline; Hb,
hemoglobin; PMSF, phenylmethylsulfonyl fluoride; EMSA, electrophoretic
mobility shift analysis; RT-PCR, reverse transcription-polymerase chain
reaction.
Address correspondence to: Dr. Stefano Fiorucci, Clinica di Gastroenterologia ed Endoscopia Digestiva, Policlinico Monteluce, 06100 Perugia, Italy. E-mail: fiorucci{at}unipg.it
|
References |
|---|
|
TopAbstractEditorial Expression of ConcernMaterials and MethodsResultsDiscussionReferences |
|---|
Alpin AE, Howe S, Alahari SK, and Juliano RL (1998)
Signal transduction and signal modulation by cell adhesion receptors: the role
of integrins, cadherins, immunoglobulin-cell adhesion molecules and selectins.
Pharmacol Rev 50:197
–263.
Barnes P and Karin M (1997) NF-B: a pivotal
transcription factor in chronic inflammatory disease. N Engl J
Med 336:1066
–1071.
Carlos T and Harlan J (1994) Leukocyte-endothelial
adhesion molecules. Blood
84:2068
–2101.
Chiang N, Takano T, Clish CB, Petasis NA, Tai H-H, and Serhan CN.
(1998) Aspirin-triggered 15-epi-lipoxin A4 (ATL)
generation by human leukocytes and murine peritonitis exudates: development of
a specific 15-epi-LXA4 ELISA. J Pharmacol Exp
Ther 287:779
–790.
Claria J and Serhan CN (1995) Aspirin triggers
previously unrecognized bioactive eicosanoids by human endothelial
cell-leukocyte interactions. Proc Natl Acad Sci USA
92:9475
–9479.
Cotran RS and Mayadas-Norton T (1998) Endothelial
adhesion molecules in health and disease. Pathol Biol
(Paris) 46:164
–170.[Medline]
De Caterina R, Libby P, Peng H-B, Thannickal VJ, Rajavashisth TB,
Gimbrone MA Jr, Shin WS, and Liao JK (1995) Nitric oxide
decreases cytokine-induced endothelial activation. J Clin
Investig 96:60
–68.
DelaTorre A, Schroeder RA, and Kuo PC (1997)
Alteration of NF-kappa B p50 DNA binding kinetics by S-nitrosylation.
Biochem Biophys Res Commun
238:703
–706.[CrossRef][Medline]
Filep JG, Zouki C, Petasis NA, Hachicha M, and Serhan CN
(1999) Anti-inflammatory actions of lipoxin A4 stable
analogs are demonstrable in human whole blood: modulation of leukocyte
adhesion molecules and inhibition of neutrophil-endothelial interactions.
Blood 94:4132
–4142.
Fiorucci S and Del Soldato P (2003) NO-aspirin:
mechanism of action and gastrointestinal safety. Dig Liver
Dis 35 (Suppl 2):S9
–S19.
Fiorucci S, Distrutti E, Mencarelli A, Morelli A, Laufor SA, Cirino
G, and Wallace JL (2003a) Evidence that 5-lipoxygenase and
acetylated cyclooxygenase 2-derived eicosanoids regulate leukocyte-endothelial
adherence in response to aspirin. Br J Pharmacol
139:1351
–1359.[CrossRef][Medline]
Fiorucci S, Mencarelli A, Meneguzzi A, Lechi A, Morelli A, del
Soldato P, and Minuz P (2002a) NCX-4016 (NO-aspirin) inhibits
lipopolysaccharide-induced tissue factor expression in vivo: role of nitric
oxide. Circulation 106:3120
–3125.
Fiorucci S, Mendes De Lima O, Mencarelli A, Palazzetti B, Distrutti
E, Mcknight W, Dicay M, Ma L, Romano M, Morelli A, et al. (2002b)
COX-2 derived Lipoxin A4 increases gastric resistance to
aspirin-induced damage. Gastroenterology
123:1598
–1606.[CrossRef][Medline]
Fiorucci S, Santucci L, Cirino G, Mencarelli A, Familiari L,
Soldato PD, and Morelli A (2000) IL-1 beta converting enzyme is a
target for nitric oxide-releasing aspirin: new insights in the
antiinflammatory mechanism of nitric oxide-releasing nonsteroidal
antiinflammatory drugs. J Immunol
165:5245
–5254.
Fiorucci S, Santucci L, Wallace JL, Sardina M, Romano M, del
Soldato P, and Morelli A (2003b) Interaction of a selective
cyclooxygenase-2 inhibitor with aspirin and NO-releasing aspirin in the human
gastric mucosa. Proc Natl Acad Sci USA
100:10937
–10941.
Fitzgerald GA and Patrono C (2001) The coxibs,
selective inhibitors of cyclooxygenase-2. N Engl J Med
345:433
–442.
Gimbrone MA Jr (1995). Vascular endothelium in health
and disease, in Molecular Cardiovascolar Medicine
(Habers E ed) pp 49–61, Scientific American
Medicine, New York.
Gronert K, Martinsson-Niskanen T, Ravasi S, Chiang N, and Serhan CN
(2001) Selectivity of recombinant human leukotriene
D4, leukotriene B4 and lipoxin A4 receptors
with aspirin-triggered 15-epi-LXA4 and regulation of vascular and
inflammatory responses. Am J Pathol
158:3
–9.
Haglund RE and Rothblum LI (1987) Isolation,
fractionation and reconstitution of a nuclear extract capable of transcribing
ribosomal DNA. Mol Cell Biochem
73:11
–20.[Medline]
Ignarro L (1990) Biosynthesis and metabolism of
endothelium-derived nitric oxide. Annu Rev Pharmacol
Toxicol 30:535
–560.[CrossRef][Medline]
Khan BV, Harrison DG, Olbrych MT, Alexander RW, and Medford RM
(1996) Nitric oxide regulates vascular cell adhesion molecule-1
gene expression and redox-sensitive transcriptional events in human vascular
endothelial cells. Proc Natl Acad Sci USA
93:9114
–9119.
Kopp E and Ghosh S (1994) Inhibition of NF-B by
sodium salicylate and aspirin. Science (Wash DC)
265:956
–959.
Kubes P, Kurose I, and Granger DN (1994) NO donors
prevent integrin-induced leukocyte adhesion but not P-selectin-dependent
rolling in postischemic venules. Am J Physiol
267:H931
–H937.
Lecomte M, Laneuville O, Ji C, Dewitt DL, and Smith WL
(1994) Acetylation of human prostaglandin endoperoxide synthase-2
(cyclooxygenase-2) by aspirin. J Biol Chem
269:13207
–13215.
Mancini JA, Vickers PJ, O'Neill GP, Boily C, Falgueyret JP, and
Riendeau D (1997) Altered sensitivity of aspirin-acetylated
prostaglandin G/H synthase-2 to inhibition by nonsteroidal anti-inflammatory
drugs. Mol Pharmacol 51:52
–60.
Matthews JR, Nicholson J, Jaffray E, Kelly SM, Price NC, and Hay RT
(1995) Conformational changes induced by DNA binding of NF-kappa
B. Nucleic Acids Res 23:3393
–3402.
Nicoll-Griffith DA, Yergey JA, Trimble LA, Silva JM, Li C, Chauret
N, Gauthier JY, Grimm E, Leger S, Roy P, et al. (2000) Synthesis,
characterization and activity of metabolites derived from the cyclooxygenase-2
inhibitor rofecoxib (MK-0966, Vioxx). Bioorg Med Chem
Lett 10:2683
–2686.[CrossRef][Medline]
Patrono C (1994) Aspirin as an antiplatelet drug.
N Engl J Med 330:1287
–1294.
Perretti M, Getting SJ, Solito E, Murphy PM, and Gao JL
(2001) Involvement of the receptor for formylated peptides in the
in vivo anti-migratory actions of annexin 1 and its mimetics. Am J
Pathol 158:1969
–1973.
Persoons JH, Schornagel K, Tilders FF, De Vente J, Berkenbosch F,
and Kraal G (1996) Alveolar macrophages autoregulate IL-1 and
IL-6 production by endogenous nitric oxide. Am J Respir Cell Mol
Biol 14:272
–278.[Abstract]
Pillinger MH, Capodici C, Rosenthal P, Kheterpal N, Hanft S,
Philips MR, and Weissmann G (1998) Modes of action of
aspirin-like drugs: salicylates inhibit erk activation and integrin-dependent
neutrophil adhesion. Proc Natl Acad Sci USA
95:14540
–14545.
Roebuck KA and Finnegan A (1999) Regulation of
intercellular adhesion molecule-1 (CD54) gene expression. J Leukoc
Biol 66:876
–888.[Abstract]
Schottelius AJ, Giesen C, Asadullah K, Fierro IM, Colgan SP, Bauman
J, Guilford W, Perez HD, and Parkinson JF (2002) An
aspirin-triggered lipoxin A4 stable analog displays a unique
topical anti-inflammatory profile. J Immunol
169:7063
–7070.
Serhan C (2002) Lipoxins and aspirin-triggered
15-epi-lipoxin biosynthesis: an update and role on anti-inflammation and
pro-resolution. Prostaglandins Other Lipid Mediat
68–69:433
–455.
Serhan CN and Oliw E (2001) Unorthodox routes to
prostanoid formation: new twists in cyclooxygenase-initiated pathways.
J Clin Investig 107:1481
–1489.[Medline]
Spiecker M, Peng HB, and Liao JK (1997) Inhibition of
endothelial vascular cell adhesion molecule-1 expression by nitric oxide
involves the induction and nuclear translocation of IkappaBalpha. J
Biol Chem 272:30969
–30974.
Stamler JS, Simon DI, Osborne JA, Mullins ME, Jaraki O, Michel T,
Singel DJ, and Loscalzo J (1992) S-Nitrosylation of
proteins with nitric oxide: synthesis and characterization of biologically
active compounds. Proc Natl Acad Sci USA
89:444
–448.
Takano TS, Fiore JF, Maddox HR, Brady NA, Petasis, and Serhan CN
(1997) Aspirin-triggered 15-epi-lipoxin A4
(LXA4) and LXA4 stable analogues are potent inhibitors
of acute inflammation: evidence for anti-inflammatory receptors. J
Exp Med 185:1693
–1704.
Wallace JL, Ignarro LJ, and Fiorucci S (2002)
Potential cardioprotective actions of no-releasing aspirin. Nat Rev
Drug Discov 1:375
–382.[CrossRef][Medline]
Wallace JL, Muscara MN, McKnight W, Dicay M, Del Soldato P, and
Cirino G (1999) In vivo anti-thrombotic effects of NCX-4016: a
nitric oxide-releasing aspirin derivative. Thromb Res
93:43
–50.[CrossRef][Medline]
Zampolli A, Basta G, Lazzerini G, Feelisch M, and De Caterina R
(2000) Inhibition of endothelial cell activation by nitric oxide
donors. J Pharmacol Exp Ther
295:818
–823.
This article has been cited by other articles:
|
|
 |
|
  D. Mitchell, S. J. O'Meara, A. Gaffney, J. K. G. Crean, B. T. Kinsella, and C. Godson The Lipoxin A4 Receptor Is Coupled to SHP-2 Activation: IMPLICATIONS FOR REGULATION OF RECEPTOR TYROSINE KINASES J. Biol. Chem., May 25, 2007; 282(21): 15606 - 15618. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. G. Burke, C. L. Wainwright, I. Vojnovic, T. Warner, D. G. Watson, and B. L. Furman The Effect of NCX4016 [2-Acetoxy-benzoate 2-(2-nitroxymethyl)-phenyl Ester] on the Consequences of Ischemia and Reperfusion in the Streptozotocin Diabetic Rat J. Pharmacol. Exp. Ther., March 1, 2006; 316(3): 1107 - 1114. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. R. Pijak Rebound Inflammation and the Risk of Ischemic Stroke After Discontinuation of Aspirin Therapy Arch Neurol, February 1, 2006; 63(2): 300 - 301. [Full Text] [PDF]
|
|
|
|
 |
|
 S. Fiorucci, A. Mencarelli, E. Distrutti, M. Baldoni, P. del Soldato, and A. Morelli Nitric Oxide Regulates Immune Cell Bioenergetic: A Mechanism to Understand Immunomodulatory Functions of Nitric Oxide-Releasing Anti-Inflammatory Drugs J. Immunol., July 15, 2004; 173(2): 874 - 882. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Paul-Clark, T. van Cao, N. Moradi-Bidhendi, D. Cooper, and D. W. Gilroy 15-epi-lipoxin A4-mediated Induction of Nitric Oxide Explains How Aspirin Inhibits Acute Inflammation J. Exp. Med., July 6, 2004; 200(1): 69 - 78. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|
 |
 |
 |
, P < 0.01 versus
cells incubated with aspirin (ASA) or NCX-4016. c, ASA and NCX-4016 trigger
ATL formation in HUVEC/PMN cocultures. Data are mean ± eight
experiments. *, P < 0.01 versus cells incubated with medium alone
or LPS/IL-1β; **, P < 0.01 versus cells incubated with
aspirin or NCX-4016. d, Boc-1, a selective LXA4 receptor
antagonist, reverses the antiadhesive activities of aspirin (ASA) but not of
NCX-4016. Data are mean ± S.E. of eight experiments. *, P <
0.001 versus control; **, P < 0.01 versus LPS/IL-1β. 
