![]() |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GASTROINTESTINAL, HEPATIC, PULMONARY, AND RENAL
Division of Genetic and Preventive Medicine, Thomas Jefferson University (T.Z., S.M.E., B.M.B.), Philadelphia, Pennsylvania; and CATX Inc., Gladwyne, Pennsylvania (J.Z.F.)
Received August 30, 2003; accepted October 14, 2003.
| Abstract |
|---|
|
|
|---|
-catenin:T-cell factor 4 (Tcf-4) pathway by the adenomatous polyposis coli protein down-regulates survivin expression and with recent evidence that sulindac induces
-catenin degradation, which would reduce Tcf-4 activation. This suggests that the
-catenin:Tcf-4:survivin mechanism may be a useful target for therapy or chemoprevention of colon cancer.
The molecular mechanisms for sulindac's antitumor effects have not been fully elucidated, although several have been described (He et al., 2000
; Zhang et al., 2000
; Marx, 2001
). One molecular mechanism appears to involve sulindac's ability, via its sulfide metabolite, to inhibit the enzymatic activity of both COX-1 and COX-2 and thereby inhibit prostaglandin synthesis. However, the effects of another metabolite, the sulfone product, appear to be COX-independent.
A cellular mechanism attributed to sulindac's antitumor effects is its ability to induce apoptosis and decrease cell proliferation (Masunaga et al., 2000
; Brown et al., 2001a
). Indeed, the majority of cancers, including colon cancer, show only limited ability to undergo apoptosis and are known to overexpress the antiapoptotic protein survivin. Survivin is an inhibitor of apoptosis protein that is thought to contribute to tumor cell immortality. This protein may also be a key contributing factor in colon carcinogenesis. In a recent study we provided evidence indicating that APC suppresses survivin expression in the colonic crypt (Zhang et al., 2001
). APC mutations are known to cause colorectal cancer, and they might do so by de-repressing the expression of survivin and thereby inhibiting apoptosis (Boman et al., 2004
). In this view, the inability of cells with mutant APC to shut down the antiapoptotic effect of survivin expression contributes to tumorigenesis in the colon, although the underlying molecular mechanism has not been established.
We hypothesized that the ability of sulindac to cause regression of adenomas and to inhibit colon carcinogenesis is mediated, at least in part, by down-regulation of the expression of antiapoptotic proteins. To test this hypothesis, we evaluated whether sulindac down-regulates the expression of Bcl-2 or survivin.
| Materials and Methods |
|---|
|
|
|---|
We exposed HT-29 cells to a sulindac concentration of 200 µM because that is the concentration that completely reverses the cellular phenotype caused by stabilized/mutant
-catenin in vitro (Naishiro et al., 2001
) and because this concentration is also higher than that achieved clinically (Mattila et al., 1984
; Ravis et al., 1993
) at the sulindac dose used to treat FAP patients (Giardiello et al., 2002
), which leads to decreased
-catenin levels in vivo (Keller et al., 2001
) and reversal of the polyposis phenotype (Waddell and Loughry, 1983
; Giardiello et al., 1993
). This concentration was also selected because it is below the sulindac concentration that results in apoptosis of HT-29 cells (Shiff et al., 1995
); higher sulindac concentrations and the resultant cell death might nonspecifically decrease the level of survivin or bcl-2. All experiments were repeated at least three times on different days and with different cultures.
RNA Extraction and cDNA Synthesis. Total RNA was isolated from HT-29 cells before and after treatment with sulindac. Isolation was done using an RNeasy Mini Kit (QIAGEN, Valencia, CA) in accordance with the manufacturer's instructions. The first strand of cDNA was synthesized from RNA using avian myeloleukemia virus reverse transcriptase as indicated by the manufacturer (Promega, Madison, WI). One microgram of RNA was used as a template for first-strand synthesis in quantitative analysis of mRNA expression.
RT-PCR Amplification. Survivin mRNA expression was evaluated semiquantitatively using RT-PCR. cDNA was made by reverse transcription with random primers. The primers used to detect fragments of the survivin gene were designed from published human sequences and span exons 1 to 4. The sequences were: 5'AGCCCTTTCTCAAGGACCAC 3' and 5'GCACTTTCTTCGCAGTTTCC 3', giving an amplified product of 363 base pairs. The PCR reaction contained 2 units of Taq polymerase (Roche Applied Science, Indianapolis, IN); 10x PCR buffer, 10 pmol of each oligonucleotide primer; a 250 µM concentration, each, of dATP, dCTP, dGTP, and dTTP; 1 µl of nascent cDNA; and sterile distilled water to bring the volume to 25 µl. The amplification cycle included a denaturation step of 94°C for 2 min. This was followed by 28 cycles of 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min, and concluded with a final primer extension step of 72°C for 5 min. Controls included replacing RNA or cDNA with distilled water. Controls were consistently found to be negative for survivin expression. PCR products were resolved in a 1.5% agarose gel in TAE buffer (Tris acetate EDTA) and visualized by ethidium bromide staining under UV illumination and photographed. To confirm the integrity of cDNA and to confirm equal loading on gels, the housekeeping gene
-actin was amplified concurrently. The survivin cDNA product was sequenced and confirmed to be survivin according to the known survivin sequence in GenBank.
Western Blot Analysis. HT-29 cells were lysed by 1x sodium dodecyl sulfate "running" buffer (100 mM Tris Cl, 200 mM dithiothreitol, 4% sodium dodecyl sulfate, 20% glycerol). The amount of protein in cell lysates was determined using the Bio-Rad protein assay (Bio-Rad, Hercules, CA). After boiling for 10 min, 50 mg of protein was loaded and resolved by electrophoresis (12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis). The protein was then transferred to a nitrocellulose membrane by capillary action. The membrane was blocked for 30 min in blocking buffer (trizma-buffered saline with 0.2% Tween 20 and 5% nonfat milk) and then incubated overnight at 4°C with rabbit anti-human survivin polyclonal antibody (1:500) or with Bcl-2 polyclonal antibody (1:1000; Santa Cruz Biotechnology, Inc., Santa Cruz, CA). The membrane was then washed in trizma-buffered saline containing 0.2% Tween 20, incubated with phosphatase-conjugated goat anti-rabbit antibody (1:1500) for 60 min, and developed with a substrate reagent kit (Bio-Rad). As a control, tubulin protein was blotted concurrently. Anti-survivin antibody was kindly supplied by Prof. Dario Altieri (Department of Pathology, Yale University, New Haven CT).
Densitometry. Quantitation of survivin mRNA and protein was done by densitometric scanning of photographs of the ethidium bromide-stained gels from our RT-PCR experiments and of Western blots. This was done using a Gateway 2000 Computer (G6-200XL), a Hewlett-Packard ScanJet 5P Scanner, and UN-SCAN-IT scanning software (Automated Digitizing System; Silk Scientific Inc., Orem, UT). The pixel total percentage was recorded, which is 100 multiplied by (pixel total)/(sum of all the pixel total background) for that lane. Pixel total is the total sum of all the pixels within that band region.
| Results |
|---|
|
|
|---|
|
Effects of Sulindac on Expression of Proteins for Survivin and Bcl-2. Figure 2 shows a representative time course for survivin and Bcl-2 protein expression following exposure of HT-29 cells to sulindac. Survivin protein expression showed a monotonic decrease up to 36 h. For Bcl-2 protein expression we observed a slight (14%), transient decrease at 12 h followed by a return to baseline.
|
| Discussion |
|---|
|
|
|---|
Since survivin is known to be an antiapoptotic protein, our findings that sulindac decreases survivin expression are consistent with previous reports showing that sulindac increases apoptosis (Masunaga et al., 2000
; Brown et al., 2001a
). The lack of a sustained effect of sulindac on Bcl-2 expression is consistent with similar findings, as reported in two recent studies (McEntee et al., 1999
; Zhang et al., 2000
).
Because the majority of colon carcinoma cells are known to overexpress survivin (Ambrosini et al., 1997
; Adida et al., 1998
) and to show only limited ability to undergo apoptosis, our finding that sulindac decreases the expression of this antiapoptotic factor in human colon carcinoma cells provides a target for possible new therapeutic approaches to colorectal cancer treatment. Indeed, the ability of NSAIDs to increase apoptosis through decreases in survivin may be responsible for NSAID-induced regression of colonic adenomas (Masunaga et al., 2001
), apoptosis and inhibition of growth in colon tumor cells lines (Richter et al., 2001
), and inhibition of intestinal tumorigenesis in the ApcMin mouse (Beazer-Barclay et al., 1996
). It should be noted, however, that although the drug has proven efficacy in reducing polyp size and number in FAP patients (Waddell and Loughry, 1983
; Giardiello et al., 1993
), it is not ideal because 1) tolerance can develop, and 2) sulindac does not appear to be effective against the development of new adenomas in FAP (Giardiello et al., 2002
).
How sulindac regulates survivin expression is not fully established. One possible mechanism is that sulindac increases expression of APC (Schnitzler et al., 1996
; Kishimoto et al., 2000
) and that APC decreases survivin expression because, as we have shown (Zhang et al., 2001
), APC down-regulates survivin through the
-catenin:Tcf-4 pathway. However, HT-29 cells lack wild-type APC, which excludes this possibility. A more likely possibility based on recent evidence is that sulindac and its metabolites induce, through a COX-independent mechanism, caspase- and proteasome-dependent degradation of
-catenin protein in human colon cancer cells (Mahmoud et al., 1997
; McEntee et al., 1999
; Thompson et al., 2000
; Brown et al., 2001b
; Li et al., 2002
; Rice et al., 2003
), and degradation of
-catenin would reduce Tcf-4 activation, which would reduce survivin expression and induce apoptosis.
Survivin is also known to promote cell division through activation of Aurora-b kinase, which regulates chromosome segregation and cytokinesis (Bolton et al., 2002
; Chen et al., 2003
). This suggests that the down-regulation of survivin expression by sulindac will also inhibit chromosome segregation and block cell division. Thus, sulindac might reduce growth of adenomas in FAP patients through both survivin-related mechanisms: induction of apoptosis and inhibition of cell division.
That sulindac might act therapeutically through more than one survivin-related mechanism is not surprising since analysis of survivin's promoter region shows the presence of sequences in addition to the one for Tcf-4 that regulate survivin expression, suggesting that there may be multiple mechanisms that regulate survivin transcription. One such mechanism appears to involve wild-type p53 that negatively regulates survivin expression (Hoffman et al., 2002
; Mirza et al., 2002
; Zhou et al., 2002
). However, in the case of sulindac's ability to down-regulate survivin in HT-29 cells, this is not a likely mechanism because HT-29 cells contain mutant p53.
The above
-catenin:Tcf-4:survivin-related mechanisms, coupled with reports that sulindac affects other cellular pathways (Marx, 2001
), suggests that sulindac's clinical antitumor effects may involve multiple cellular mechanisms. Nevertheless, the mechanism reported on here, sulindac regulation of survivin expression, might be particularly important inasmuch as it directly involves the main pathway, dysregulation of APC:
-catenin:Tcf-4 signaling, by which most colonic tumors appear to be initiated. Also, there may be other Tcf-4 target genes, in addition to survivin, that are affected by sulindac's effects on
-catenin. Further work may identify specific steps in this pathway that could serve as effective targets for cancer treatment and even chemoprevention.
| Acknowledgements |
|---|
| Footnotes |
|---|
ABBREVIATIONS: NSAID, nonsteroidal anti-inflammatory drug; FAP, familial adenomatous polyposis; COX, cyclooxygenase; APC, adenomatous polyposis coli; Tcf-4, T-cell factor 4; RT-PCR, reverse transcription-polymerase chain reaction.
Address correspondence to: Dr. Bruce M. Boman, Director, Division of Genetic and Preventive Medicine, Department of Medicine, 1100 Walnut St., Suite 400, Thomas Jefferson University, Philadelphia PA 19107. E-mail: bruce.boman{at}mail.tju.edu
| References |
|---|
|
|
|---|
Adida C, Crotty PL, McGrath J, Berrebi D, Diebold J, and Altieri DC (1998) Developmentally regulated expression of the novel anti-apoptosis gene survivin in human and mouse differentiation. Am J Pathol 152: 4349.[Abstract]
Ambrosini G, Adida C, and Altieri DC (1997) A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nature Med 3: 917921.[CrossRef][Medline]
Beazer-Barclay Y, Levy DB, Moser AR, Dove WF, Hamilton SR, Vogelstein B, and Kinzler KW (1996) Sulindac suppresses tumorigenesis in the Min mouse. Carcinogenesis 17: 17571760.
Bolton MA, Lan W, Powers SE, McCleland ML, Kuang J, and Stukenberg PT (2002) Aurora B kinase exists in a complex with survivin and INCENP and its kinase activity is stimulated by survivin binding and phosphorylation. Mol Biol Cell 13: 30643077.
Boman BM, Zhang T, and Fields JZ (2004) Evidence that APC regulates survinin expression: a possible mechanism contributing to the stem cell origin of colon cancer (Letter to the Editor). Cancer Res, in press.
Brown WA, Skinner SA, Malcontenti-Wilson C, Vogiagis D, and O'Brien PE (2001a) Non-steroidal anti-inflammatory drugs with activity against either cyclooxygenase 1 or cyclooxygenase 2 inhibit colorectal cancer in a DMH rodent model by inducing apoptosis and inhibiting cell proliferation. Gut 48: 660666.
Brown WA, Skinner SA, Vogiagis D, and O'Brien PE (2001b) Inhibition of beta-catenin translocation in rodent colorectal tumors: a novel explanation for the protective effect of nonsteroidal anti-inflammatory drugs in colorectal cancer. Dig Dis Sci 46: 23142321.[CrossRef][Medline]
Chen J, Jin S, Tahir SK, Zhang H, Liu X, Sarthy AV, McGonigal TP, Liu Z, Rosenberg SH, and Ng SC (2003) Survivin enhances aurora B kinase activity and localizes aurora B in human cells. J Biol Chem 278: 486490.
Fournier DB and Gordon GB (2000) COX-2 and colon cancer: potential targets for chemoprevention. J Cell Biochem 34 (Suppl): 97102.
Giardiello FM, Hamilton SR, Krush AJ, Piantadosi S, Hylind LM, Celano P, Booker SV, Robinson CR, and Offerhaus GJ (1993) Treatment of colonic and rectal adenomas with sulindac in familial adenomatous polyposis. New Engl J Med 328: 13131316.
Giardiello FM, Yang VW, Hylind LM, Krush AJ, Petersen GM, Trimbath JD, Piantadosi S, Garrett E, Geiman DE, Hubbard W, et al. (2002) Primary chemoprevention of familial adenomatous polyposis with sulindac. N Engl J Med 346: 10541059.
He T-C, Chan TA, Vogelstein B, and Kinzler WK (2000) PPAR
is an APC-regulated target of nonsteroidal anti-inflammatory drugs. Cell 99: 335345.
Hoffman W, Biade S, Zilfou JT, Chen J, and Murphy M (2002) Transcriptional repression of the anti-apoptotic survivin gene by wild type p53. J Biol Chem 277: 32473257.
Keller JJ, Offerhaus GJ, Frillenburg P, Caspers E, Musler A, Ristimaki A, and Giardiello FM (2001) Molecular analysis of sulindac-resistant adenomas in familial adenomatous polyposis. Clin Cancer Res 7: 40004007.
Kishimoto Y, Takata N, Jinnai T, Morisawa T, Shiota G, Kawasaki H, and Hasegawa. J (2000) Sulindac and a cyclooxygenase-2 inhibitor, etodolac, increase APC mRNA in the colon of rats treated with azoxymethane. Gut 47: 812819.
Li H, Liu L, David ML, Whitehead CM, Chen M, Getter JR, Sperl GJ, Pamukcu R, and Thompson WJ (2002) Pro-apoptotic actions of exisulind and CP461 in SW480 colon tumor cells involve beta-catenin and cyclin D1 down-regulation. Biochem Pharmacol 64: 13251335.[CrossRef][Medline]
Mahmoud NN, Boolbol SK, Bilinski RT, Martucci C, Chadburn A, and Bertagnolli MM (1997) Apc gene mutation is associated with a dominant-negative effect upon intestinal cell migration. Cancer Res 57: 50455050.
Marx J (2001) Anti-inflammatories inhibit cancer growth but how? Science (Wash DC) 291: 581582.
Masunaga R, Kohno H, Dhar DK, Kotoh T, Tabara H, Tachibana M, Kubota H, and Nagasue N (2001) Enhanced apoptosis and transforming growth factor-beta1 expression in colorectal adenomas and carcinomas after sulindac therapy. Dis Colon Rectum 44: 10081015.[CrossRef][Medline]
Masunaga R, Kohno H, Kumar DD, Kotoh T, Tachibana M, Kubota H, and Nagasue N (2000) Sulindac inhibits growth of rat colon carcinoma by inducing apoptosis. Eur Surg Res 32: 305309.[CrossRef][Medline]
Mattila J, Mantyla R, Vuoreta A, Lamminsivu U, and Mannisto P (1984) Pharmacokinetics of graded oral doses of sulindac in man. Arzneim-Forsch 34: 226229.[Medline]
McEntee MF, Chiu CH, and Whelan J (1999) Relationship of beta-catenin and Bcl-2 expression to sulindac-induced regression of intestinal tumors in Min mice. Carcinogenesis 20: 635640.
Mirza A, McGuirk M, Hockenberry TN, Wu Q, Ashar H, Black S, Wen SF, Want L, Kirschmeier P, Bishop WR, et al. (2002) Human survivin is negatively regulated by wild-type p53 and participates in p53-dependent apoptotic pathway. Oncogene 21: 26132622.[CrossRef][Medline]
Naishiro Y, Yamada T, Takaoka AS, Hayashi R, Hasegawa F, Imai K, and Hirohashi S (2001) Restoration of epithelial cell polarity in a colorectal cancer cell line by suppression of beta-catenin/T-cell factor 4-mediated gene transactivation. Cancer Res 61: 27512758.
Patrignani P (2000) Nonsteroidal anti-inflammatory drugs, COX-2 and colorectal cancer. Toxicol Lett 112113: 493498.
Ravis WR, Diskin CJ, Campagna KD, Clark CR, and McMillian CL (1993) Pharmacokinetics and dialyzability of sulindac and metabolites in patients with end-stage renal failure. J Clin Pharmacol 33: 527534.[Abstract]
Rice PL, Kelloff J, Sullivan H, Driggers LJ, Beard KS, Kuwada S, Piazza G, and Ahnen DJ (2003) Sulindac metabolites induce caspase- and proteasome-dependent degradation of beta-catenin protein in human colon cancer cells. Mol Cancer Ther 2: 885892.
Richter M, Weiss M, Weinberger I, Furstenberger G, and Marian B (2001) Growth inhibition and induction of apoptosis in colorectal tumor cells by cyclooxygenase inhibitors. Carcinogenesis 22: 1725.
Schnitzler M, Dwight T, and Robinson BG (1996) Sulindac increases the expression of APC mRNA in malignant colonic epithelial cells: an in vitro study. Gut 38: 707713.
Shiff SJ, Qiao L, Tsai LL, and Rigas B (1995) Sulindac sulfide, an aspirin-like compound, inhibits proliferation, causes cell cycle quiescence and induces apoptosis in HT-29 colon adenocarcinoma cells. J Clin Investig 96: 491503.
Taylor MT, Lawson KR, Ignatenko NA, Marek SE, Stringer DE, and Skovan BA (2000) Sulindac sulfone inhibits k-ras dependent cyclooxygenase-2 expression in human colon cancer cells. Cancer Res 60: 66076610.
Thompson WJ, Piazza GA, Li H, Liu L, Fetter J, Zhu B, Sprel G, Ahnen D, and Pamukcu R (2000) Exisulind induction of apoptosis involves guanosine 3',5'-cyclic monophosphate phosphodiesterase inhibition, protein kinase G activation and attenuated beta-catenin. Cancer Res 60: 33383342.
Torrance CJ, Jackson PE, Montgomery E, Kinzler KW, Vogelstein B, Wissner A, Nunes M, Frost P, and Discafani CM (2000) Combinatorial chemoprevention of intestinal neoplasia. Nature Med 6: 10241028.[CrossRef][Medline]
Waddell WR and Loughry RW (1983) Sulindac for polyposis of the colon. J Surg Oncol 24: 8388.[Medline]
Zhang L, Yu J, Park BH, Kinzler KW, and Vogelstein B (2000) Role of BAX in the apoptotic response to anticancer agents. Science (Wash DC) 290: 989992.
Zhang T, Otevrel T, Gao ZQ, Gao ZP, Ehrlich SM, Fields JZ, and Boman BM (2001) Evidence that APC regulates survivin expression: a possible mechanism contributing to the stem cell origin of colon cancer. Cancer Res 61: 86648667.
Zhou M, Gu L, Li F, Zhu Y, Woods WG, and Findley HW (2002) DNA damage induces a novel p53-survivin signaling pathway regulating cell cycle and apoptosis in acute lymphoblastic leukemia cells. J Pharmacol Exp Ther 303: 124131.
This article has been cited by other articles:
![]() |
M. Schwab, V. Reynders, S. Loitsch, Y. M. Shastri, D. Steinhilber, O. Schroder, and J. Stein PPAR{gamma} is involved in mesalazine-mediated induction of apoptosis and inhibition of cell growth in colon cancer cells Carcinogenesis, July 1, 2008; 29(7): 1407 - 1414. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gaspar, J. Cardoso, P. Franken, L. Molenaar, H. Morreau, G. Moslein, J. Sampson, J. M. Boer, R. X. de Menezes, and R. Fodde Cross-Species Comparison of Human and Mouse Intestinal Polyps Reveals Conserved Mechanisms in Adenomatous Polyposis Coli (APC)-Driven Tumorigenesis Am. J. Pathol., May 1, 2008; 172(5): 1363 - 1380. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. A. Sinicrope and R. C. Penington Sulindac sulfide-induced apoptosis is enhanced by a small-molecule Bcl-2 inhibitor and by TRAIL in human colon cancer cells overexpressing Bcl-2 Mol. Cancer Ther., October 1, 2005; 4(10): 1475 - 1483. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||