![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GASTROINTESTINAL, HEPATIC, PULMONARY, AND RENAL
First Department of Surgery, University of Yamanashi, Yamanashi, Japan (H.K., M.A., A.M., H.A., M.M., Y.M.); and Department of Surgery, Shinko Byoin Hospital, Hyogo, Japan (M.Y.)
Received for publication
April 28, 2003
Accepted
June 17, 2003.
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionConclusionReferences |
|---|
and interleukin-6 were significantly blunted in the liver by EDA. This reduction was accompanied by a significant reduction of their serum levels. In conclusion, EDA prevented liver injury by both inhibition of recruitments of inflammatory cells and expression of inflammatory cytokine levels in the liver.
). As it is well known, not only free radical itself but also lipid peroxidative metabolites such as 4-hydroxynonenal (HNE)-modified protein cause cytotoxicity on endothelial cells and hepatocytes. Additionally, free radical induces proinflammatory cytokine and chemokine productions by tissue macrophages immediately, which subsequently attracts inflammatory cells into the liver. Polymorphonuclear and mononuclear cells attached to the hepatic sinusoid also produce a large amount of free radicals and cause liver injury (Mayer and Spitzer, 1993; Spitzer and Mayer, 1993). In our previous work, elimination of hepatic macrophage, the Kupffer cell, which is a potent source of free radicals in the liver in endotoxemia, by gadolinium chloride (GdCl3) blunted proinflammatory cytokine production and the number of infiltrating inflammatory cells after lipopolysaccharide (LPS) challenge, and then, in turn, reduced liver injury as well as mortality (Iimuro et al., 1996; Kono et al., 1998). Together, free radicals play a critical role in endotoxemia and hence therapies against oxidants could be useful in inflammation or sepsis.
Antioxidants such as diphenyleneiodonium sulfate, allopurinol, and superoxide dismutase scavenged free radicals, as reported in previous work (Feher et al., 1998). Allopurinol and diphenyleneiodonium sulfate prevented alcohol-induced liver injury by inhibition of free radical formation in the liver in a rat enteral model (Fehniger et al., 1999; Kono et al., 2000a). Furthermore, allopurinol prevented liver injury due to ischemia-reperfusion by inhibition of free radical formation (Wong and Wispe, 1997). Superoxide dismutase also prevented LPS-induced liver injury in hepatectomized rats (Kono et al., 2001a). These chemicals, however, may not be appropriate for clinical use due to their toxicity and instability. 3-methyl-1-phenyl-2-pyrazolin-5-one (edaravone; EDA) is a potent and novel scavenger of free radicals inhibiting not only hydroxyl radicals but also iron-induced peroxidative injuries (Watanabe et al., 1997). It has been reported that edaravone changes into 2-oxo-3-(phenylhydrazono)-butanoic acid after the reaction with peroxy radicals in vitro (Yamamoto et al., 1996). Edaravone has protective effects on both hemispheric embolization and transient cerebral ischemia in rats (Watanabe et al., 1994; Kawai et al., 1997). Furthermore, it has been reported that edaravone have protective effects against brain damage after ischemia-reperfusion by scavenging hydroxyl radical clinically. These effects were predominantly thought of as a result of protection of endothelial cells and neurons against lipid peroxidation. Therefore, the specific purpose of this study was to investigate the possible anti-inflammatory effect of edaravone, attenuation of lipid peroxidation or inhibition of proinflammatory and chemokine gene activation, leading to inhibition of inflammatory cell recruitments in the liver.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionConclusionReferences |
|---|
) or the same volume of saline (1 ml/kg) as vehicle was started just after LPS injection and then was continued intermittently every 2 h (five administrations in total) (Fig. 1). To decide the optimal dose of edaravone for the proposed experiment, rats were given edaravone with a dose of 0, 0.3, 1.5, 3, 6, and 12 g/kg/day or the same volume of saline (n = 6 in each group). Rats were given food and water ad libitum throughout the study.
|
Experiment II: Analysis of Mechanisms.
For further analysis of mechanisms, a dose of 3 mg/kg edaravone was used, because maximum effects of improvement of survival rates were observed at this dose.
Serum Alanine Aminotransferase (ALT) Levels after LPS Administration. In a separate set of experiments to determine the extent of liver damage by LPS and evaluate effects of edaravone on liver injury, ALT assay was performed. Blood samples were collected from the aorta 9 h after LPS administration in all groups and centrifuged at 1,200g for 10 min at 4°C, respectively (n = 8 in each group). Serum was stored at –80°C until assays. ALT was measured enzymatically (Nissui Transnase; Nissui Pharmaceutical Co., Tokyo, Japan) (Arai, 1986).
Pathological Change and the Number of Neutrophils in the Liver. Liver specimens taken 9 h LPS administration were formalin-fixed, embedded in paraffin, and stained with hematoxylin-eosin to assess inflammation and necrosis (n = 6 in each group). Histological samples were evaluated by one of the authors and by an outside expert in rodent liver pathology.
The number of neutrophils (n = 6 in each group) in the liver was expressed per 400 hepatocytes in three high-power fields (400x) per slide (Alexander et al., 1998). The mean value from three high-power fields was used for statistical analysis.
Assay of Serum TNF- and IL-6 Levels. For measurements of cytokines, blood samples were collected from the aorta 60 min, 90 min, 6 h, or 9 h after LPS or saline injections (n = 6 in each group). Samples were centrifuged at 1,200g for 10 min at 4°C and serum was stored at –80°C until assays. TNF- and IL-6 levels were determined using an ELISA kit (Cosmo Bio Co., Tokyo, Japan).
Immunohistochemical Detection of HNE-Modified Proteins in the Liver. Paraffin-embedded sections of liver tissue were deparaffinized, rehydrated, and stained immunohistochemically for the presence of an in vivo marker of lipid peroxidation, 4-hydroxynonenal protein adducts, by sequential incubation with a polyclonal antibody (Alpha Diagnostic International, San Antonio, TX) in phosphate-buffered saline (pH 7.4) containing 1% Tween 20 and 1% bovine serum albumin (Eldridge et al., 1990). Peroxidase-linked secondary antibody and diaminobenzidine (peroxidase envision kit; DAKO, Carpinteria, CA) were used to detect specific binding. The slides were rinsed twice with phosphate-buffered saline-0.1% Tween 20 between all incubations, and sections were counterstained with hematoxylin as described previously (Kono et al., 2001c). To control for nonspecific binding of the secondary antibody, sections from the same animals were processed without the primary antibody, followed by the procedure detailed above. No positive staining was observed in this control experiment (data not shown).
Real-Time Reverse Transcription-Polymerase Chain Reaction (RT-PCR) for mRNA Expressions of TNF-, IL-6, Interferon (IFN)-
, and IL-10 in Liver Tissues. mRNAs were quantified by a real-time RT-PCR procedure (TaqMan; Applied Biosystems, Foster City, CA). Quantitative real-time PCR was performed with the GeneAmp 5700 sequence detection system (Applied Biosystems). For the sequence of specific primers for TNF- (accession no. NM 012676), IL-6 (accession no. M26744
[GenBank]
), IFN- (accession no. AF010466
[GenBank]
), and IL-10 (accession no. NM 012854), predeveloped TaqMan assay reagents (Applied Biosystems) were used. Ribosomal RNA (18s rRNA) was used as an internal control.
Liver tissue samples were collected from animals sacrificed at 60 min for TNF- or 6 h for IL-6, IFN-, and IL-10 after LPS or saline injections. Total RNA was isolated from about 25-mg samples of liver tissue by the use of an RNA purification kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer's instructions. Reverse transcription of total RNA (2 µg) was performed in a final volume of 100 µl containing 1x TaqMan reverse transcription buffer, 5.5 mM MgCl2, 500 µM/l each dNTP, 2.5 µM random hexamers, 0.4 U/µl RNase inhibitor, and 1.25 U/µl multiscribe reverse transcriptase. Two microliters of cDNA samples was used for quantitative RT-PCR (a 10-min step at 95°C, followed by 40 cycles of 15 s at 95°C, and 1 min at 60°C in the presence of specific forward and reverse primers and TaqMan Universal PCR Master Mix; Applied Biosystems). Messenger RNA levels were calculated using the comparative Ct method (Pritts et al., 2002) and normalized to ribosomal RNA. To confirm amplification specificity, polymerase chain reaction (PCR) products were subjected to a melting curve analysis.
RT-PCR for mRNA Expressions of Macrophage Inflammatory Protein (MIP)-2, Monocyte Chemoattractant Protein (MCP)-1, and MCP-5 in the Liver. Liver tissue samples were collected from animals sacrificed at 9 h after LPS or saline injections. Total RNA was isolated from about 25-mg samples of liver tissue by the use of a RNA purification kit (QIAGEN GmbH) according to the manufacturer's instructions and used for PCR assay to detect mRNA expressions of MIP-2, MCP-1, and MCP-5.
Reverse transcription of total RNA was performed by the method described above. PCR primers for MIP-2, MCP-1, MCP-5, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) contained the following sequences: MIP-2 sense (5'-CAGAGCTTGAGTGTGACG-3') and antisense (5'-TCGTACCTGATGTGCCTC-3'); MCP-1 sense (TCCACCACTATGCAGGTCTC) and antisense (TGGACCCATTCCTTATTGGG); MCP-5 sense (CCACATTCGGAGGCTAAAG) and antisense (GGGGAAGGTCAGAGGAAATAA); and GAPDH sense (5'-TGAAGGTCGGAGTCAACGGATTTGGT-3') and antisense (5'-CATGTGGGCCATGAGGTCCACCAC-3').
The size of amplified PCR products was subjected to electrophoresis at 100 V through 2% agarose gel (Invitrogen, Carlsbad, CA) for about 30 min. Agarose gels were stained with 0.5 mg/ml ethidium bromide Tris/borate/EDTA buffer (ICN, Costa Mesa, CA) and photographed with type 55 Polaroid positive/negative film. Densitometric analysis of the captured image was performed on a Macintosh computer using NIH Image 1.54 analysis software. The area under the curve was normalized for GAPDH content.
Immunohistochemistry for ED1 and ED2 Antibodies. Tissue samples from the liver were collected from rats sacrificed 9 h after injection of LPS or vehicle, fixed in formalin, embedded in paraffin, and serially sectioned (5 µm in thickness). Some sections were used for the immunohistochemistry using ED1 and ED2 monoclonal antibodies and labeled streptavidin biotin kit (DAKO). The antibodies used were ED1-specific for macrophages/monocytes (Hardonk et al., 1992; Johnson and Kudsk, 1999) but not granulocytes and ED2 specific for Kupffer cells (Serotec, Oxford, UK). Immunohistochemistry was performed as follows. Liver sections were fixed in acetone for 5 min and covered with 0.5% hydrogen peroxide in methanol to block endogenous peroxidase. The sections were first incubated with normal goat serum and then with primary diluted antibodies (1:200 for ED1 and 1:100 for ED2), a secondary antibody composed of biotinized goat anti-rabbit and mouse immunoglobulins; and finally with peroxidase-incorporated streptavidin. The sections were developed with 3,3'-diaminobenzidine and counterstained with hematoxylin.
Statistics
Data are expressed as mean values ± S.E.M. ANOVA with Bonferroni's post hoc test or the Student's t test was used for the determination of statistical significance as appropriate. A P value less than 0.05 was selected before the study as the level of significance.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionConclusionReferences |
|---|
|
Experiment II: Analysis of the Mechanisms for Improvement of Survival
Serum ALT Levels after LPS Administration. Serum ALT levels were about 40 IU/l before LPS administration, and edaravone alone had no effect on its value (Fig. 2). ALT levels increased to about 1,250 IU/l 9 h after LPS administration in the vehicle-treated group. Edaravone also blunted this increase significantly.
|
Effect of Edaravone on LPS-Induced Liver Injury. No pathological changes were observed in liver tissues from both the vehicle-treated and the EDA group before LPS administration (Fig. 3, A and B). In contrast, inflammation, focal necrosis (Fig. 3E), and hemorrhagic change (Fig. 3F) were observed in the liver 9 h after LPS administration in the vehicle-treated group (Fig. 3C). Edaravone prevented these pathological changes markedly (Fig. 3D).
|
Effect of LPS and Edaravone on Serum TNF- and IL-6 Levels. These values were below the limit for detection in rats without LPS injection (data not shown). As expected, LPS administration caused a rapid peak increase in serum TNF- levels to about 120 ng/ml after 90 min, and values were decreased gradually to the basal level by 9 h in the vehicle-treated rats (Fig. 4). Edaravone blunted these levels at 60 min, 90 min, and 6 h after LPS injection significantly. Alternatively, IL-6 levels were increased gradually until 6 h and reached maximum values of about 100 ng/ml in the vehicle-treated group. Although values were also increased in rats treated with edaravone, they were only about 15 ng/ml. There were significant differences in IL-6 levels between the two groups.
|
Messenger RNA Expression of MIP-2, MCP-1, and MCP-5 and the Number of Infiltrating Neutrophils in the Liver. Messenger RNA expression of MIP-2 was minimal before LPS injection in both the two groups. On the other hand, it was significantly increased in the vehicle-treated group after LPS administration as expected. This increase was significantly blunted by edaravone treatment (Fig. 5).
|
Alternatively, mRNA expression of MCP-1 and MCP-5 were also assessed. Messenger RNA expressions of MCP-1 were not affected by EDA. On the other hand, mRNA expressions of MCP-5 were significantly blunted by edaravone.
The number of infiltrating neutrophils in the liver from the vehicle-treated or the EDA group is shown in Fig. 6. The number was minimal before LPS injection. In contrast, infiltrating neutrophils were increased significantly after LPS administration in the vehicle-treated rats. This increase was blunted significantly by edaravone, consistent with the results of MIP-2 mRNA expression.
|
Immunohistochemical Detection of HNE-Modified Protein. To test whether edaravone reduced lipid peroxidation caused by LPS challenge, 4-HNE-modified proteins were detected by immunohistochemistry (Fig. 7) (Marotto et al., 1988). Increases in 4-hydroxynonenal protein adducts were not detected before LPS administration. After LPS injection, a significant accumulation of 4-hydroxynonenal (brown staining) was observed in the liver. These accumulations were significantly reduced in livers from rats treated with edaravone.
|
Messenger RNA Expression of TNF-, IL-6, IFN-, and IL-10 in the Liver. Messenger RNA expressions of TNF-, IL-6 INF-, and IL-10 were assessed in the liver from the vehicle- or edaravone-treated rats (Fig. 8). Expressions were not detectable in the liver before LPS administration. In contrast, LPS administration significantly increased these expressions about 3-fold in livers from the vehicle-treated rats. Expressions of inflammatory cytokines TNF-, IL-6, and IFN- were blunted by about 70% by EDA. On the other hand, anti-inflammatory cytokine IL-10 were not affected by edaravone.
|
Immunohistochemistry for ED1 and ED2 in the Liver. In further experiments, we assessed the effect edaravone and LPS on hepatic macrophage population by immunohistochemistry with ED1 and ED2 monoclonal antibodies (Fig. 9, A and B). Furthermore, ED2-positive cells, which may be resident hepatic macrophages, were located mainly around the periportal area (Fig. 9B). Administration of LPS did not increase the number of ED2-positive cells in vehicle-treated group. In contrast, the number of ED1-positive cells was increased significantly in vehicle-treated rats but not rats treated with EDA after LPS administration, suggesting that infiltrating monocytes/macrophages were increased (Fig. 9A).
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionConclusionReferences |
|---|
) and prevents the peroxidative vascular endothelial damage caused by hydroperoxyeicosatetraenoic acid in vitro (Otomo et al., 1998). It was reported that edaravone reacted with DPPH, hydroxyl radicals generated by Fenton reaction, and peroxyl radical generated by Fe3+-stimulated decomposition of methyl linoleate hydroperoxide in vitro (Spitzer and Mayer, 1993). In that study, 2-oxo-3-(phenylhydrazono)-butanoic acid was observed as the reaction product of edaravone in methanol/phosphate buffer under atmospheric condition.
Edaravone was metabolized in the liver and excreted rapidly in the urine within 24 h after the beginning of infusion. Irrespective of the dose and infusion time, the urinary excretion rates of edaravone and its conjugates were almost the same. Initially, edaravone was tested in various different models to evaluate its protective effects in cerebral ischemia/reperfusion (Goode and Webster, 1993). In cerebral infarction, free radicals (e.g., hydroxyl radicals) are thought to play an important role in the secondary injury cerebral ischemia mainly by activating the lipoxygenase pathway in the arachidonic acid cascade (Seki et al., 1998). Thus, inhibition of free radical production may result in the attenuation of secondary injury theoretically. Therefore, edaravone was used to scavenge free radicals to protect from brain injuries in several animal studies. Based on these results, it has been clinically used for therapies against acute cerebral infarction without any significant safety problems (Barsig et al., 1995). Therefore, this study was undertaken to determine whether edaravone prevents liver injury and mortality in rats administered endotoxin. Because edaravone blunted increases in lipid peroxidation (Fig. 7) and prevented liver injury (Fig. 3), one effect of edaravone in endotoxemia was inhibition of lipid peroxidation caused by oxidants.
Role of Chemoattractant Factors and Infiltrating Leukocytes in Endotoxemia. Free radicals also increase proinflammatory cytokines such as TNF-, which is involved in triggering a vicious cycle in infectious insults via the redox-sensitive transcriptional factor nuclear factor-
B (Kono et al., 2000b). These proinflammatory cytokines regulate the chemoattractant factors, which subsequently increase leukocyte numbers into the host tissue. Indeed, endotoxin influxes in the circulation stimulate the hepatic resident macrophages, Kupffer cells, to produce MIP-2, and up-regulate the expression of adhesion molecules, i.e., CD18 on neutrophils and its counter-receptor intercellular adhesion molecule-1 on sinusoidal endothelial cells (Bautista, 1997). Furthermore, expressions of the CC chemokines such as MCP-1 and MCP-5 are increased after LPS administration, and they are all chemotactic for monocytes/macrophages and T cells (Valente et al., 1988). Polymorphonuclear cells and mononuclear cells attached to the hepatic sinusoid also produce a large amount of mediators (Spitzer and Mayer, 1993; Mayer and Spitzer, 1993). Various mediators produced by these recruited cells induce injury of the sinusoidal endothelial cells (Vollmar et al., 1996; Bukara and Bautista, 2000). As a result, enhanced sequestration and cell-cell interaction among these cell types may occur in the liver, which in turn could result in altered hepatic function and hepatotoxicity. Indeed, elimination of the hepatic macrophages by gadolinium chloride almost completely prevented free radical production, the number of infiltrating cells, and liver injury (Kohno et al., 1993; Kono et al., 2001a; Iimuro et al., 1996). Thus, tissue attached inflammatory cell play an important role in sepsis or endotoxemia. Therefore, expression of chemotactic factors in the liver was assessed in this study. LPS administration increased in mRNA expression of MIP-2, MCP-1, and MCP-5. These expressions were significantly blunted by edaravone (Figs. 5 and 8). As a result, the number of neutrophils and monocytes/macrophage in the liver was significantly blunted by edaravone (Figs. 6 and 9). It was reported that recruiting neutrophils and lymphocytes produce a large amount of proinflammatory cytokines such as IFN- and IL-6, which is involved in the hepatotoxicity (Murota et al., 1990). In this study, edaravone also blunted increases in mRNA expression of IFN- and IL-6 in the liver (Fig. 8). It is likely that MIP-2, MCP-1, and MCP-5 induced by TNF- recruit inflammatory cells in the liver and that production of toxic mediators is involved in hepatic inflammation and necrosis in endotoxemia (Hewett et al., 1992). Indeed, TNF- mRNA expression was significantly blunted in the liver by edaravone (data not shown), although differences in its serum levels were very small (Fig. 4). In this study, changes in TNF- in the serum were relatively small but significantly deceased compared with those of serum IL-6 levels. TNF- is released early after an inflammatory stimulus followed by release of IL-1 and later by IL-6 (Damas et al., 1992). In the present study, the reduction of TNF- levels in the serum with edaravone treatment was small but exactly reduced the elevation of IL-6 in serum 6 h later. IL-6 is an integral part of the inflammatory response to sepsis and endotoxemia.
Alternatively, IL-10 is among the most potent anti-inflammatory agents induced in response to LPS (Moore et al., 1993). Indeed, anti-IL-10 antibody pretreatment increases mortality in lethal endotoxemic mice model (Standiford et al., 1995). In contrast, recombinant IL-10 influx significantly prevents LPS-induced lethality in rodent model. In this study, LPS challenge increased mRNA expression of IL-10, consistent with previous work (Fig. 8). Several studies have demonstrated the ability of IL-10 to down-regulate LPS-inducible mRNA expression of inflammatory cytokines (IFN-, IL-1, IL-6, IL-12, and TNF-) and chemokines (interferon--inducible protein-10, keratinocyte-derived chemokine, MIP-1, and MIP-1
) (Lentsch et al., 1997; Yoshidome et al., 1999). In this study, the up-regulated expression of IL-10 was not affected by edaravone, ruling out the contribution of this pathway to the protective effect of edaravone (Fig. 8).
|
Conclusion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionConclusionReferences |
|---|
|
Footnotes |
|---|
ABBREVIATIONS: HNE, hydroxynonenal; LPS, lipopolysaccharide; EDA, edaravone; ALT, alanine aminotransferase; TNF, tumor necrosis factor; IL, interleukin; RT-PCR, reverse transcription-polymerase chain reaction; IFN, interferon; MIP, macrophage infiltrating protein; MCP, monocyte chemoattractant protein; PCR, polymerase chain reaction; GADPH, glyceraldehyde-3-phosphate dehydrogenase; ANOVA, analysis of variance.
Address correspondence to: Dr. Hiroshi Kono, First Department of Surgery, University of Yamanashi, 1110 Shimokato, Tamaho, Nakakoma, Yamanashi 409-3898, Japan. E-mail: hkouno{at}res.yamanashi-med.ac.jp
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionConclusionReferences |
|---|
Abe K, Yuki S, and Kogure K (1988) Strong attenuation of ischemic and postischemic brain edema in rats by a novel free radical scavenger. Stroke 19: 480–485.
Alexander JW, Ogle CK, and Nelson JL (1998) Diets and infection: composition and consequences. World J Surg 22: 209–212.[CrossRef][Medline]
Arai M (1986) Effect of ethanol on the intestinal uptake of endotoxin. Nippon Shokakibyo Gakkai Zasshi 83: 1060.[Medline]
Barsig J, Kusters S, Vogt K, Volk HD, Tiegs G, and Wendel A (1995) Lipopolysaccharide-induced interleukin-10 in mice: role of endogenous tumor necrosis factor-alpha. Eur J Immunol 25: 2888–2893.[Medline]
Bautista AP (1997) Chronic alcohol intoxication induces hepatic injury through enhanced macrophage inflammatory protein-2 production and intercellular adhesion molecule-1 expression in the liver. Hepatology 25: 335–342.[CrossRef][Medline]
Bukara M and Bautista AP (2000) Acute alcohol intoxication and gadolinium chloride attenuate endotoxin-induced release of CC chemokines in the rat. Alcohol 20: 193–203.[CrossRef][Medline]
Damas P, Ledoux D, Nys M, Vrindts Y, De Groote D, Franchimont P, and Lamy M (1992) Cytokine serum level during severe sepsis in human IL-6 as a marker of severity. Ann Surg 215: 356–362.[Medline]
Eldridge SR, Tilbury LF, Goldsworthy TL, and Butterworth BE (1990) Measurement of chemically induced cell proliferation in rodent liver and kidney: a comparison of 5-bromo-2'-deoxyuridine and [3H]thymidine administered by injection or osmotic pump. Carcinogenesis 11: 2245–2251.
Feher J, Lengyel G, and Blazovics A (1998) Oxidative stress in the liver and biliary tract diseases. Scand J Gastroenterol Suppl 228: 38–46.[Medline]
Fehniger TA, Shah MH, Turner MJ, VanDeusen JB, Whitman SP, Cooper MA, Suzuki K, Wechser M, Goodsaid F, and Caligiuri MA (1999) Differential cytokine and chemokine gene expression by human NK cells following activation with IL-18 or IL-15 in combination with IL-12: implications for the innate immune response. J Immunol 162: 4511–4520.
Goode HF and Webster NR (1993) Free radicals and antioxidants in sepsis. Crit Care Med 21: 1770–1776.[Medline]
Hardonk MJ, Dijkhuis FWJ, and Hulstaert CE (1992) Heterogeneity of rat liver and spleen macrophages in gadolinium chloride-induced elimination and repopulation. J Leukoc Biol 52: 296–302.[Abstract]
Hewett JA, Schultze AE, VanCise S, and Roth RA (1992) Neutrophil depletion protects against liver injury from bacterial endotoxin. Lab Investig 66: 347–361.[Medline]
Iimuro Y, Yamamoto M, and Kono H (1996) Blockade of liver macrophages by gadolinium chloride reduces lethality in endotoxemic rats; analysis of mechanisms of lethality in endotoxemia. J Leukoc Biol 55: 723–728.
Johnson CD and Kudsk KA (1999) Nutrition and intestinal mucosal immunity. Clin Nutr 18: 337–344.[CrossRef][Medline]
Kawai H, Nakai H, Suga M, Yuki S, Watanabe T, and Saito K (1997) Effects of a novel free radical scavenger, MCI-186, on ischemic brain damage in the rat distal middle cerebral artery occlusion model. J Pharmacol Exp Ther 281: 921–927.
Kohno H, Yamamoto M, and Iimuro Y (1993) Reduction of mortality in endotoxemic rats pretreatment with gadolinium chloride: relationship to suppression of superoxide production in liver macrophages. Yamanashi Med J 8: 101–112.
Kono H, Fujii H, Matsuda M, Yamamoto M, and Matsumoto Y (2001a) Gadolinium chloride prevents mortality in hepatectomized rats given endotoxin. J Surg Res 96: 204–210.[CrossRef][Medline]
Kono H, Rusyn I, and Thurman RG (2000a) Allopurinol attenuates hepatic necrosis and inflammation caused by chronic intragastric ethanol exposure in rats. J Pharmacol Exp Ther 293: 296–303.
Kono H, Rusyn I, Uesugi T, Yamashina S, Connor HD, Dikalova A, Mason RP, and Thurman RG (2001b) Diphenyleneiodonium sulfate, an NADPH oxidase inhibitor, prevents early alcohol-induced liver injury in the rat. Am J Physiol 280: G1005–G1012.
Kono H, Rusyn I, Yin M, Gabele E, Yamashina S, Dikalova A, Kadiiska MB, Connor HD, Mason RP, Segal BH, et al. (2000b) NADPH oxidase-derived free radicals are key oxidants in alcohol-induced liver disease. J Clin Investig 106: 867–872.[Medline]
Kono H, Uesugi T, Froh M, Rusyn I, Bradford BU, and Thurman RG (2001c) ICAM-1 is involved in the mechanism of alcohol-induced liver injury: studies with knockout mice. Am J Physiol 280: G1289–G1295.
Kono H, Yamamoto M, Iimuro Y, Fujii H, and Matsumoto Y (1998) The role of splenic macrophages in plasma tumor necrosis factor levels in endotoxemia. Eur Surg Res 29: 176–186.
Lentsch AB, Shanley TP, Sarma V, and Ward PA (1997) In vivo suppression of NF-kappa B and preservation of I kappa B alpha by interleukin-10 and interleukin-13. J Clin Investig 100: 2443–2448.[Medline]
Marotto ME, Thurman RG, and Lemasters JJ (1988) Early midzonal cell death during low-flow hypoxia in the isolated, perfused rat liver: protection by allopurinol. Hepatology 8: 585–590.[Medline]
Mayer AM and Spitzer JA (1993) Modulation of superoxide anion generation by manoalide, arachidonic acid and staurosporine in liver infiltrated neutrophils in a rat model of endotoxemia. J Pharmacol Exp Ther 267: 400–409.
Moore KW, O'Garra A, de Waal MR, Vieira P, and Mosmann TR (1993) Interleukin-10. Annu Rev Immunol 11: 165–190.[CrossRef][Medline]
Murota S, Morita I, and Suda N (1990) The control of vascular endothelial cell injury. Ann NY Acad Sci 598: 182–187.[Medline]
Otomo E, Tohgi H, Kogure K, Hirai S, Terashi A, Gotoh F, Tazaki Y, Ito E, and Swada T (1998) Clinical efficacy of a free radical scavenger, MCI-186 on acute cerebral infarction - early phase trial. Ther Res 19: 1311–1332.
Pritts T, Hungness E, Wang Q, Robb B, Hershko D, and Hasselgren PO (2002) Mucosal and enterocyte IL-6 production during sepsis and endotoxemia - role of transcription factors and regulation by the stress response. Am J Surg 183: 372–383.[CrossRef][Medline]
Seki S, Osada S, Ono S, Aosasa S, Habu Y, Nishikage T, Mochizuki H, and Hiraide H (1998) Role of liver NK cells and peritoneal macrophages in gamma interferon and interleukin-10 production in experimental bacterial peritonitis in mice. Infect Immun 66: 5286–5294.
Spitzer JA and Mayer AM (1993) Hepatic neutrophil influx: eicosanoid and superoxide formation in endotoxemia. J Surg Res 55: 60–67.[CrossRef][Medline]
Standiford TJ, Stieter RM, Lukacs NW, and Kunkel S (1995) Neutralization of IL-10 increases lethality in endotoxemia. J Immunol 155: 2222–2229.[Abstract]
Valente AJ, Graves DT, Vialle-Valentin CE, Delgado R, and Schwartz CJ (1988) Purification of a monocyte chemotactic factor secreted by nonhuman primate vascular cells in culture. Biochemistry 27: 4162–4168.[CrossRef][Medline]
Vollmar B, Ruttinger D, Wanner GA, Leiderer R, and Menger MD (1996) Modulation of Kupffer cell activity by gadolinium chloride in endotoxemic rats. Shock 6: 434–441.[Medline]
Watanabe K, Watanabe K, and Hayase T (1997) Radical scavenging mechanism of MCI-186. Jpn Pharmacol Ther 25: S1699–S1707.
Watanabe T, Yuki S, Egawa M, and Nishi H (1994) Protective effects of MCI-186 on cerebral ischemia: possible involvement of free radical scavenging and antioxidant actions. J Pharmacol Exp Ther 268: 1597–1604.
Wong HR and Wispe JR (1997) The stress response and the lung. Am J Physiol 273: L1–L9.
Yamamoto Y, Kuwahara T, Watanabe K, and Watanabe K (1996) Antioxidant activity of 3-methyl-1-phenyl-2-pyrazolin-5-one. Redox Rep 2: 333–338.
Yoshidome H, Kato A, Edwards MJ, and Lentsch AB (1999) Interleukin-10 inhibits pulmonary NF-kappaB activation and lung injury induced by hepatic ischemia-reperfusion. Am J Physiol 277: L919–L923.
This article has been cited by other articles:
|
|
 |
|
  K. Yagi, K. T. Kitazato, M. Uno, Y. Tada, T. Kinouchi, K. Shimada, and S. Nagahiro Edaravone, a Free Radical Scavenger, Inhibits MMP-9-Related Brain Hemorrhage in Rats Treated With Tissue Plasminogen Activator Stroke, February 1, 2009; 40(2): 626 - 631. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Arai, M. Nonogawa, K. Makino, N. Endo, H. Mori, T. Miyoshi, K. Yamashita, M. Sasada, M. Kakuyama, and K. Fukuda The Radical Scavenger Edaravone (3-Methyl-1-phenyl-2-pyrazolin-5-one) Reacts with a Pterin Derivative and Produces a Cytotoxic Substance That Induces Intracellular Reactive Oxygen Species Generation and Cell Death J. Pharmacol. Exp. Ther., February 1, 2008; 324(2): 529 - 538. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Koizumi, H. Tanaka, S. Sakaki, and S. Shimazaki The Therapeutic Efficacy of Edaravone in Extensively Burned Rats Arch Surg, October 1, 2006; 141(10): 992 - 995. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Qi, Y. Okuma, T. Hosoi, and Y. Nomura Edaravone Protects against Hypoxia/Ischemia-Induced Endoplasmic Reticulum Dysfunction J. Pharmacol. Exp. Ther., October 1, 2004; 311(1): 388 - 393. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|
 |
 |
 |
