JPET Assistant Professor of Medicine (Clinician-Educator)

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Journal of Pharmacology And Experimental Therapeutics Fast Forward
First published on September 3, 2003; DOI: 10.1124/jpet.103.053595


0022-3565/03/3071-74-82$20.00
JPET 307:74-82, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.103.053595v1
307/1/74    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kono, H.
Right arrow Articles by Matsumoto, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kono, H.
Right arrow Articles by Matsumoto, Y.

GASTROINTESTINAL, HEPATIC, PULMONARY, AND RENAL

Edaravone, a Novel Free Radical Scavenger, Prevents Liver Injury and Mortality in Rats Administered Endotoxin

Hiroshi Kono, Masami Asakawa, Hideki Fujii, Akira Maki, Hidetake Amemiya, Masayuki Yamamoto, Masanori Matsuda, and Yoshiro Matsumoto

First Department of Surgery, University of Yamanashi, Yamanashi, Japan (H.K., M.A., A.M., H.A., M.M., Y.M.); and Department of Surgery, Shinko Byoin Hospital, Hyogo, Japan (M.Y.)

Received April 28, 2003; accepted June 17, 2003.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 
We postulated that a novel free radical scavenger, 3-methyl-1-phenyl-2-pyrazolin-5-one (edaravone; EDA), would attenuate inflammatory cytokine and chemokine expression in the liver after lipopolysaccharide (LPS) challenge through its antioxidant effect. Rats were administered EDA (0.3, 1.5, 3.0, 6.0, and 12.0 mg/kg) or the same volume of saline intravenously just after LPS (10 mg/kg) injection and then was continued intermittently every 2 h (five administrations in total). Survival was assessed for the next 24 h. In separate experiments, rats were sacrificed at 60 min, 90 min, 6 h, and 9 h after LPS injection. Serum and liver sections were collected for further analysis. Survival was improved by EDA in a dose-dependent manner up to 3 mg/kg, and maximum effects were observed at a dose of 3 mg/kg. After LPS injection, alanine aminotransferase levels increased significantly to about 1,250 IU/l in the vehicle-treated group, whereas values were blunted by about 80% by EDA. Furthermore, increases in 4-hydroxynonenal-modified proteins were also blunted in the liver by EDA. Moreover, mRNA expressions of macrophage infiltrating protein-2, monocyte chemoattractant protein (MCP)-1 and MCP-5 were attenuated by EDA. As a result, increases in the number of infiltrating inflammatory cells and mRNA expression of inflammatory cytokines such as tumor necrosis factor-{alpha} and interleukin-6 were significantly blunted in the liver by EDA. This reduction was accompanied by a significant reduction of their serum levels. In conclusion, EDA prevented liver injury by both inhibition of recruitments of inflammatory cells and expression of inflammatory cytokine levels in the liver.


Free radicals are involved in pathophysiology directly and indirectly in sepsis or endotoxemia (Abe et al., 1988Go). As it is well known, not only free radical itself but also lipid peroxidative metabolites such as 4-hydroxynonenal (HNE)-modified protein cause cytotoxicity on endothelial cells and hepatocytes. Additionally, free radical induces proinflammatory cytokine and chemokine productions by tissue macrophages immediately, which subsequently attracts inflammatory cells into the liver. Polymorphonuclear and mononuclear cells attached to the hepatic sinusoid also produce a large amount of free radicals and cause liver injury (Mayer and Spitzer, 1993Go; Spitzer and Mayer, 1993Go). In our previous work, elimination of hepatic macrophage, the Kupffer cell, which is a potent source of free radicals in the liver in endotoxemia, by gadolinium chloride (GdCl3) blunted proinflammatory cytokine production and the number of infiltrating inflammatory cells after lipopolysaccharide (LPS) challenge, and then, in turn, reduced liver injury as well as mortality (Iimuro et al., 1996Go; Kono et al., 1998Go). Together, free radicals play a critical role in endotoxemia and hence therapies against oxidants could be useful in inflammation or sepsis.

Antioxidants such as diphenyleneiodonium sulfate, allopurinol, and superoxide dismutase scavenged free radicals, as reported in previous work (Feher et al., 1998Go). Allopurinol and diphenyleneiodonium sulfate prevented alcohol-induced liver injury by inhibition of free radical formation in the liver in a rat enteral model (Fehniger et al., 1999Go; Kono et al., 2000aGo). Furthermore, allopurinol prevented liver injury due to ischemia-reperfusion by inhibition of free radical formation (Wong and Wispe, 1997Go). Superoxide dismutase also prevented LPS-induced liver injury in hepatectomized rats (Kono et al., 2001aGo). These chemicals, however, may not be appropriate for clinical use due to their toxicity and instability. 3-methyl-1-phenyl-2-pyrazolin-5-one (edaravone; EDA) is a potent and novel scavenger of free radicals inhibiting not only hydroxyl radicals but also iron-induced peroxidative injuries (Watanabe et al., 1997Go). It has been reported that edaravone changes into 2-oxo-3-(phenylhydrazono)-butanoic acid after the reaction with peroxy radicals in vitro (Yamamoto et al., 1996Go). Edaravone has protective effects on both hemispheric embolization and transient cerebral ischemia in rats (Watanabe et al., 1994Go; Kawai et al., 1997Go). Furthermore, it has been reported that edaravone have protective effects against brain damage after ischemia-reperfusion by scavenging hydroxyl radical clinically. These effects were predominantly thought of as a result of protection of endothelial cells and neurons against lipid peroxidation. Therefore, the specific purpose of this study was to investigate the possible anti-inflammatory effect of edaravone, attenuation of lipid peroxidation or inhibition of proinflammatory and chemokine gene activation, leading to inhibition of inflammatory cell recruitments in the liver.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 
Experiment I: Assessment of Mortality
Male Sprague-Dawley rats (250–300 g body weight; Japan SLC Inc., Shizuoka, Japan) were used in these experiments. Animals were administered either saline vehicle (1 ml/kg) or LPS (10 mg/kg, Escherichia coli serotype 0111:B4; Sigma-Aldrich, St. Louis, MO) via the tail vein (bolus injection), and survival was assessed for the next 24 h (n = 6 in each group). Administration of either EDA, a kind gift from Mitsubishi Pharma Corporation (Tokyo, Japan) (Barsig et al., 1995Go) or the same volume of saline (1 ml/kg) as vehicle was started just after LPS injection and then was continued intermittently every 2 h (five administrations in total) (Fig. 1). To decide the optimal dose of edaravone for the proposed experiment, rats were given edaravone with a dose of 0, 0.3, 1.5, 3, 6, and 12 g/kg/day or the same volume of saline (n = 6 in each group). Rats were given food and water ad libitum throughout the study.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1. Experimental protocol. Experimental protocols are shown. Saline, VEH.

 

Experiment II: Analysis of Mechanisms.
For further analysis of mechanisms, a dose of 3 mg/kg edaravone was used, because maximum effects of improvement of survival rates were observed at this dose.

Serum Alanine Aminotransferase (ALT) Levels after LPS Administration. In a separate set of experiments to determine the extent of liver damage by LPS and evaluate effects of edaravone on liver injury, ALT assay was performed. Blood samples were collected from the aorta 9 h after LPS administration in all groups and centrifuged at 1,200g for 10 min at 4°C, respectively (n = 8 in each group). Serum was stored at –80°C until assays. ALT was measured enzymatically (Nissui Transnase; Nissui Pharmaceutical Co., Tokyo, Japan) (Arai, 1986Go).

Pathological Change and the Number of Neutrophils in the Liver. Liver specimens taken 9 h LPS administration were formalin-fixed, embedded in paraffin, and stained with hematoxylin-eosin to assess inflammation and necrosis (n = 6 in each group). Histological samples were evaluated by one of the authors and by an outside expert in rodent liver pathology.

The number of neutrophils (n = 6 in each group) in the liver was expressed per 400 hepatocytes in three high-power fields (400x) per slide (Alexander et al., 1998Go). The mean value from three high-power fields was used for statistical analysis.

Assay of Serum TNF-{alpha} and IL-6 Levels. For measurements of cytokines, blood samples were collected from the aorta 60 min, 90 min, 6 h, or 9 h after LPS or saline injections (n = 6 in each group). Samples were centrifuged at 1,200g for 10 min at 4°C and serum was stored at –80°C until assays. TNF-{alpha} and IL-6 levels were determined using an ELISA kit (Cosmo Bio Co., Tokyo, Japan).

Immunohistochemical Detection of HNE-Modified Proteins in the Liver. Paraffin-embedded sections of liver tissue were deparaffinized, rehydrated, and stained immunohistochemically for the presence of an in vivo marker of lipid peroxidation, 4-hydroxynonenal protein adducts, by sequential incubation with a polyclonal antibody (Alpha Diagnostic International, San Antonio, TX) in phosphate-buffered saline (pH 7.4) containing 1% Tween 20 and 1% bovine serum albumin (Eldridge et al., 1990Go). Peroxidase-linked secondary antibody and diaminobenzidine (peroxidase envision kit; DAKO, Carpinteria, CA) were used to detect specific binding. The slides were rinsed twice with phosphate-buffered saline-0.1% Tween 20 between all incubations, and sections were counterstained with hematoxylin as described previously (Kono et al., 2001cGo). To control for nonspecific binding of the secondary antibody, sections from the same animals were processed without the primary antibody, followed by the procedure detailed above. No positive staining was observed in this control experiment (data not shown).

Real-Time Reverse Transcription-Polymerase Chain Reaction (RT-PCR) for mRNA Expressions of TNF-{alpha}, IL-6, Interferon (IFN)-{gamma}, and IL-10 in Liver Tissues. mRNAs were quantified by a real-time RT-PCR procedure (TaqMan; Applied Biosystems, Foster City, CA). Quantitative real-time PCR was performed with the GeneAmp 5700 sequence detection system (Applied Biosystems). For the sequence of specific primers for TNF-{alpha} (accession no. NM 012676), IL-6 (accession no. M26744 [GenBank] ), IFN-{gamma} (accession no. AF010466 [GenBank] ), and IL-10 (accession no. NM 012854), predeveloped TaqMan assay reagents (Applied Biosystems) were used. Ribosomal RNA (18s rRNA) was used as an internal control.

Liver tissue samples were collected from animals sacrificed at 60 min for TNF-{alpha} or 6 h for IL-6, IFN-{gamma}, and IL-10 after LPS or saline injections. Total RNA was isolated from about 25-mg samples of liver tissue by the use of an RNA purification kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer's instructions. Reverse transcription of total RNA (2 µg) was performed in a final volume of 100 µl containing 1x TaqMan reverse transcription buffer, 5.5 mM MgCl2, 500 µM/l each dNTP, 2.5 µM random hexamers, 0.4 U/µl RNase inhibitor, and 1.25 U/µl multiscribe reverse transcriptase. Two microliters of cDNA samples was used for quantitative RT-PCR (a 10-min step at 95°C, followed by 40 cycles of 15 s at 95°C, and 1 min at 60°C in the presence of specific forward and reverse primers and TaqMan Universal PCR Master Mix; Applied Biosystems). Messenger RNA levels were calculated using the comparative Ct method (Pritts et al., 2002Go) and normalized to ribosomal RNA. To confirm amplification specificity, polymerase chain reaction (PCR) products were subjected to a melting curve analysis.

RT-PCR for mRNA Expressions of Macrophage Inflammatory Protein (MIP)-2, Monocyte Chemoattractant Protein (MCP)-1, and MCP-5 in the Liver. Liver tissue samples were collected from animals sacrificed at 9 h after LPS or saline injections. Total RNA was isolated from about 25-mg samples of liver tissue by the use of a RNA purification kit (QIAGEN GmbH) according to the manufacturer's instructions and used for PCR assay to detect mRNA expressions of MIP-2, MCP-1, and MCP-5.

Reverse transcription of total RNA was performed by the method described above. PCR primers for MIP-2, MCP-1, MCP-5, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) contained the following sequences: MIP-2 sense (5'-CAGAGCTTGAGTGTGACG-3') and antisense (5'-TCGTACCTGATGTGCCTC-3'); MCP-1 sense (TCCACCACTATGCAGGTCTC) and antisense (TGGACCCATTCCTTATTGGG); MCP-5 sense (CCACATTCGGAGGCTAAAG) and antisense (GGGGAAGGTCAGAGGAAATAA); and GAPDH sense (5'-TGAAGGTCGGAGTCAACGGATTTGGT-3') and antisense (5'-CATGTGGGCCATGAGGTCCACCAC-3').

The size of amplified PCR products was subjected to electrophoresis at 100 V through 2% agarose gel (Invitrogen, Carlsbad, CA) for about 30 min. Agarose gels were stained with 0.5 mg/ml ethidium bromide Tris/borate/EDTA buffer (ICN, Costa Mesa, CA) and photographed with type 55 Polaroid positive/negative film. Densitometric analysis of the captured image was performed on a Macintosh computer using NIH Image 1.54 analysis software. The area under the curve was normalized for GAPDH content.

Immunohistochemistry for ED1 and ED2 Antibodies. Tissue samples from the liver were collected from rats sacrificed 9 h after injection of LPS or vehicle, fixed in formalin, embedded in paraffin, and serially sectioned (5 µm in thickness). Some sections were used for the immunohistochemistry using ED1 and ED2 monoclonal antibodies and labeled streptavidin biotin kit (DAKO). The antibodies used were ED1-specific for macrophages/monocytes (Hardonk et al., 1992Go; Johnson and Kudsk, 1999Go) but not granulocytes and ED2 specific for Kupffer cells (Serotec, Oxford, UK). Immunohistochemistry was performed as follows. Liver sections were fixed in acetone for 5 min and covered with 0.5% hydrogen peroxide in methanol to block endogenous peroxidase. The sections were first incubated with normal goat serum and then with primary diluted antibodies (1:200 for ED1 and 1:100 for ED2), a secondary antibody composed of biotinized goat anti-rabbit and mouse immunoglobulins; and finally with peroxidase-incorporated streptavidin. The sections were developed with 3,3'-diaminobenzidine and counterstained with hematoxylin.

Statistics
Data are expressed as mean values ± S.E.M. ANOVA with Bonferroni's post hoc test or the Student's t test was used for the determination of statistical significance as appropriate. A P value less than 0.05 was selected before the study as the level of significance.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 
Experiment I: Assessment of Mortality after LPS Administration
Vehicle-treated rats seemed moribund 9 h after LPS injection, and all animals died within 24 h, suggesting that this dose was lethal (Table 1). In contrast, this mortality was prevented by EDA administration in a dose-dependent manner up to 3 mg/kg, and maximum effects were observed at a 3 mg/kg edaravone.


View this table:
[in this window]
[in a new window]
 
TABLE 1 Effect of LPS and edaravone on mortality

Mortality after LPS administration was determined as described under Materials and Methods (n = 6).

 

Experiment II: Analysis of the Mechanisms for Improvement of Survival
Serum ALT Levels after LPS Administration. Serum ALT levels were about 40 IU/l before LPS administration, and edaravone alone had no effect on its value (Fig. 2). ALT levels increased to about 1,250 IU/l 9 h after LPS administration in the vehicle-treated group. Edaravone also blunted this increase significantly.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2. Effect of LPS and edaravone on serum ALT levels. Blood samples were collected 9 h after LPS administration and ALT was measured as detailed under Materials and Methods. Vehicle, VEH. Values are mean ± S.E.M. (n = 8). *, P < 0.05 compared with vehicle-treated rats with vehicle; #, P < 0.05 compared with vehicle-treated rats administered LPS by ANOVA with Bonferroni's post hoc test.

 

Effect of Edaravone on LPS-Induced Liver Injury. No pathological changes were observed in liver tissues from both the vehicle-treated and the EDA group before LPS administration (Fig. 3, A and B). In contrast, inflammation, focal necrosis (Fig. 3E), and hemorrhagic change (Fig. 3F) were observed in the liver 9 h after LPS administration in the vehicle-treated group (Fig. 3C). Edaravone prevented these pathological changes markedly (Fig. 3D).



View larger version (94K):
[in this window]
[in a new window]
 
Fig. 3. Effect of LPS and edaravone on the liver. Liver sections from rats given saline (A, VEH; B, EDA) and LPS (C, E, and F, VEH; D, EDA) are shown. Saline, VEH. Original magnification (A–D), 200x and (E and F), 400x. Representative photomicrographs from six animals per group.

 

Effect of LPS and Edaravone on Serum TNF-{alpha} and IL-6 Levels. These values were below the limit for detection in rats without LPS injection (data not shown). As expected, LPS administration caused a rapid peak increase in serum TNF-{alpha} levels to about 120 ng/ml after 90 min, and values were decreased gradually to the basal level by 9 h in the vehicle-treated rats (Fig. 4). Edaravone blunted these levels at 60 min, 90 min, and 6 h after LPS injection significantly. Alternatively, IL-6 levels were increased gradually until 6 h and reached maximum values of about 100 ng/ml in the vehicle-treated group. Although values were also increased in rats treated with edaravone, they were only about 15 ng/ml. There were significant differences in IL-6 levels between the two groups.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4. Serum TNF-{alpha} and IL-6 levels after LPS administration Blood samples were collected from the aorta at each time point, and serum TNF-{alpha} and IL-6 levels were determined as described under Materials and Methods. Data represent mean ± S.E.M. (n = 6). *, P < 0.05 compared with the vehicle-treated rats by ANOVA; #, P < 0.05 compared with rats administered EDA by ANOVA with Bonferroni's post hoc test.

 

Messenger RNA Expression of MIP-2, MCP-1, and MCP-5 and the Number of Infiltrating Neutrophils in the Liver. Messenger RNA expression of MIP-2 was minimal before LPS injection in both the two groups. On the other hand, it was significantly increased in the vehicle-treated group after LPS administration as expected. This increase was significantly blunted by edaravone treatment (Fig. 5).



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 5. Effect of chronic LPS and edaravone on mRNA expression of MIP-2, MCP-1, and MCP-5 in the liver. Liver tissue samples were collected from animals sacrificed at 9 h after LPS or saline injections. Messenger RNA expressions of MIP-2, MCP-1, and MCP-5 in the liver were determined as described under Materials and Methods. Amplification of each mRNA transcript are shown in D. A to C, mRNA signals expressed as a ratio to GAPDH mRNA as measured by densitometric analysis. Vehicle, VEH. Samples shown are representative of four to six samples per group. Data represent mean ± S.E.M. (n = 4). *, P < 0.01 compared with vehicle-treated rats; #, P < 0.05 compared with vehicle-treated rats administered LPS by the Student's t test.

 

Alternatively, mRNA expression of MCP-1 and MCP-5 were also assessed. Messenger RNA expressions of MCP-1 were not affected by EDA. On the other hand, mRNA expressions of MCP-5 were significantly blunted by edaravone.

The number of infiltrating neutrophils in the liver from the vehicle-treated or the EDA group is shown in Fig. 6. The number was minimal before LPS injection. In contrast, infiltrating neutrophils were increased significantly after LPS administration in the vehicle-treated rats. This increase was blunted significantly by edaravone, consistent with the results of MIP-2 mRNA expression.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 6. Effect of chronic LPS and edaravone on the number of neutrophils infiltrating into the liver. Liver tissue samples were collected from animals sacrificed at 9 h after LPS or saline injections. The number of neutrophils observed in hematoxylin and eosin sections of liver is shown. Values were determined by counting neutrophils in three high-power fields (400x) per slide. The number of hepatocytes was also counted in each field, and the number of cells was expressed per 400 hepatocytes. Data represent mean ± S.E.M. (n = 6). Vehicle, VEH. *, P < 0.05 compared with vehicle-treated rats; #, P < 0.05 compared with vehicle-treated rats administered LPS diet by the Student's t test.

 

Immunohistochemical Detection of HNE-Modified Protein. To test whether edaravone reduced lipid peroxidation caused by LPS challenge, 4-HNE-modified proteins were detected by immunohistochemistry (Fig. 7) (Marotto et al., 1988Go). Increases in 4-hydroxynonenal protein adducts were not detected before LPS administration. After LPS injection, a significant accumulation of 4-hydroxynonenal (brown staining) was observed in the liver. These accumulations were significantly reduced in livers from rats treated with edaravone.



View larger version (125K):
[in this window]
[in a new window]
 
Fig. 7. Immunohistochemical detection of 4-hydroxynonenal-modified protein. Sections of liver tissues from rats before LPS administration (A and B) and 9 h after LPS administration without edaravone treatment (C) or with edaravone treatment (D) were stained immunohistochemically for 4-hydroxynonenal-modifed proteins (brown staining) as detailed under Materials and Methods. Saline, VEH. Original magnification, 200x. Representative photomicrographs from 4 animals/group.

 

Messenger RNA Expression of TNF-{alpha}, IL-6, IFN-{gamma}, and IL-10 in the Liver. Messenger RNA expressions of TNF-{alpha}, IL-6 INF-{gamma}, and IL-10 were assessed in the liver from the vehicle- or edaravone-treated rats (Fig. 8). Expressions were not detectable in the liver before LPS administration. In contrast, LPS administration significantly increased these expressions about 3-fold in livers from the vehicle-treated rats. Expressions of inflammatory cytokines TNF-{alpha}, IL-6, and IFN-{gamma} were blunted by about 70% by EDA. On the other hand, anti-inflammatory cytokine IL-10 were not affected by edaravone.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 8. Messenger RNA expressions of TNF-{alpha}, IL-6, IFN-{gamma}, and IL-10 in the liver. Liver tissue samples were collected from animals sacrificed at 60 min for TNF-{alpha} or 6 h for IL-6, IFN-{gamma}, and IL-10 after LPS or saline injections. Messenger RNA expressions of TNF-{alpha}, IL-6, IFN-{gamma}, and IL-10 in the liver were determined as described under Materials and Methods. A, TNF-{alpha} mRNA; B, IL-6 mRNA; C, IFN-{gamma} mRNA; and D, IL-10 mRNA. Saline, VEH. Data represent mean ± S.E.M. (n = 6). *, P < 0.01 compared with vehicle-treated rats; #, P < 0.05 compared with vehicle-treated rats administered LPS by Student's t test.

 

Immunohistochemistry for ED1 and ED2 in the Liver. In further experiments, we assessed the effect edaravone and LPS on hepatic macrophage population by immunohistochemistry with ED1 and ED2 monoclonal antibodies (Fig. 9, A and B). Furthermore, ED2-positive cells, which may be resident hepatic macrophages, were located mainly around the periportal area (Fig. 9B). Administration of LPS did not increase the number of ED2-positive cells in vehicle-treated group. In contrast, the number of ED1-positive cells was increased significantly in vehicle-treated rats but not rats treated with EDA after LPS administration, suggesting that infiltrating monocytes/macrophages were increased (Fig. 9A).



View larger version (113K):
[in this window]
[in a new window]
 
Fig. 9. Immunohistochemistry for ED1 and ED2 in the liver. Liver tissue samples were collected from animals sacrificed at 9 h after LPS or saline injections. Sections were stained immunohistochemically with ED1 (A) or ED2 (B) monoclonal mouse anti-rat antibodies as detailed under Materials and Methods. Saline, VEH. Original magnification, 200x. Representative photomicrographs from four animals per group.

 


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 
Effects of Edaravone in Endotoxemia. Therapies against oxidants could be useful to prevent organ injury. However, an appropriate method for clinical use is still lacking. Edaravone, a newly synthesized free radical scavenger, exerts beneficial free radical scavenging and antioxidant characteristics (Kono et al., 2001bGo) and prevents the peroxidative vascular endothelial damage caused by hydroperoxyeicosatetraenoic acid in vitro (Otomo et al., 1998Go). It was reported that edaravone reacted with DPPH, hydroxyl radicals generated by Fenton reaction, and peroxyl radical generated by Fe3+-stimulated decomposition of methyl linoleate hydroperoxide in vitro (Spitzer and Mayer, 1993Go). In that study, 2-oxo-3-(phenylhydrazono)-butanoic acid was observed as the reaction product of edaravone in methanol/phosphate buffer under atmospheric condition.

Edaravone was metabolized in the liver and excreted rapidly in the urine within 24 h after the beginning of infusion. Irrespective of the dose and infusion time, the urinary excretion rates of edaravone and its conjugates were almost the same. Initially, edaravone was tested in various different models to evaluate its protective effects in cerebral ischemia/reperfusion (Goode and Webster, 1993Go). In cerebral infarction, free radicals (e.g., hydroxyl radicals) are thought to play an important role in the secondary injury cerebral ischemia mainly by activating the lipoxygenase pathway in the arachidonic acid cascade (Seki et al., 1998Go). Thus, inhibition of free radical production may result in the attenuation of secondary injury theoretically. Therefore, edaravone was used to scavenge free radicals to protect from brain injuries in several animal studies. Based on these results, it has been clinically used for therapies against acute cerebral infarction without any significant safety problems (Barsig et al., 1995Go). Therefore, this study was undertaken to determine whether edaravone prevents liver injury and mortality in rats administered endotoxin. Because edaravone blunted increases in lipid peroxidation (Fig. 7) and prevented liver injury (Fig. 3), one effect of edaravone in endotoxemia was inhibition of lipid peroxidation caused by oxidants.

Role of Chemoattractant Factors and Infiltrating Leukocytes in Endotoxemia. Free radicals also increase proinflammatory cytokines such as TNF-{alpha}, which is involved in triggering a vicious cycle in infectious insults via the redox-sensitive transcriptional factor nuclear factor-{kappa}B (Kono et al., 2000bGo). These proinflammatory cytokines regulate the chemoattractant factors, which subsequently increase leukocyte numbers into the host tissue. Indeed, endotoxin influxes in the circulation stimulate the hepatic resident macrophages, Kupffer cells, to produce MIP-2, and up-regulate the expression of adhesion molecules, i.e., CD18 on neutrophils and its counter-receptor intercellular adhesion molecule-1 on sinusoidal endothelial cells (Bautista, 1997Go). Furthermore, expressions of the CC chemokines such as MCP-1 and MCP-5 are increased after LPS administration, and they are all chemotactic for monocytes/macrophages and T cells (Valente et al., 1988Go). Polymorphonuclear cells and mononuclear cells attached to the hepatic sinusoid also produce a large amount of mediators (Spitzer and Mayer, 1993Go; Mayer and Spitzer, 1993Go). Various mediators produced by these recruited cells induce injury of the sinusoidal endothelial cells (Vollmar et al., 1996Go; Bukara and Bautista, 2000Go). As a result, enhanced sequestration and cell-cell interaction among these cell types may occur in the liver, which in turn could result in altered hepatic function and hepatotoxicity. Indeed, elimination of the hepatic macrophages by gadolinium chloride almost completely prevented free radical production, the number of infiltrating cells, and liver injury (Kohno et al., 1993Go; Kono et al., 2001aGo; Iimuro et al., 1996Go). Thus, tissue attached inflammatory cell play an important role in sepsis or endotoxemia. Therefore, expression of chemotactic factors in the liver was assessed in this study. LPS administration increased in mRNA expression of MIP-2, MCP-1, and MCP-5. These expressions were significantly blunted by edaravone (Figs. 5 and 8). As a result, the number of neutrophils and monocytes/macrophage in the liver was significantly blunted by edaravone (Figs. 6 and 9). It was reported that recruiting neutrophils and lymphocytes produce a large amount of proinflammatory cytokines such as IFN-{gamma} and IL-6, which is involved in the hepatotoxicity (Murota et al., 1990Go). In this study, edaravone also blunted increases in mRNA expression of IFN-{gamma} and IL-6 in the liver (Fig. 8). It is likely that MIP-2, MCP-1, and MCP-5 induced by TNF-{alpha} recruit inflammatory cells in the liver and that production of toxic mediators is involved in hepatic inflammation and necrosis in endotoxemia (Hewett et al., 1992Go). Indeed, TNF-{alpha} mRNA expression was significantly blunted in the liver by edaravone (data not shown), although differences in its serum levels were very small (Fig. 4). In this study, changes in TNF-{alpha} in the serum were relatively small but significantly deceased compared with those of serum IL-6 levels. TNF-{alpha} is released early after an inflammatory stimulus followed by release of IL-1 and later by IL-6 (Damas et al., 1992Go). In the present study, the reduction of TNF-{alpha} levels in the serum with edaravone treatment was small but exactly reduced the elevation of IL-6 in serum 6 h later. IL-6 is an integral part of the inflammatory response to sepsis and endotoxemia.

Alternatively, IL-10 is among the most potent anti-inflammatory agents induced in response to LPS (Moore et al., 1993Go). Indeed, anti-IL-10 antibody pretreatment increases mortality in lethal endotoxemic mice model (Standiford et al., 1995Go). In contrast, recombinant IL-10 influx significantly prevents LPS-induced lethality in rodent model. In this study, LPS challenge increased mRNA expression of IL-10, consistent with previous work (Fig. 8). Several studies have demonstrated the ability of IL-10 to down-regulate LPS-inducible mRNA expression of inflammatory cytokines (IFN-{gamma}, IL-1, IL-6, IL-12, and TNF-{alpha}) and chemokines (interferon-{gamma}-inducible protein-10, keratinocyte-derived chemokine, MIP-1{alpha}, and MIP-1{beta}) (Lentsch et al., 1997Go; Yoshidome et al., 1999Go). In this study, the up-regulated expression of IL-10 was not affected by edaravone, ruling out the contribution of this pathway to the protective effect of edaravone (Fig. 8).


    Conclusion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 
The data presented here are the first report that a novel free radical scavenger, edaravone, prevents liver injury and improves mortality in endotoxemia. Furthermore, edaravone prevents lung injury and mortality after cecal ligation and puncture (CH. Kono, unpublished data). Because edaravone is used in clinical practice without serious side effects, this may provide a new, effective, and powerful strategy for anti-inflammatory therapy. However, further investigation to elucidate the details of the functional mechanisms and an appropriate infusion method are needed in various infection models before clinical application.


    Footnotes
 
DOI: 10.1124/jpet.103.053595.

ABBREVIATIONS: HNE, hydroxynonenal; LPS, lipopolysaccharide; EDA, edaravone; ALT, alanine aminotransferase; TNF, tumor necrosis factor; IL, interleukin; RT-PCR, reverse transcription-polymerase chain reaction; IFN, interferon; MIP, macrophage infiltrating protein; MCP, monocyte chemoattractant protein; PCR, polymerase chain reaction; GADPH, glyceraldehyde-3-phosphate dehydrogenase; ANOVA, analysis of variance.

Address correspondence to: Dr. Hiroshi Kono, First Department of Surgery, University of Yamanashi, 1110 Shimokato, Tamaho, Nakakoma, Yamanashi 409-3898, Japan. E-mail: hkouno{at}res.yamanashi-med.ac.jp


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 

Abe K, Yuki S, and Kogure K (1988) Strong attenuation of ischemic and postischemic brain edema in rats by a novel free radical scavenger. Stroke 19: 480–485.[Abstract/Free Full Text]

Alexander JW, Ogle CK, and Nelson JL (1998) Diets and infection: composition and consequences. World J Surg 22: 209–212.[CrossRef][Medline]

Arai M (1986) Effect of ethanol on the intestinal uptake of endotoxin. Nippon Shokakibyo Gakkai Zasshi 83: 1060.[Medline]

Barsig J, Kusters S, Vogt K, Volk HD, Tiegs G, and Wendel A (1995) Lipopolysaccharide-induced interleukin-10 in mice: role of endogenous tumor necrosis factor-alpha. Eur J Immunol 25: 2888–2893.[Medline]

Bautista AP (1997) Chronic alcohol intoxication induces hepatic injury through enhanced macrophage inflammatory protein-2 production and intercellular adhesion molecule-1 expression in the liver. Hepatology 25: 335–342.[CrossRef][Medline]

Bukara M and Bautista AP (2000) Acute alcohol intoxication and gadolinium chloride attenuate endotoxin-induced release of CC chemokines in the rat. Alcohol 20: 193–203.[CrossRef][Medline]

Damas P, Ledoux D, Nys M, Vrindts Y, De Groote D, Franchimont P, and Lamy M (1992) Cytokine serum level during severe sepsis in human IL-6 as a marker of severity. Ann Surg 215: 356–362.[Medline]

Eldridge SR, Tilbury LF, Goldsworthy TL, and Butterworth BE (1990) Measurement of chemically induced cell proliferation in rodent liver and kidney: a comparison of 5-bromo-2'-deoxyuridine and [3H]thymidine administered by injection or osmotic pump. Carcinogenesis 11: 2245–2251.[Abstract/Free Full Text]

Feher J, Lengyel G, and Blazovics A (1998) Oxidative stress in the liver and biliary tract diseases. Scand J Gastroenterol Suppl 228: 38–46.[Medline]

Fehniger TA, Shah MH, Turner MJ, VanDeusen JB, Whitman SP, Cooper MA, Suzuki K, Wechser M, Goodsaid F, and Caligiuri MA (1999) Differential cytokine and chemokine gene expression by human NK cells following activation with IL-18 or IL-15 in combination with IL-12: implications for the innate immune response. J Immunol 162: 4511–4520.[Abstract/Free Full Text]

Goode HF and Webster NR (1993) Free radicals and antioxidants in sepsis. Crit Care Med 21: 1770–1776.[Medline]

Hardonk MJ, Dijkhuis FWJ, and Hulstaert CE (1992) Heterogeneity of rat liver and spleen macrophages in gadolinium chloride-induced elimination and repopulation. J Leukoc Biol 52: 296–302.[Abstract]

Hewett JA, Schultze AE, VanCise S, and Roth RA (1992) Neutrophil depletion protects against liver injury from bacterial endotoxin. Lab Investig 66: 347–361.[Medline]

Iimuro Y, Yamamoto M, and Kono H (1996) Blockade of liver macrophages by gadolinium chloride reduces lethality in endotoxemic rats; analysis of mechanisms of lethality in endotoxemia. J Leukoc Biol 55: 723–728.

Johnson CD and Kudsk KA (1999) Nutrition and intestinal mucosal immunity. Clin Nutr 18: 337–344.[CrossRef][Medline]

Kawai H, Nakai H, Suga M, Yuki S, Watanabe T, and Saito K (1997) Effects of a novel free radical scavenger, MCI-186, on ischemic brain damage in the rat distal middle cerebral artery occlusion model. J Pharmacol Exp Ther 281: 921–927.[Abstract/Free Full Text]

Kohno H, Yamamoto M, and Iimuro Y (1993) Reduction of mortality in endotoxemic rats pretreatment with gadolinium chloride: relationship to suppression of superoxide production in liver macrophages. Yamanashi Med J 8: 101–112.

Kono H, Fujii H, Matsuda M, Yamamoto M, and Matsumoto Y (2001a) Gadolinium chloride prevents mortality in hepatectomized rats given endotoxin. J Surg Res 96: 204–210.[CrossRef][Medline]

Kono H, Rusyn I, and Thurman RG (2000a) Allopurinol attenuates hepatic necrosis and inflammation caused by chronic intragastric ethanol exposure in rats. J Pharmacol Exp Ther 293: 296–303.[Abstract/Free Full Text]

Kono H, Rusyn I, Uesugi T, Yamashina S, Connor HD, Dikalova A, Mason RP, and Thurman RG (2001b) Diphenyleneiodonium sulfate, an NADPH oxidase inhibitor, prevents early alcohol-induced liver injury in the rat. Am J Physiol 280: G1005–G1012.

Kono H, Rusyn I, Yin M, Gabele E, Yamashina S, Dikalova A, Kadiiska MB, Connor HD, Mason RP, Segal BH, et al. (2000b) NADPH oxidase-derived free radicals are key oxidants in alcohol-induced liver disease. J Clin Investig 106: 867–872.[Medline]

Kono H, Uesugi T, Froh M, Rusyn I, Bradford BU, and Thurman RG (2001c) ICAM-1 is involved in the mechanism of alcohol-induced liver injury: studies with knockout mice. Am J Physiol 280: G1289–G1295.

Kono H, Yamamoto M, Iimuro Y, Fujii H, and Matsumoto Y (1998) The role of splenic macrophages in plasma tumor necrosis factor levels in endotoxemia. Eur Surg Res 29: 176–186.

Lentsch AB, Shanley TP, Sarma V, and Ward PA (1997) In vivo suppression of NF-kappa B and preservation of I kappa B alpha by interleukin-10 and interleukin-13. J Clin Investig 100: 2443–2448.[Medline]

Marotto ME, Thurman RG, and Lemasters JJ (1988) Early midzonal cell death during low-flow hypoxia in the isolated, perfused rat liver: protection by allopurinol. Hepatology 8: 585–590.[Medline]

Mayer AM and Spitzer JA (1993) Modulation of superoxide anion generation by manoalide, arachidonic acid and staurosporine in liver infiltrated neutrophils in a rat model of endotoxemia. J Pharmacol Exp Ther 267: 400–409.[Abstract/Free Full Text]

Moore KW, O'Garra A, de Waal MR, Vieira P, and Mosmann TR (1993) Interleukin-10. Annu Rev Immunol 11: 165–190.[CrossRef][Medline]

Murota S, Morita I, and Suda N (1990) The control of vascular endothelial cell injury. Ann NY Acad Sci 598: 182–187.[Medline]

Otomo E, Tohgi H, Kogure K, Hirai S, Terashi A, Gotoh F, Tazaki Y, Ito E, and Swada T (1998) Clinical efficacy of a free radical scavenger, MCI-186 on acute cerebral infarction - early phase trial. Ther Res 19: 1311–1332.

Pritts T, Hungness E, Wang Q, Robb B, Hershko D, and Hasselgren PO (2002) Mucosal and enterocyte IL-6 production during sepsis and endotoxemia - role of transcription factors and regulation by the stress response. Am J Surg 183: 372–383.[CrossRef][Medline]

Seki S, Osada S, Ono S, Aosasa S, Habu Y, Nishikage T, Mochizuki H, and Hiraide H (1998) Role of liver NK cells and peritoneal macrophages in gamma interferon and interleukin-10 production in experimental bacterial peritonitis in mice. Infect Immun 66: 5286–5294.[Abstract/Free Full Text]

Spitzer JA and Mayer AM (1993) Hepatic neutrophil influx: eicosanoid and superoxide formation in endotoxemia. J Surg Res 55: 60–67.[CrossRef][Medline]

Standiford TJ, Stieter RM, Lukacs NW, and Kunkel S (1995) Neutralization of IL-10 increases lethality in endotoxemia. J Immunol 155: 2222–2229.[Abstract]

Valente AJ, Graves DT, Vialle-Valentin CE, Delgado R, and Schwartz CJ (1988) Purification of a monocyte chemotactic factor secreted by nonhuman primate vascular cells in culture. Biochemistry 27: 4162–4168.[CrossRef][Medline]

Vollmar B, Ruttinger D, Wanner GA, Leiderer R, and Menger MD (1996) Modulation of Kupffer cell activity by gadolinium chloride in endotoxemic rats. Shock 6: 434–441.[Medline]

Watanabe K, Watanabe K, and Hayase T (1997) Radical scavenging mechanism of MCI-186. Jpn Pharmacol Ther 25: S1699–S1707.

Watanabe T, Yuki S, Egawa M, and Nishi H (1994) Protective effects of MCI-186 on cerebral ischemia: possible involvement of free radical scavenging and antioxidant actions. J Pharmacol Exp Ther 268: 1597–1604.[Abstract/Free Full Text]

Wong HR and Wispe JR (1997) The stress response and the lung. Am J Physiol 273: L1–L9.

Yamamoto Y, Kuwahara T, Watanabe K, and Watanabe K (1996) Antioxidant activity of 3-methyl-1-phenyl-2-pyrazolin-5-one. Redox Rep 2: 333–338.

Yoshidome H, Kato A, Edwards MJ, and Lentsch AB (1999) Interleukin-10 inhibits pulmonary NF-kappaB activation and lung injury induced by hepatic ischemia-reperfusion. Am J Physiol 277: L919–L923.


This article has been cited by other articles:


Home page
StrokeHome page
K. Yagi, K. T. Kitazato, M. Uno, Y. Tada, T. Kinouchi, K. Shimada, and S. Nagahiro
Edaravone, a Free Radical Scavenger, Inhibits MMP-9-Related Brain Hemorrhage in Rats Treated With Tissue Plasminogen Activator
Stroke, February 1, 2009; 40(2): 626 - 631.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
T. Arai, M. Nonogawa, K. Makino, N. Endo, H. Mori, T. Miyoshi, K. Yamashita, M. Sasada, M. Kakuyama, and K. Fukuda
The Radical Scavenger Edaravone (3-Methyl-1-phenyl-2-pyrazolin-5-one) Reacts with a Pterin Derivative and Produces a Cytotoxic Substance That Induces Intracellular Reactive Oxygen Species Generation and Cell Death
J. Pharmacol. Exp. Ther., February 1, 2008; 324(2): 529 - 538.
[Abstract] [Full Text] [PDF]


Home page
Arch SurgHome page
T. Koizumi, H. Tanaka, S. Sakaki, and S. Shimazaki
The Therapeutic Efficacy of Edaravone in Extensively Burned Rats
Arch Surg, October 1, 2006; 141(10): 992 - 995.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
X. Qi, Y. Okuma, T. Hosoi, and Y. Nomura
Edaravone Protects against Hypoxia/Ischemia-Induced Endoplasmic Reticulum Dysfunction
J. Pharmacol. Exp. Ther., October 1, 2004; 311(1): 388 - 393.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
jpet.103.053595v1
307/1/74    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kono, H.
Right arrow Articles by Matsumoto, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kono, H.
Right arrow Articles by Matsumoto, Y.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition