![]() |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
NEUROPHARMACOLOGY
Departments of Molecular Pharmacology (K.J.V., E.R.G., G.W., M.H., L.S.) and Computational, Combinatorial, and Medicinal Chemistry (L.T., Q.S.), Purdue Pharma Discovery Research, Cranbury, New Jersey; and Discovery Support (Y.R.), Purdue Pharma, Ardsley, New York
Received January 3, 2003; accepted April 15, 2003.
| Abstract |
|---|
|
|
|---|
1 h and significant penetration into the central nervous system. Thus, BCTC is a high potency, selective VR1 antagonist that, unlike capsazepine, has potent blocking effects on low pH-induced activation of rat VR1. These properties make it a more suitable candidate than capsazepine for testing the role played by VR1 in rat models of human disease.
Capsaicin seems to mediate its effects on nociceptive neurons through activation of a specific vanilloid receptor (Caterina et al., 1997
; Szallasi et al., 1999
). Characterization of the first cloned vanilloid receptor, VR1, revealed that its tissue distribution is consistent with the native capsaicin receptor (Caterina et al., 1997
; Tominaga et al., 1998
). VR1 is a member of the transient receptor potential ion channel family (for review, see Benham et al., 2002
). It functions as a ligand-gated nonselective cation channel activated by capsaicin, noxious heat (≥42°C), low extracellular pH (≤6.3) (Caterina et al., 1997
; Tominaga et al., 1998
; Hayes et al., 2000
), and endogenous chemical mediators of inflammation such as the cannabinoid anandamide and products of the lipoxygenase pathway (Piomelli, 2001
). Disruption of the VR1 receptor gene in mice causes reductions in both thermal nociception and thermal hyperalgesia (Caterina et al., 2000
; Davis et al., 2000
). Together, these data suggest a role for VR1 as a molecular integrator of multiple pain-producing stimuli and suggest that this receptor may represent a useful target for the discovery of novel analgesics.
To date, several classes of compounds have been identified that have biological activity at VR1 (Jerman et al., 2000
; Smart et al., 2001
). Structurally related vanilloid analogs of capsaicin include the agonist olvanil and the synthetic competitive antagonist capsazepine (Walpole et al., 1994
) (Fig. 1). As a class, the vanilloid compounds generally demonstrate poor metabolic and pharmacokinetic properties, undergoing extensive first-pass metabolism when dosed orally to rodents (Wehmeyer et al., 1990
). Compounds outside the vanilloid class also having activity at VR1 include the agonists resiniferatoxin and phorbol 12-phenylacetate 13-acetate 20-homovanillate, as well as the naturally occurring antagonist isovelleral. More recently, iodo-resiniferatoxin has been synthesized and characterized as a potent VR1 antagonist (Seabrook et al., 2002
). Although VR1 agonists have a wide range of potencies for VR1 activation (range of EC50 values, 109105 M) (Jerman et al., 2000
; Smart et al., 2001
), current antagonists exhibit moderate-to-high potencies at rat and human VR1 against capsaicin-mediated activation (range of IC50 values, 109106 M), with capsazepine being the most well characterized to date (Jerman et al., 2000
; McIntyre et al., 2001
; Smart et al., 2001
). Interestingly, capsazepine exhibits species specificity in its ability to block human and rat VR1 activation by low pH (McIntyre et al., 2001
). Although robust activity is seen against low pH-induced activation of human VR1, capsazepine is unable to block this mode of activation for rat VR1 (McIntyre et al., 2001
). Additionally, although iodo-resiniferatoxin blocks both capsaicin and low pH-mediated activation of rat VR1 in vitro, intraplantar administration was unable to block capsaicin-induced paw flinching in rat (Seabrook et al., 2002
), suggesting poor availability to native VR1 even with local administration. Collectively, the combination of modest potency, poor pharmacokinetic properties, and/or the lack of efficacy against low pH activation of rat VR1 have hindered the interpretation of data from in vivo testing of currently available VR1 antagonists in rat pain models.
|
Here, we report the characterization of a highly potent VR1 antagonist N-(4-tertiarybutylphenyl)-4-(3-chloropyridin-2-yl) tetrahydropyrazine-1(2H)-carbox-amide (BCTC) (Fig. 1). We show that BCTC has pharmacological and pharmacokinetic properties that should make it a useful tool for exploring the role of vanilloid receptors in rat models of chronic pain and other disease states.
| Materials and Methods |
|---|
|
|
|---|
Rat VR1 primers were designed to the published sequence (Caterina, accession no. AAC53398
[GenBank]
): forward primer, GTCCAAGGCACTTGCTCCATT; and reverse primer, GTGTCCAAGTAGAGATTTGCCATTC. The polymerase chain reaction (PCR) was performed on one tenth of the RT reaction using Expand Long Template Polymerase and Expand buffer 2 in 50-µl reactions according to the manufacturer's instructions (Roche Diagnostics, Indianapolis, IN). After denaturation for 2 min at 94°C, PCR amplification was performed for 25 cycles of 94°C for 15 s, 58°C for 30 s, and 68°C for 3 min. A final incubation at 72°C for 7 min completed the amplification. A PCR product of
2.8 kilobases was gel isolated from a 1.0% agarose Tris-acetate gel containing 1.6 µg/ml crystal violet and purified with a SNAP UV-free gel purification kit (Invitrogen). The PCR product was cloned into the pIND/V5-His-TOPO vector (Invitrogen) according to the manufacturer's instructions. DNA preparations, restriction enzyme digestions, and preliminary DNA sequencing were performed according to standard protocols (Sambrook et al., 1989
). Full-length sequencing was performed by MWG, Inc. (High Point, NC) and confirmed the identity of rat VR1 (data not shown).
Generation of Inducible Cell Lines. Unless noted otherwise, cell culture reagents were purchased from Invitrogen (Carlsbad, CA). HEK293-EcR cells expressing the ecdysone receptor (Invitrogen) were cultured in growth medium (Dulbecco's modified Eagle's medium containing 10% fetal bovine serum) (Hyclone Laboratories, Logan, UT), 1x penicillin/streptomycin, 1x glutamine, 1 mM sodium pyruvate, and 400 µg/ml Zeocin. The rat VR1-pIND construct was transfected into the HEK293-EcR cell line using FuGENE transfection reagent (Roche Diagnostics, Basel, Switzerland). After 48 h, cells were transferred to selection medium (growth medium containing 300 µg/ml G418). Approximately 3 weeks later, individual Zeocin/G418-resistant colonies were isolated and expanded. To identify functional clones, multiple colonies were plated into 96-well plates and expression induced for 48 h with selection medium supplemented with 5 µM ponasterone A. On the day of testing, cells were loaded with the calcium-sensitive dye Fluo-4 AM (Molecular Probes, Eugene, OR) and capsaicin-mediated calcium influx measured with a fluorometric imaging plate reader (FLIPR, Molecular Devices Corp., Sunnyvale, CA) (see below for assay details). Functional clones were retested, expanded, and cryopreserved.
Capsaicin-Based Calcium Influx Assay. A resistant clonal rat VR1 cell line was maintained in flasks using selection medium to yield cell numbers suitable for experimentation. To induce transient expression of the VR1 gene, media were changed to selection medium supplemented with 5 µM ponasterone A. Inductions were initiated on day 0 at the time of replating into poly-D-lysine-coated 96-well black dishes (BD Biosciences, Franklin Lakes, NJ) for assay. Experiments were conducted after no further cell manipulations on days 2, 3, or 4. Cells were seeded using the following densities: 25,000, 50,000, or 75,000 cells/well for use on days 4, 3, or 2, respectively. On the day of experiment, plates were washed with 0.2 ml of 1x Hanks' balanced salt solution containing 1.6 mM CaCl2 and 20 mM HEPES, pH 7.4 (wash buffer) and loaded using 0.1 ml of wash buffer containing Fluo-4 AM (3 µM final). After 1 h, cells were washed twice with 0.2 ml of wash buffer and resuspended to a final volume of 0.1 ml of wash buffer. Plates were transferred to the FLIPR for assay. For competition curves, 0.05 ml of compounds prepared as 4x stock serial dilutions in wash buffer were transferred by the FLIPR to the cell plates to yield final concentrations in the range of 100 µM to 17 pM. Cellular responses elicited upon compound addition were monitored for 2 min. Capsaicin agonist buffer (0.05 ml of 400 nM capsaicin diluted in wash buffer) was then added to each well and plate responses monitored for an additional 1.5 min. The final dimethyl sulfoxide concentration in the assay was 1.0%. Each data point represents the response from one well analyzed using the Max-Min statistic from the FLIPR software in the time interval immediately preceding and 1 min after capsaicin agonist buffer addition (i.e., peak height was used as a measure of response and is measured in fluorescent counts). Each assay plate contained eight wells of positive controls that received capsaicin agonist buffer in the absence of antagonist, and eight wells of negative controls that received wash buffer only. To allow comparison of independent experiments conducted on multiple plates and run on different days, data were normalized to percentage of control using the following equation: % control = (([Response]inhibitor [Response]background)/([Response]positive [Response]background)) · 100, where [Response]inhibitor is the average signal from duplicate wells receiving capsaicin agonist buffer in the presence of a designated concentration of inhibitor; [Response]background is the average signal from duplicate wells receiving capsaicin agonist buffer in the presence of a saturating concentration of BCTC (to define background; this value did not differ from the average of eight negative control wells run on the same plate, indicating that BCTC completely inhibits the capsaicin response); and [Response]positive is the average signal from eight positive control wells. These data analyses and normalizations were performed using Microsoft Excel 2000 and GraphPad Prism version 3.02 software (GraphPad Software, Inc., San Diego, CA). In Prism, curves were fit using a nonlinear regression of a one-site competition model.
Low Extracellular pH-Based Calcium Influx Assay. Assay plates were prepared and cells loaded/washed as described above. Afterwards, 0.05 ml of 1x Hanks' balanced salt solution containing 3.5 mM CaCl2 and 10 mM citrate, pH 7.4 (assay buffer), was added to each well. Plates were then transferred to the FLIPR for assay. Compounds diluted in assay buffer (0.05 ml of 4x stock serial dilutions for competition curves, all prepared in assay buffer) were added to the cell plates and responses monitored for 2 min. Acid agonist buffer (0.1 ml) (1x Hanks' balanced salt solution containing 3.5 mM CaCl2 and 0.0125 N HCl) was then added to each well (yields pH 5.5 when mixed 1:1 with assay buffer) and plate responses monitored for an additional 1.5 min. The final dimethyl sulfoxide concentration in the assay was 1.0%. Each data point represents the response from one well analyzed using the Max-Min statistic from the FLIPR software in the time interval immediately preceding and 1 min after acid agonist buffer addition (i.e., peak height was used as a measure of response and is measured in fluorescent counts). Each assay plate contained eight wells of positive controls that received acid agonist buffer in the absence of antagonist, and eight wells of negative controls that received acid agonist buffer in the presence of excess BCTC (to define background; neutral pH wash buffer addition is not appropriate to define background in this assay format because Fluo-4 AM's affinity for calcium is sensitive to pH). To allow comparison of independent experiments conducted on multiple plates and run on different days, data were normalized to percentage of control using the following equation: % control = (([Response]inhibitor [Response]background)/([Response]positive [Response]background)) · 100, where [Response]inhibitor is the average signal from duplicate wells receiving acid agonist buffer in the presence of a designated concentration of inhibitor; [Response]background is the average signal from duplicate wells receiving acid agonist buffer in the presence of a saturating concentration of BCTC; and [Response]positive is the average signal from eight positive control wells. These data analyses and normalizations were performed using Microsoft Excel 2000 and GraphPad Prism as described above.
Skin-Nerve Electrophysiology. An isolated rat skin-nerve preparation was used to record from single unmyelinated primary afferent fibers, as described previously (Reeh, 1986
; Steen et al., 1992
). The preparations were excised from 15 male adult Sprague-Dawley rats (Taconic Farms, Germantown, NY). The skin was superfused with carbogen (95% O2, 5% CO2)-saturated synthetic interstitial fluid (SIF). The temperature was thermostatically set at 32°C (± 0.5°C). The electrical signals were amplified (Neurolog; Digitimer Ltd., Hertfordshire, UK) and detected online (DAPSYS; Johns Hopkins University, Baltimore, MD). For each unit, the conduction velocity was measured and the mechanical (von Frey filament of 4.56 or 5.46 bar) and heat (temperature feedback-controlled radiant heat of 38°C on the corium side, corresponding to 46°C at the epidermal surface) sensitivity were tested. Only C-fiber polymodal nociceptor units that had conduction velocities of less than 1 m/s and responded to mechanical and thermal stimulation were included in the study. For heat and acid stimulation and application of drugs, a metal ring was used to isolate the receptive field. The fluid inside the ring was continuously bubbled with gas (carbogen or pure CO2). The acid stimulation was accomplished by applying a pure CO2-saturated SIF solution (pH 6.1) to the receptive field (Steen et al., 1992
). For the repetitive activation, capsaicin (0.5 µM) was applied for 30 s at intervals of 30 min (Seno and Dray, 1993
). Capsaicin as well as capsazepine and BCTC were dissolved in dimethyl sulfoxide and diluted in prewarmed (38°C) and carbogen-saturated SIF solution. The final concentration of dimethyl sulfoxide was 0.1%.
µ-Opioid Receptor Functional Studies. Functional GTP
[35S] binding assays were conducted with recombinant µ-opioid receptors (PerkinElmer Life Sciences, Boston, MA) by sequentially mixing (on ice) the following reagents in the order shown to yield the indicated final concentrations: 0.026 µg/µl membrane protein, 10 µg/ml saponin, 3 µM GDP, and 0.20 nM GTP
[35S] (PerkinElmer Life Sciences) to binding buffer (100 mM NaCl, 10 mM MgCl2, and 20 mM HEPES, pH 7.4). The prepared membrane solution (190 µl/well) was transferred to 96-well polypropylene plates containing 10 µl of 20x concentrated serial dilutions of BCTC or [D-Ala2,N-Me-Phe4,Gly5-ol]enkephalin prepared in dimethyl sulfoxide. Plates were incubated for 30 min at room temperature with shaking. Reactions were terminated by rapid filtration onto 96-well Unifilter GF/B filter plates (PerkinElmer Life Sciences) using a 96-well tissue harvester (Brandel, Inc., Gaithersburg, MD) followed by three filtration washes with 200 µl of ice-cold wash buffer (10 mM NaH2PO4, 10 mM Na2HPO4, pH 7.4). Filter plates were subsequently dried at 50°C for 2 to 3 h. Fifty microliters per well of BetaScint scintillation cocktail (PerkinElmer Wallac, Turku, Finland) were added and plates counted in a Packard TopCount for 1 min/well.
In Vivo Pharmacokinetic Studies and CNS Permeability of BCTC. Jugular-cannulated male Sprague-Dawley rats (200300 g) (Taconic Farms) were fasted overnight before dosing. Four groups of rats (three per group) were dosed with BCTC under fasted conditions at 3, 10, and 40 mg/kg p.o. or 3 mg/kg i.v. using 25% hydroxypropyl-
-cyclodextrin as vehicle. The dosage formulations were sonicated for 2.5 h before administration. Blood was collected predose and at the times indicated in Fig. 6. One milliliter of blood was drawn at each time point and replaced with 1 ml of donor plasma. The collection tubes contained EDTA as an anti-coagulant. Plasma was separated by centrifugation and used for analysis. To study the CNS permeability of BCTC, three rats received a single 10 mg/kg i.p. administration of compound suspended in 20% hydroxypropyl-
-cyclodextrin. Blood and brains were taken 1 h after drug administration and analyzed by separate bioanalytical methods. The ratio of BCTC concentration in blood (nanograms per milliliter) and brain (nanograms per gram of tissue) were then calculated for each individual rat. Brain and plasma samples were analyzed with a liquid chromatography tandem mass spectrometry-based method with a limit of quantitation of 1 ng/ml. All pharmacokinetic parameters were calculated using the NCA algorithm of Pharsight's WinNonlin Professional version 3.0 software (Mountain View, CA).
|
| Results |
|---|
|
|
|---|
20% of the response measured using induced cells stimulated with 3 µM capsaicin (maximal signal range, 15277671 counts)] or pH 5.5 buffer [
25% of the response measured using induced cells (signal range, 14667545 counts)], indicating low expression levels of functional rat VR1 in the absence of ponasterone A. Additionally, untransfected HEK293 cells showed no response with up to 3 µM capsaicin, whereas pH 5.5 caused small and variable calcium signals (signal range, 670-5471 counts). These data indicate the absence of endogenous VR1 in this cell line and suggest potential minor contributions from endogenous acid-sensing ion channels (ASICs) to the pH 5.5 response. In Vitro Pharmacological Characterization of BCTC. The ability of BCTC to inhibit channel activation in response to 100 nM capsaicin was investigated for the rat VR1 (Fig. 2A). BCTC potently and dose dependently inhibited capsaicin-induced calcium influx with an IC50 value (mean ± S.E.M.) of 34.9 ± 19.4 nM (n = 6). In this assay, BCTC was >100-fold more potent than the classic VR1 antagonist capsazepine, which demonstrated an IC50 value (mean ± S.E.M.) of 3893 ± 1118 nM (n = 4).
|
To determine whether BCTC competitively inhibits capsaicin binding to rat VR1, dose-response curves for capsaicin were generated in the absence or presence of BCTC (3, 30, and 300 nM) (data not shown). Preincubation of VR1-expressing HEK cells with increasing concentrations of BCTC caused progressive rightward shifts in the capsaicin dose-response curve, with no effect on capsaicin's maximal efficacy. Analysis of these data by Schild regression (Arunlakshana and Schild, 1959
) estimated a Kb of 0.69 ± 0.36 nM with a slope factor of 1.08 ± 0.14 (r2 = 0.95 ± 0.02). These data indicate that BCTC competitively interacts with capsaicin for binding to the rat VR1.
The ability of BCTC to inhibit acid-induced VR1 activation was also demonstrated (Fig. 2B). Calcium influx in response to a change in extracellular pH from 7.4 to 5.5 was monitored in the absence and presence of increasing concentrations of BCTC and capsazepine. BCTC potently and dose dependently inhibited receptor activation with an IC50 value (mean ± S.E.M.) of 6.0 ± 3.2 nM (n = 3). Interestingly, no activity was observed with capsazepine in this assay at doses up to 100 µM. These data are consistent with recent reports demonstrating a similar pharmacological profile for capsazepine (McIntyre et al., 2001
; Walker et al., 2003
). In addition, BCTC had no effect on calcium influx in response to pH 5.5 in untransfected HEK293 cells (signal range, 3085283 counts), indicating a lack of activity against endogenously expressed ASICs (data not shown).
We also evaluated the ability of BCTC to inhibit calcium influx in response to the calcium ionophore ionomycin using IMR-32 neuroblastoma cells (data not shown). No inhibitory effect was seen on the calcium signals at doses up to 10 µM BCTC, suggesting that its inhibitory effects on calcium influx are specific for VR1.
Pharmacological Characterization of BCTC in Isolated Rat Skin-Nerve Preparation. Recordings were made from a total of 49 polymodal nociceptors with conduction velocities in the C-fiber range (0.30.8 m/s). Capsaicin (0.5 µM) responses were seen in eight of the 24 units tested. A 30-s exposure to 0.5 µM capsaicin caused no significant tachyphylaxis upon repetitive applications (Fig. 3; Table 1). This capsaicin-mediated activation was completely blocked by either 10 µM capsazepine (Fig. 3A; Table 1) or 300 nM BCTC (Fig. 3B; Table 1). In addition, the inhibitory effects of both compounds could be washed out. Thus, like capsazepine, BCTC blocks capsaicin-induced activation of native vanilloid receptors expressed in the peripheral terminals of primary nociceptive neurons.
|
|
Of the other 25 units tested, 13 responded to acidic pH (6.1). Low pH-induced activation was not affected by 10 µM capsazepine (Fig. 4A; Table 1). In contrast, 300 nM BCTC produced a partial but significant blockade of the pH response (Fig. 4B; Table 1). The capsaicin sensitivity for eight of these units (four within the capsazepine study and four within the BCTC study, including the two units presented in Fig. 4) was confirmed by the application of 10 µM capsaicin to the receptive field at the end of each recording. These data verify that vanilloid receptors were expressed in the terminal of these acid-sensitive nociceptors. Thus, unlike capsazepine, BCTC can block acid-induced nociceptor activation. In addition, one unit was tested with BCTC and capsazepine in the same recording. Although the acid activation was markedly suppressed by the first BCTC application, it remained unchanged during the subsequent capsazepine treatment (data not shown). Therefore, it is unlikely that the pharmacological differences between capsazepine and BCTC are due to the lack of vanilloid receptor expression on the nociceptors tested with capsazepine.
|
Pharmacological Specificity of BCTC. In studies performed by NovaScreen, no binding inhibition was observed with BCTC (10 µM) in 62 of the radioligand displacement assays used to assess selectivity against major ion channel, receptor, enzyme, and transporter sites (Table 2). However, activity was observed in one assay: a nonselective rat forebrain opioid receptor-binding assay using [3H]naloxone (
86% inhibition). Follow-up dose-displacement radioligand binding assays conducted at NovaScreen indicated no activity at recombinant
- or
-opioid receptors (up to 100 µM BCTC), but low micromolar activity against the recombinant µ-opioid receptor (Ki = 0.95 µM; data not shown). Importantly, in vitro functional studies demonstrated no µ-agonist activity at doses up to 100 µM BCTC in a GTP
[35S] assay (Fig. 5).
|
|
In Vivo Pharmacokinetic Profile of BCTC. BCTC was administered to rats to examine its pharmacokinetic profile (Fig. 6). Mean BCTC plasma concentrations were determined after a single 3 mg/kg intravenous dose (Fig. 6A). Two experiments were used to calculate a plasma half-life for BCTC of 0.85 ± 0.07 h with a clearance of 5.1 ± 0.71 l/h/kg (values given are mean ± S.D.). In addition, the volume of distribution was 5.95 ± 0.21 l/kg, suggesting significant accessibility to peripheral compartments. BCTC plasma concentrations were also measured after single-dose oral administration of 3, 10, and 40 mg/kg (Fig. 6B). Although low, but measurable, plasma concentrations were seen with 3 mg/kg BCTC, significant levels were measured after 10- and 40-mg/kg dosing. The 40-mg/kg dose provided sufficient, sustained plasma concentrations (maximum 1116 ± 271 ng/ml), allowing accurate calculation of bioavailability as a dose-adjusted ratio of BCTC's area under the curve after i.v. and p.o. administration; the bioavailability was calculated to be 10.3 ± 6.8%. Last, penetration of BCTC into the CNS was determined 1 h after a single 10 mg/kg i.p. dose of BCTC (plasma concentration, 558 ± 111 ng/ml; brain concentration, 740 ± 88 ng/g tissue). The blood-to-brain ratio was calculated at 1.37 ± 0.37 (n = 3), indicating that BCTC readily permeates the CNS.
| Discussion |
|---|
|
|
|---|
We first investigated BCTC's ability to inhibit capsaicinmediated activation of rat VR1. In FLIPR-based assays, BCTC was a potent antagonist of VR1 (IC50 of
35 nM against 100 nM capsaicin), exhibiting
112-fold higher potency than capsazepine (Fig. 2). The absolute IC50 measured for capsazepine was significantly higher (3- to 100-fold) than reported previously (Szallasi et al., 1999
; Jerman et al., 2000
; McIntyre et al., 2001
). The reason for the reduced potency in our assay is unclear but may reflect differences in cellular backgrounds and assay conditions. Similar to capsazepine (Caterina et al., 1997
; Jerman et al., 2000
; Smart et al., 2001
), BCTC interacts competitively at the capsaicin site of VR1 as demonstrated by concentration-dependent, parallel rightward shifts in capsaicin dose-response curves. The calculated Kb values from Schild regression of these curves was
0.7 nM. The corresponding Ki value, calculated from concentration-inhibition curves (Cheng and Prusoff, 1973
), was also
0.7 nM, consistent with the high potency measured by Schild analysis. Thus, BCTC represents one of the most potent VR1 antagonists of capsaicin-mediated channel activation reported to date.
The ability of BCTC to competitively interact at the capsaicin binding site of VR1 is not unexpected based on structural similarities to capsaicin and capsazepine (Fig. 1). The urea, thiourea, and amide moieties of BCTC, capsazepine, and capsaicin, respectively, link a relatively polar aromatic head group with a more hydrophobic tail group. Additionally, the nitrogen atom of BCTC's pyridyl ring may mimic one of the hydroxyl groups of capsazepine and capsaicin, which are predicted to participate in hydrogen bond interactions (Walpole et al., 1993
). Interestingly, both BCTC and capsazepine are conformationally constrained, rendering them more rigid compared with capsaicin (Walpole et al., 1994
). The implications of this property are currently unknown, but may be a common feature of antagonists acting at this site.
We next investigated BCTC's ability to block low pH-mediated VR1 activation. In FLIPR-based assays, BCTC blocked rat VR1 activation by pH 5.5 with high potency, similar to results in the capsaicin assay (Fig. 2). This contrasts sharply with the previously reported in vitro profile of capsazepine, which does not block low pH-mediated activation of rat VR1 (McIntyre et al., 2001
). Similarly, in our assay capsazepine did not block acid-induced activation of rat VR1 at concentrations up to 100 µM. Although our data suggest that BCTC and capsazepine act at the same or overlapping sites on rat VR1 (the capsaicin binding site), the reasons for these pharmacological differences are unclear. Interspecies chimeric receptors and site-directed mutagenesis strategies will be necessary to investigate the amino acids responsible for agonist/antagonist interactions with VR1. Similar approaches have recently been used to map key residues responsible for conferring capsaicin sensitivity from rat VR1 to the vanilloid-insensitive chicken VR1 (Jordt and Julius, 2002
). These studies will ultimately provide insights into channel activation mechanisms and the differences in BCTC and capsazepine interactions.
Although the mechanism of BCTC inhibition of low pH-induced channel activation was not investigated, similar experiments with capsazepine have demonstrated a noncompetitive interaction (McIntyre et al., 2001
). These data are supported by studies demonstrating that the capsaicin and proton binding sites of VR1 are distinct and use different activation mechanisms (Jung et al., 1999
; Baumann and Martenson, 2000
; Jordt et al., 2000
; Welch et al., 2000
). As such, noncompetitive inhibition of low pH-induced VR1 activation would predict IC50 values similar to the Ki/Kb values calculated in the capsaicin studies. Although the IC50 value obtained from the low pH assay was
6 nM, this is 8.5-fold higher than the Ki/Kb values. The reasons for these differences are unclear; however, similar phenomenon have been noted for capsazepine, where IC50 values for inhibition of capsaicin- and low pH-induced activation of human VR1 were 39 and 210 nM, respectively (McIntyre et al., 2001
). It is possible that decreased extracellular pH alters affinity for VR1 by modification of the ligand charge state, or the charge state of the binding pocket. Additionally, the capsaicin-specific conformational changes that occur in VR1, but which are absent in response to proton activation (Welch et al., 2000
), may stabilize a high-affinity state for BCTC and capsazepine. Last, low extracellular pH may not directly open VR1 but may instead increase its affinity for an uncharacterized endogenous agonist which competes with BCTC and capsazepine for a common binding site, thus altering their apparent affinities (Benham et al., 2002
).
The pharmacological profile of BCTC was further characterized using an ex vivo rat skin-nerve preparation. Here, we directly examined the ability of BCTC to modulate nociceptor activation by capsaicin and low pH. Similar to capsazepine, BCTC completely blocked capsaicin-induced nociceptor activation, suggesting that it is also a potent antagonist of native VR1 expressed in peripheral terminals of rat cutaneous nociceptors (Fig. 3). Capsazepine blockade of capsaicin-induced activation of C-fiber polymodal nociceptors has been reported previously in the same preparation (Seno and Dray, 1993
). However, the most striking feature revealed in our studies was that unlike capsazepine, BCTC partially inhibits (
60%) low pH-induced nociceptor activation (Fig. 4). Our findings are in-line with a previous study in which capsazepine failed to modulate low-pH nociceptor activation in isolated rat skin sensitized with an inflammatory cocktail (Habelt et al., 2000
). Moreover, in naïve rat dorsal root ganglion neurons, the similarity between acid- and capsaicin-evoked currents is well established (Bevan and Yeats, 1991
). Capsazepine fails to modulate the sustained inward current induced by acid in these preparations (Bevan et al., 1992
; Vyklicky et al., 1998
), a phenomenon possibly due, at least in part, to its inability to block acid-induced rat VR1 activation.
Together, these data suggest that VR1 partially contributes to acid-induced nociceptor responses in the skin-nerve preparation. This is further supported by the ability of BCTC to block low pH-induced nociceptor activation in isolated preparations that are also capsaicin responsive. Although previous reports indicate that not all acid-activated nociceptors in these preparations are capsaicin responsive (Steen et al., 1992
), in our hands, all acid-responsive nociceptors that were tested for capsaicin sensitivity exhibited a robust response (
62% of all units tested in low-pH assay). These data are further supported by studies with VR1 gene knockout mice from which small-diameter dorsal root ganglion neurons have lost their acid-gated responses (Caterina et al., 2000
; Davis et al., 2000
). Because complete inhibition of nociceptor activation was never observed with BCTC, mechanisms other than VR1 are also involved. The remaining activity may be mediated by other members of the transient receptor potential ion channel and/or the ASICs families (for review, see Waldmann et al., 1999
). Future studies will be necessary to determine the relative contribution of these proteins to the acid sensitivity of DRG neurons. Irrespective of the mechanism, the pharmacological properties of BCTC in the ex vivo skin-nerve preparation correlate well with the in vitro profile, and suggest the potential for antihyperalgesic activity in conditions involving local tissue acidosis.
In addition to the pharmacological profile highlighted above for capsazepine, investigations of the physiological role(s) played by VR1 in vivo have also been hampered by a general lack of antagonists with suitable pharmacokinetic profiles. For instance, isovelleral's metabolically labile structure predicts poor pharmacokinetic properties. Together with its low potency for blockade of capsaicin-induced VR1 activation, isovelleral represents a poor in vivo pharmacological tool. In contrast, the superior pharmacokinetic profile of BCTC demonstrated in rats (Fig. 6), characterized by an
1 h half-life, oral bioavailability resulting in high plasma concentrations, distribution roughly equivalent to the peripheral compartment volume, and equal partitioning into the CNS, all suggest a strong potential for in vivo utility. Moreover, rats attaining plasma concentrations of
1 µg/ml BCTC (
3 µM) revealed no aberrant clinical signs, suggesting a general lack of side effects for the target and compound, even at high doses.
Previous studies have shown that capsazepine is unable to reverse the hyperalgesia associated with inflammatory and neuropathic pain models in the rat, whereas robust activity has been demonstrated using similar models in the guinea pig (Walker et al., 2003
). These results correlate with the finding that capsazepine is able to block acid-induced activation of guinea pig VR1 in vitro (Lou and Lundberg, 1992
; Satoh et al., 1993
; Fox et al., 1995
; Savidge et al., 2002
), a property shared with human VR1 but absent from rat VR1 (McIntyre et al., 2001
). Together, these data raise the possibility that blockade of VR1 responses activated by low pH, or dual blockade of capsaicin site and pH site-mediated responses, may be important for antihyperalgesic efficacy in vivo. Consistent with this hypothesis, in the accompanying article BCTC is shown to have robust antihyperalgesic properties in rat models of inflammatory and neuropathic pain (Pomonis et al., 2003
).
| Acknowledgements |
|---|
| Footnotes |
|---|
ABBREVIATIONS: CNS, central nervous system; VR1, vanilloid receptor 1; BCTC, N-(4-tertiarybutylphenyl)-4-(3-chloropyridin-2-yl)tetrahydropyrazine-1(2H)-carbox-amide; RT, reverse transcription; PCR, polymerase chain reaction; HEK, human embryonic kidney; FLIPR, fluorescent imaging plate reader; SIF, synthetic interstitial fluid; GTP
S, guanosine 5'-O-(3-thio)triphosphate; ASIC, acid-sensing ion channel.
1 Current address: Allergan, Inc., 2525 Dupont Dr., Irvine, CA 92612. ![]()
2 Current address: Pharmacia Corporation, 4901 Searle Pkwy., Skokie, IL 60077. ![]()
3 Current address: Vertex Pharmaceuticals LLC, 11010 Torreyana Rd., San Diego, CA 92121. ![]()
Address correspondence to: Dr. Kenneth J. Valenzano, 6 Cedarbrook Dr., Cranbury, NJ 08512. E-mail: ken.valenzano{at}pharma.com
| References |
|---|
|
|
|---|
Arunlakshana O and Schild HO (1959) Some quantitative uses of drug antagonists. Br J Pharmacol 14: 4858.[Medline]
Baumann TK and Martenson ME (2000) Extracellullar protons both increase the activity and reduce the conductance of capsaicin-gated channels. J Neurosci 20: RC80 (15).
Benham CD, Davis JB, and Randall AD (2002) Vanilloid and TRP channels: a family of lipid-gated cation channels. Neuropharmacology 42: 873888.[CrossRef][Medline]
Bevan S, Rang HP, and Shah K (1992) Capsazepine does not block the proton-induced activation of rat sensory neurons. Br J Pharmacol 107: 235P.
Bevan S and Yeats JC (1991) Protons activate a cation conductance in a subpopulation of rat dorsal root ganglion neurons. J Physiol (Lond) 433: 145161.
Caterina MJ, Leffler A, Malmberg AB, Martin WJ, Trafton J, Petersen-Zeitz KR, Koltzenburg M, Basbaum AI, and Julius D (2000) Impaired nociception and pain sensation in mice lacking the capsaicin receptor. Science (Wash DC) 288: 306313.
Caterina MJ, Schumacher MA, Tominaga M, Rosen TA, Levine JD, and Julius D (1997) The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature (Lond) 389: 816824.[CrossRef][Medline]
Cheng Y and Prusoff WH (1973) Relationship between the inhibition constant (Ki) and the concentration of inhibitor which causes 50 per cent inhibition (IC50) of an enzymatic reaction. Biochem Pharmacol 22: 30993108.[CrossRef][Medline]
Davis JB, Gray J, Gunthorpe MJ, Hatcher JP, Davey PT, Overend P, Harries MH, Latcham J, Claphams C, Atkinson K, et al. (2000) Vanilloid receptor-1 is essential for inflammatory thermal hyperalgesia. Nature (Lond) 405: 183187.[CrossRef][Medline]
Dray A (1995) Inflammatory mediators of pain. Br J Anaesth 75: 125131.
Fox AJ, Urban L, Barnes PJ, and Dray A (1995) Effects of capsazepine against capsaicin- and proton-evoked excitation of single airway C-fibers and vagus nerve from the guinea-pig. Neuroscience 67: 741752.[CrossRef][Medline]
Furst S (1999) Transmitters involved in antinociception in the spinal cord. Brain Res Bull 48: 129141.[CrossRef][Medline]
Habelt C, Kessler F, Distler C, Kress M, and Reeh PW (2000) Interactions of inflammatory mediators and low pH not influenced by capsazepine in rat cutaneous nociceptors. Neuroreport 11: 973976.[Medline]
Hayes P, Meadows H, Gunthorpe M, Harries M, Duckworth D, Cairns W, Harrison D, Clarke C, Ellington K, Prinjha R, et al. (2000) Cloning and functional expression of a human orthologue of rat vanilloid receptor-1. Pain 88: 205215.[CrossRef][Medline]
Jerman JC, Brough SJ, Prinjha R, Harries MH, Davis JB, and Smart D (2000) Characterization using FLIPR of rat vanilloid receptor (rVR1) pharmacology. Br J Pharmacol 130: 916922.[CrossRef][Medline]
Jordt S-E and Julius D (2002) Molecular basis for species-specific sensitivity to "hot" chili peppers. Cell 108: 421430.[CrossRef][Medline]
Jordt S-E, Tominaga M, and Julius D (2000) Acid potentiation of the capsaicin receptor determined by a key extracellular site. Proc Natl Acad Sci USA 97: 81348139.
Jung J, Hwang SW, Kwak J, Lee S-L, Kang C-J, Kim WB, Kim D, and Oh U (1999) Capsaicin binds to the intracellular domain of the capsaicin-activated ion channel. J Neurosci 19: 529538.
Lou YP and Lundberg JM (1992) Inhibition of low pH evoked activation of airway sensory nerves by capsazepine, a novel capsaicin-receptor antagonist. Biochem Biophys Res Commun 189: 537544.[CrossRef][Medline]
McIntyre P, McLatchie LM, Chambers A, Phillips E, Clarke M, Savidge J, Toms C, Peacock M, Shah K, Winter J, et al. (2001) Pharmacological differences between the human and rat vanilloid receptor 1 (VR1). Br J Pharmacol 132: 10841094.[CrossRef][Medline]
Park KM, Max MM, Robinovitz E, Gracely RH, and Bennet GJ (1995) Effects of intravenous ketamine, alfentanil or placebo on pain, pinprick hyperalgesia and allodynia produced by intradermal capsaicin in human subjects. Pain 63: 163172.[CrossRef][Medline]
Piomelli D (2001) The ligand that came from within. Trends Pharmacol Sci 22: 1719.[CrossRef][Medline]
Pomonis JD, Harrison J, Mark L, Waligora DT, Valenzano KJ, and Walker K (2003) N-(4-Tertiarybutylphenyl)-4-(3-chloropyridin-2-yl)tetrahydropyrazine-1(2H)carbox-amide (BCTC), a novel, orally effective vanilloid receptor 1 antagonist with analgesic properties. II. In vivo characterization in rat models of inflammatory and neuropathic pain. J Pharmacol Exp Ther 306: 387393.
Reeh PW (1986) Sensory receptors in mammalian skin in an in vitro preparation. Neurosci Lett 66: 141146.[CrossRef][Medline]
Sambrook J, Fritsch EF, and Maniatis T (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
Satoh H, Lou YP, and Lundberg JM (1993) Inhibitory effects of capsazepine and SR 48968 on citric acid-induced bronchoconstriction in guinea pigs. Eur J Pharmacol 236: 367372.[CrossRef][Medline]
Savidge J, Davis C, Shah K, Colley S, Phillips E, Ranasinghe S, Winter J, Kotsonis P, Rang H, and McIntyre P (2002) Cloning and functional characterization of the guinea-pig vanilloid receptor 1. Neuropharmacology 43: 450456.[CrossRef][Medline]
Seabrook GR, Sutton KG, Jarolimek W, Hollingworth GJ, Teague S, Webb J, Clark N, Boyce S, Kerby J, Ali Z, et al. (2002) Functional properties of the high-affinity TRPV1 (VR1) vanilloid receptor antagonist (4-hydroxy-5-iodo-3-methoxyphenylacetate ester) iodo-resiniferatoxin. J Pharmacol Exp Ther 303: 10521060.
Seno N and Dray A (1993) Capsaicin-induced activation of fine afferent fibers from rat skin in vitro. Neuroscience 55: 563569.[CrossRef][Medline]
Simone DA, Ngeow JYF, Putterman GJ, and Lamotte RH (1987) Hyperalgesia to heat after intradermal injection of capsaicin. Brain Res 418: 201203.[CrossRef][Medline]
Smart D, Jerman JC, Gunthorpe MJ, Brough SJ, Ranson J, Cairns W, Hayes PD, Randall AD, and Davis JB (2001) Characterization using FLIPR of human vanilloid VR1 receptor pharmacology. Eur J Pharmacol 417: 5158.[CrossRef][Medline]
Steen KH, Reeh OW, Anton F, and Handwerker HO (1992) Protons selectively induce lasting excitation and sensitization to mechanical stimulation of nociceptors in rat skin in vitro. J Neurosci 12: 8695.[Abstract]
Szallasi A, Blumberg PM, Annicelli LL, Krause JE, and Cortright DN (1999) The cloned rat vanilloid receptor VR1 mediates both R-type binding and C-type calcium response in dorsal root ganglion neurons. Mol Pharmacol 56: 581587.
Tominaga M, Caterina M, Malmberg A, Rosen T, Gilbert H, Skinner K, Raumann B, Basbaum A, and Julius D (1998) The cloned capsaicin receptor integrates multiple pain-producing stimuli. Neuron 21: 531543.[CrossRef][Medline]
Vyklicky L, Knotkova-Urbancova H, Vitaskova Z, Vlachova V, Kress M, and Reeh PW (1998) Inflammatory mediators at acidic pH activate capsaicin receptors in cultured sensory neurons from newborn rats. J Neurophysiol 79: 670676.
Waldmann R, Champigny G, Lingueglia E, De Weille JR, Heurteaux C, and Lazdunski M (1999) H(+)-gated cation channels. Ann NY Acad Sci 868: 6776.[CrossRef][Medline]
Walker K, Urban L, Medhurst SJ, Patel S, Panesar M, Fox AJ, and McIntyre P (2003) The VR1 antagonist, capsazepine, reverses mechanical hyperalgesia in models of inflammatory and neuropathic pain. J Pharmacol Exp Ther 304: 5662.
Walpole CSJ, Bevan S, Bovermann G, Boelsterli JJ, Breckenridge R, Davies JW, Hughes GA, James I, Oberer L, Winter J, et al. (1994) The discovery of capsazepine, the first competitive antagonist of the sensory neuron excitants capsaicin and resiniferatoxin. J Med Chem 37: 19421954.[CrossRef][Medline]
Walpole CSJ, Wrigglesworth R, Bevan S, Campbell EA, Dray A, James IF, Perkins MN, Reid DJ, and Winter J (1993) Analogues of capsaicin with agonist activity as novel analgesic agents; structure-activity studies. 1. The aromatic "A-region". J Med Chem 36: 23622372.[CrossRef][Medline]
Welch JM, Simon SA, and Reinhart PH (2000) The activation mechanism of rat vanilloid receptor 1 by capsaicin involves the pore domain and differs from the activation by either acid or heat. Proc Natl Acad Sci USA 97: 1388913894.
Wehmeyer KR, Kasting GB, Powell JH, Kuhlenbeck DL, Underwood RA, and Bowman LA (1990) Application of liquid chromatography with on-line radiochemical detection to metabolism studies on a novel class of analgesics. J Pharm Biomed Anal 8: 177183.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
A. Dhaka, V. Uzzell, A. E. Dubin, J. Mathur, M. Petrus, M. Bandell, and A. Patapoutian TRPV1 Is Activated by Both Acidic and Basic pH J. Neurosci., January 7, 2009; 29(1): 153 - 158. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. U. De Schepper, B. Y. De Winter, L. Van Nassauw, J.-P. Timmermans, A. G. Herman, P. A. Pelckmans, and J. G. De Man TRPV1 receptors on unmyelinated C-fibres mediate colitis-induced sensitization of pelvic afferent nerve fibres in rats J. Physiol., November 1, 2008; 586(21): 5247 - 5258. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Surowy, T. R. Neelands, B. R. Bianchi, S. McGaraughty, R. El Kouhen, P. Han, K. L. Chu, H. A. McDonald, M. Vos, W. Niforatos, et al. (R)-(5-tert-Butyl-2,3-dihydro-1H-inden-1-yl)-3-(1H-indazol-4-yl)-urea (ABT-102) Blocks Polymodal Activation of Transient Receptor Potential Vanilloid 1 Receptors in Vitro and Heat-Evoked Firing of Spinal Dorsal Horn Neurons in Vivo J. Pharmacol. Exp. Ther., September 1, 2008; 326(3): 879 - 888. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Escalera, C. A. von Hehn, B. F. Bessac, M. Sivula, and S.-E. Jordt TRPA1 Mediates the Noxious Effects of Natural Sesquiterpene Deterrents J. Biol. Chem., August 29, 2008; 283(35): 24136 - 24144. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Fajardo, V. Meseguer, C. Belmonte, and F. Viana TRPA1 Channels Mediate Cold Temperature Sensing in Mammalian Vagal Sensory Neurons: Pharmacological and Genetic Evidence J. Neurosci., July 30, 2008; 28(31): 7863 - 7875. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. U. De Schepper, J. G. De Man, N. E. Ruyssers, A. Deiteren, L. Van Nassauw, J.-P. Timmermans, W. Martinet, A. G. Herman, P. A. Pelckmans, and B. Y. De Winter TRPV1 receptor signaling mediates afferent nerve sensitization during colitis-induced motility disorders in rats Am J Physiol Gastrointest Liver Physiol, January 1, 2008; 294(1): G245 - G253. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Cadiou, M. Studer, N. G. Jones, E. St. J. Smith, A. Ballard, S. B. McMahon, and P. A. McNaughton Modulation of Acid-Sensing Ion Channel Activity by Nitric Oxide J. Neurosci., November 28, 2007; 27(48): 13251 - 13260. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bhattacharya, B. P. Scott, N. Nasser, H. Ao, M. P. Maher, A. E. Dubin, D. M. Swanson, N. P. Shankley, A. D. Wickenden, and S. R. Chaplan Pharmacology and Antitussive Efficacy of 4-(3-Trifluoromethyl-pyridin-2-yl)-piperazine-1-carboxylic Acid (5-Trifluoromethyl-pyridin-2-yl)-amide (JNJ17203212), a Transient Receptor Potential Vanilloid 1 Antagonist in Guinea Pigs J. Pharmacol. Exp. Ther., November 1, 2007; 323(2): 665 - 674. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. R. Gavva, A. W. Bannon, D. N. Hovland Jr., S. G. Lehto, L. Klionsky, S. Surapaneni, D. C. Immke, C. Henley, L. Arik, A. Bak, et al. Repeated Administration of Vanilloid Receptor TRPV1 Antagonists Attenuates Hyperthermia Elicited by TRPV1 Blockade J. Pharmacol. Exp. Ther., October 1, 2007; 323(1): 128 - 137. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Gunthorpe, S. L. Hannan, D. Smart, J. C. Jerman, S. Arpino, G. D. Smith, S. Brough, J. Wright, J. Egerton, S. C. Lappin, et al. Characterization of SB-705498, a Potent and Selective Vanilloid Receptor-1 (VR1/TRPV1) Antagonist That Inhibits the Capsaicin-, Acid-, and Heat-Mediated Activation of the Receptor J. Pharmacol. Exp. Ther., June 1, 2007; 321(3): 1183 - 1192. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Malkia, R. Madrid, V. Meseguer, E. de la Pena, M. Valero, C. Belmonte, and F. Viana Bidirectional shifts of TRPM8 channel gating by temperature and chemical agents modulate the cold sensitivity of mammalian thermoreceptors J. Physiol., May 15, 2007; 581(1): 155 - 174. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. R. Gavva, A. W. Bannon, S. Surapaneni, D. N. Hovland Jr, S. G. Lehto, A. Gore, T. Juan, H. Deng, B. Han, L. Klionsky, et al. The Vanilloid Receptor TRPV1 Is Tonically Activated In Vivo and Involved in Body Temperature Regulation J. Neurosci., March 28, 2007; 27(13): 3366 - 3374. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Madrid, T. Donovan-Rodriguez, V. Meseguer, M. C. Acosta, C. Belmonte, and F. Viana Contribution of TRPM8 Channels to Cold Transduction in Primary Sensory Neurons and Peripheral Nerve Terminals J. Neurosci., November 29, 2006; 26(48): 12512 - 12525. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Klionsky, R. Tamir, B. Holzinger, X. Bi, J. Talvenheimo, H. Kim, F. Martin, J.-C. Louis, J. J. S. Treanor, and N. R. Gavva A Polyclonal Antibody to the Prepore Loop of Transient Receptor Potential Vanilloid Type 1 Blocks Channel Activation J. Pharmacol. Exp. Ther., October 1, 2006; 319(1): 192 - 198. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lazar, D. C. Braun, A. Toth, Y. Wang, L. V. Pearce, V. A. Pavlyukovets, P. M. Blumberg, S. H. Garfield, S. Wincovitch, H.-K. Choi, et al. Kinetics of Penetration Influence the Apparent Potency of Vanilloids on TRPV1 Mol. Pharmacol., April 1, 2006; 69(4): 1166 - 1173. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. R. Gavva, R. Tamir, L. Klionsky, M. H. Norman, J.-C. Louis, K. D. Wild, and J. J. S. Treanor Proton Activation Does Not Alter Antagonist Interaction with the Capsaicin-Binding Pocket of TRPV1 Mol. Pharmacol., December 1, 2005; 68(6): 1524 - 1533. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Weil, S. E. Moore, N. J. Waite, A. Randall, and M. J. Gunthorpe Conservation of Functional and Pharmacological Properties in the Distantly Related Temperature Sensors TRVP1 and TRPM8 Mol. Pharmacol., August 1, 2005; 68(2): 518 - 527. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. El Kouhen, C. S. Surowy, B. R. Bianchi, T. R. Neelands, H. A. McDonald, W. Niforatos, A. Gomtsyan, C.-H. Lee, P. Honore, J. P. Sullivan, et al. A-425619 [1-Isoquinolin-5-yl-3-(4-trifluoromethyl-benzyl)-urea], a Novel and Selective Transient Receptor Potential Type V1 Receptor Antagonist, Blocks Channel Activation by Vanilloids, Heat, and Acid J. Pharmacol. Exp. Ther., July 1, 2005; 314(1): 400 - 409. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. R. Gavva, R. Tamir, Y. Qu, L. Klionsky, T. J. Zhang, D. Immke, J. Wang, D. Zhu, T. W. Vanderah, F. Porreca, et al. AMG 9810 [(E)-3-(4-t-Butylphenyl)-N-(2,3-dihydrobenzo[b][1,4] dioxin-6-yl)acrylamide], a Novel Vanilloid Receptor 1 (TRPV1) Antagonist with Antihyperalgesic Properties J. Pharmacol. Exp. Ther., April 1, 2005; 313(1): 474 - 484. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. R. Gavva, L. Klionsky, Y. Qu, L. Shi, R. Tamir, S. Edenson, T. J. Zhang, V. N. Viswanadhan, A. Toth, L. V. Pearce, et al. Molecular Determinants of Vanilloid Sensitivity in TRPV1 J. Biol. Chem., May 7, 2004; 279(19): 20283 - 20295. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Toth, P. M. Blumberg, Z. Chen, and A. P. Kozikowski Design of a High-Affinity Competitive Antagonist of the Vanilloid Receptor Selective for the Calcium Entry-Linked Receptor Population Mol. Pharmacol., February 1, 2004; 65(2): 282 - 291. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Pomonis, J. E. Harrison, L. Mark, D. R. Bristol, K. J. Valenzano, and K. Walker N-(4-Tertiarybutylphenyl)-4-(3-cholorphyridin-2-yl)tetrahydropyrazine -1(2H)-carbox-amide (BCTC), a Novel, Orally Effective Vanilloid Receptor 1 Antagonist with Analgesic Properties: II. In Vivo Characterization in Rat Models of Inflammatory and Neuropathic Pain J. Pharmacol. Exp. Ther., July 1, 2003; 306(1): 387 - 393. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||