|
|
|
|
ABSORPTION, DISTRIBUTION, METABOLISM, AND EXCRETION
Department of Pharmacology and Toxicology, University of Oulu, Finland (J.Hu., T.V., A.L., O.P., J.Ha.); Department of Internal Medicine, Lapland Central Hospital, Rovaniemi, Finland (J.Hu.); Finnish Institute of Occupational Health, Helsinki, Finland (R.P., S.A.); and Department of Pharmacology and Toxicology, University of Kuopio, Finland (H.R.)
Received May 2, 2002 ; accepted November 6, 2002.
| Abstract |
|---|
|
|
|---|
Lung tissues activate several procarcinogens, such as the polycyclic
aromatic hydrocarbon benzo[a]pyrene (B[a]P) and several
N-nitrosamines, to form DNA adducts
(Autrup, 1990
). It has been
shown that benzo[a]pyrene diol epoxide, the ultimate carcinogenic
metabolite of B[a]P, causes lung cancer-specific mutations in the p53
tumor suppressor gene in human bronchial epithelial cells
(Denissenko et al., 1996
), thus
providing a direct link between lung cancer and B[a]P exposure.
CYP1A1 constitutes the major P450 enzyme activating B[a]P, but CYP3A
enzymes may play a role in the second step by catalyzing activation of
proximate metabolite B[a]P-7,8-diol
(Shimada et al., 1989
).
Research on pulmonary P450 enzymes has been dominated by CYP1A1, which is
induced by tobacco smoke in the human lung
(McLemore et al., 1990
;
Anttila et al., 1991
). Genetic
polymorphisms of this gene have been linked with a higher risk for the
development of lung cancer in the Japanese population
(Kawajiri, 1999
).
Human airway epithelial cells also contain CYP3A5 protein, which
constitutes the major CYP3A form in the human lung and is localized to
bronchial and alveolar epithelium (Kivisto
et al., 1996
; Anttila et al.,
1997
; Mace et al.,
1998
). CYP3A5 activates B[a]P dihydrodiols to DNA-binding
metabolites (Roberts-Thomson et al.,
1993
). CYP3A5 also metabolizes steroid hormones, including
glucocorticoid cortisol (Wrighton et al.,
1990
; Waxman et al.,
1991
; Kocarek et al.,
1995
).
CYP3A5 has been generally thought to be noninducible, but recent reports
from our laboratory and others have given evidence for glucocorticoid
induction of CYP3A5 (Schuetz et al.,
1996
; Hukkanen et al.,
2000
). The characterization of CYP3A5 regulation has been
previously confused by the complex structure of the CYP3A gene locus. A recent
report revealed that the originally cloned CYP3A5 5'
(Jounaidi et al., 1994
)
actually represent 5' to the CYP3AP1 pseudogene, with an exon 1 similar
to CYP3A5 (Finta and Zaphiropoulos,
2000
). Therefore, the mechanisms behind the CYP3A5 induction by
glucocorticoids need to be reanalyzed.
In our previous study, we detected the induction of CYP3A5 by dexamethasone
in the human A549 lung adenocarcinoma cell line
(Hukkanen et al., 2000
). In
the current study, we have further characterized the induction of CYP3A5 in
human lung cells by glucocorticoids, including several compounds used for the
treatment of asthma, and we demonstrate that CYP3A5 is induced in human
lung-derived cells by a mechanism involving transcriptional induction mediated
by the glucocorticoid receptor.
| Materials and Methods |
|---|
|
|
|---|
The bronchoalveolar macrophage samples were prepared as described earlier
(Piipari et al., 2000
).
Briefly, bronchoalveolar lavage was performed under local anesthesia using a
fiber optic bronchofi-beroscope. Either a medial or lateral segment of the
right middle lobe, or in a few cases, some other segment avoiding the tumor
area, was lavaged with ten 20-ml aliquots of saline solution. Fresh lavage
fluid was placed on ice, and a subset of cells was used for mRNA
preparation.
Reagents. Rifampicin, budesonide, beclomethasone dipropionate, dexamethasone, nifedipine, mifepristone (RU486), and clotrimazole were purchased from Sigma-Aldrich (St. Louis, MO).
Cell Culture. The human lung adenocarcinoma cell line A549,
originally from the American Type Culture Collection (Manassas, VA), was
cultured in Ham's F-12 medium with L-glutamine (Invitrogen, Carlsbad, CA)
supplemented with 10% fetal bovine serum (Invitrogen) and 10 µg/ml
gentamicin (Invitrogen). The cells were cultured at 37°C in 5%
CO2 and saturated humidity. Nearly confluent cells were incubated
for 24 h in the presence of inducers in Ham's F-12 medium without fetal bovine
serum. Control cultures contained the same concentration of vehicle (0.5%
dimethyl sulfoxide). After the incubation, the cells were washed with
phosphate-buffered saline (pH 7.4) suspended in the same buffer and
centrifuged. The cell pellet was suspended in cell lysis buffer for mRNA
extraction. The inducer concentrations used were not cytotoxic, judging from
the cell morphology and the
-actin mRNA contents of the cells. HepG2 and
COS-1 cells (American Type Culture Collection) were cultured in Dulbecco's
modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum
and 100 U/ml penicillin and 100 µg/ml streptomycin (Invitrogen). Otherwise,
culture conditions were similar to the A549 cells.
RT-PCR. mRNA of A549 cells, alveolar macrophages, and human liver (positive control) was extracted with the QuickPrep Micro mRNA purification kit. mRNA (0.5 µg) was used for cDNA synthesis with the First-Strand synthesis kit. All reagents were from Amersham Biosciences AB (Uppsala, Sweden).
The PCR reactions contained 1 µl of cDNA (of the 15 µl of total cDNA), 2.0 U of DynaZyme DNA polymerase (Finnzymes, Helsinki, Finland), 5 µl of 10x DynaZyme reaction buffer, dNTP reaction mix (Finnzymes) at a final concentration of 200 µM, 50 pmol of each primer, and water to a final volume of 50 µl. Thirty-five PCR cycles of 1 min at 94°C, 1 min at 5562°C, and 2 min at 72°C were performed. In every series of PCR reactions, there was a negative control containing an aliquot of cDNA synthesis reaction performed with heat-inactivated reverse transcriptase enzyme. All PCR reactions were performed at least three times. To exclude the chance of cross-hybridization with other sequences, each primer was compared with the European Molecular Biology Laboratory human gene bank using the FASTA program (Genetics Computer Group, Madison, WI). The primers [glucocorticoid receptor (GR), Se: GGAGTTTTCTTCTGGGTCCC, As: GAGAGCTTACATCTGGTCTC; pregnane X receptor (PXR), Se: AGCTGGAACCATGCTGACTT, As: AGGGGCGTAGCAAAGGGGTG; CAR, Se: AAGGAGCAAGAAGAGCTGATC, As: TCAGCTGCAGATCTCCTGGAG] were also designed to amplify regions containing at least one intron in the gene to exclude contamination of cDNA with genomic DNA. After the PCR, an 8-µl aliquot of each reaction mixture was electrophoresed in an agarose gel and stained with ethidium bromide. A visible band of the correct size was considered a sign of the specific mRNA being present in the sample.
Quantitative RT-PCR. The total RNA from A549 cells for quantitative RT-PCR measurements was extracted with quanidium thiocyanate followed by centrifugation in cesium chloride. The first-strand cDNA was synthesized with the First-Strand synthesis kit (Amersham Biosciences AB) using 1 µg of RNA and pd(N)6 random hexadeoxynucleotides.
Quantitative PCR reactions were performed with an ABI 7700 sequence detection system using TaqMan chemistry (Applied Biosystems, Foster City, CA). The forward and reverse primers for CYP3A5 mRNA detection were AAGGAAGACTCACAGAACACAGTTGA and GGTTTCCACCGCCAAATTT, respectively. The 74-base pair amplicon was detected using the bifunctional fluorogenic probe 5'-Fam AAGGAAAGTGGCGATGGACCTCATCC-Tamra-3'. The results were normalized to 18 S RNA quantified from the same samples using the forward and reverse primers TGGTTGCAAAGCTGAAACTTAAAG and AGTCAAATTAAGCCGCAGGC, respectively. The probe for the 18 S amplicon was 5'-Vic-CCTGGTGGTGCCCTTCCGTCA-Tamra-3'.
Plasmids. The CYP3A5 5' 1355 to +40 and the CYP3AP1
5' 1359 to +39 regions were amplified with PCR from human genomic
DNA using Dynazyme EXT polymerase (Finnzymes). The numbering is based on
Jounaidi et al. (1994
). The
PCR products were cloned using KpnI and NheI restriction
sites to pGL3-Basic (Promega, Madison, WI) in front of the luciferase reporter
gene. The identity of the constructs was verified by sequencing. The CYP3A5
5' sequence amplified from liver M24 was found to be fully identical to
the GenBank sequence (accession no. NG_000004). The corresponding sequence
from liver M27 had two point mutations. These nucleotide changes had no effect
on transcriptional activation. The GR expression plasmid and the
pGRE2TATA-luc reporter plasmid were generously provided by Dr.
Jorma Palvimo (Institute of Biomedicine, University of Helsinki, Finland).
Transfections. The A549 cells were seeded to 24-well plates the day
before transfection. The cells were transfected with LipofectAMINE 2000
transfection reagent (Invitrogen) according to the manufacturer's protocol,
using 1 µg of plasmid DNA and 2.5 µl of transfection lipid and Opti-MEM
I media (Invitrogen). Twenty-four hours after transfection, the media was
replaced with serum-free Ham's F-12 medium, and the 10 µM dexamethasone or
dimethyl sulfoxide was added when appropriate for 48 h. The HepG2 cells were
transfected with Tfx-20 reagent (Promega) according to the manufacturer's
protocol. The COS-1 cells were seeded to 24-well plates the day before
transfection and transfected with Lipo-fectAMINE 2000 transfection reagent,
using 0.8 µg of reporter plasmid DNA, 0.2 µg of GR expression vector,
and 3 µl of transfection lipid and Opti-MEM I media. The treatment was
similar to A549 cells. To provide an internal control for transfection
efficiency, a second reporter plasmid was transfected. For A549 and HepG2
cells, pSV-
-galactosidase plasmid (Promega) was used, and for COS-1
cells, pRL-TK plasmid (Promega) was used. The luciferase activities for A549
and HepG2 cells were measured using the luciferase assay system (Promega), and
the
-galactosidase activities were measured with the luminescent
-galactosidase detection kit II (BD Biosciences Clontech, Palo Alto,
CA). For COS-1 cells, the activities were measured using the Dual-luciferase
reporter assay system (Promega).
Statistical Analyses. Student's t test was used for comparison between two groups. Comparison of several groups was done with one-way ANOVA followed by Bonferroni's post hoc test. The results concerning the effects of glucocorticoid use and smoking on CYP3A5 mRNA levels in macrophages were analyzed with two-way ANOVA followed by Bonferroni's post hoc test.
Results
Induction of CYP3A5 in A549 Cells. CYP3A5 mRNA was measured by
quantitative RT-PCR after exposure of the A549 cells for 24 h to well defined
chemical inducers of CYP3A. CYP3A5 was induced only by the glucocorticoids
dexamethasone, beclomethasone dipropionate, and budesonide
(Fig. 1). CYP3A5 mRNA was not
affected by treatment with typical inducers of CYP3A4, i.e., RU486,
clotrimazole, rifampicin, or nifedipine. Induction by glucocorticoids was
further characterized by dose-response analyses, which showed that
100 nM
concentrations were sufficient for maximal induction
(Fig. 2).
|
|
CYP3A5 Glucocorticoid Induction Is Mediated by the Glucocorticoid
Receptor. To test the involvement of GR in the induction process of
CYP3A5, a glucocorticoid receptor antagonist, RU486, was used. CYP3A5
induction by glucocorticoids was completely blocked by the RU486
(Fig. 3). Budenoside has the
highest affinity for GR among the glucocorticoids tested
(KD,
1 nM)
(Boobis, 1998
;
Esmailpour et al., 1998
). A
10-fold excess of RU486 with a similar KD
(Cadepond et al., 1997
) was
able to block CYP3A5 induction by budenoside.
|
Further, to exclude the involvement of nuclear receptors PXR and CAR that regulates induction of many P450 genes, including CYP3A4, RT-PCR with PXR, CAR, and GR primers were performed to detect the expression of mRNAs of these receptors. As illustrated in Fig. 4, only GR mRNA was present. In separate experiments, a 24-h exposure to 10 µM dexamethasone, budenoside, or beclomethasone dipropionate did not induce PXR or CAR mRNA in A549 cells (data not shown).
|
Regulation of CYP3A5 Transcription by Glucocorticoids. To assess the
role of transcriptional regulation in induction of CYP3A5 by glucocorticoids,
a reporter gene construct containing the CYP3A5 5' regulatory region and
luciferase reporter gene was constructed. The characterization of CYP3A5
regulation has been previously confused by the complex structure of the CYP3A
gene locus. The recent characterization of CYP3A locus
(Finta and Zaphiropoulos,
2000
) revealed that the originally cloned CYP3A5 5'
(Jounaidi et al., 1994
)
actually represents the 5' area of the CYP3AP1 pseudogene, with an exon
1 similar to CYP3A5. The pseudogene 5' region was found to have 89%
sequence similarity to the CYP3A5 5' region
(Finta and Zaphiropoulos,
2000
). The 1355 to +40 region of the CYP3A5 5' and
1359 to +39 region of the CYP3AP1 pseudogene 5' were amplified
with PCR from genomic DNA from two individuals, one with a high level of
CYP3A5 protein in the liver (M27) and another with very low level (M24). The
liver CYP3A5 protein levels were determined by immunoblotting, using
CYP3A5-specific antipeptide antibody (data not shown) as previously described
(Hakkola et al., 2001
).
The reporter gene constructs were transfected into A549 cells, and the
cells were treated with dexamethasone or vehicle alone for 48 h. A construct
with two copies of glucocorticoid response elements (GRE) in front of a TATA
box was used as a positive control (pGRE2TATA-luc)
(Moilanen et al., 1998
). After
treatment, the cells were harvested, and the luciferase activity was measured.
The constructs with CYP3A5 5' regulatory regions from the two
individuals were much more actively transcribed than the construct with
CYP3AP1 5', indicating that the relatively few nucleotide differences
between the CYP3A5 5' and the CYP3AP1 pseudogene 5' are critically
important for the regulation of CYP3A5 gene expression
(Fig. 5). There was no
difference in transcriptional activation by the constructs from the two
different individuals. Dexamethasone treatment induced transcription of
pGRE2TATA-luc construct 17-fold. CYP3A5 5'-luc was modestly
activated 1.3- to 1.5-fold, indicating involvement of transcriptional
mechanism in the induction by glucocorticoids
(Fig. 5). Also, the hepatoma
cell line HepG2 was transfected and treated in a similar manner. Results
similar to the A549 cells were also obtained in the HepG2 cell line (data not
shown), indicating that the glucocorticoid induction of CYP3A5 is not a unique
characteristic of lung cells.
|
The significance of cellular content of GR for induction of CYP3A5 was studied next by overexpression studies. The GR expression plasmid was cotransfected together with CYP3A5 5'-luc plasmid or with control plasmid pGRE2TATA-luc to both A549 and HepG2 cells. Overexpression of GR increased basal expression level of pGRE2TATA-luc in both cell lines. However, the fold induction by dexamethasone treatment was increased only in HepG2 cells. In contrast, cotransfection of GR with CYP3A5 5'-luc increased the CYP3A5 5' dexamethasone response from 1.3- to 3.1-fold and 1.2- to 3.2-fold in both A549 and HepG2, respectively (Fig. 6).
|
To confirm the contribution of the GR to induction mechanism, the CYP3A5 5'-luc reporter construct was transfected to the GR-deficient cell line COS-1, and the cells were treated with dexamethasone for 48 h. The pGRE2TATA-luc construct was transfected in a similar manner. Dexamethasone was unable to induce either CYP3A5 5'-luc or pGRE2TATA-luc in COS-1 cells. Cotransfection with GR-expression vector restored the dexamethasone induction for both the CYP3A5'-luc and the pGRE2TATA-luc (Fig. 7), indicating that the GR is both necessary and sufficient for CYP3A5 induction by dexamethasone.
|
Effect of Inhaled Glucocorticoids and Smoking on the Alveolar Macrophage CYP3A5 mRNA Levels. To test the hypothesis that inhaled glucocorticoids affect the level of CYP3A5 mRNA of alveolar macrophages in patients with respiratory diseases in vivo, CYP3A5 mRNA was measured with quantitative RT-PCR from 32 macrophage samples. In two-way ANOVA, the CYP3A5 expression level was dependent on smoking status (F = 4.028, P = 0.03) but not on glucocorticoid use (F = 0.214, P = 0.809). Tobacco smoking and glucocorticoid use were statistically not dependent on each other (F = 1.048 and P = 0.365). Smoking decreased the CYP3A5 level by 93% compared with nonsmokers (Bonferroni's post hoc test, P = 0.039) (Fig. 8). Ex-smokers' CYP3A5 level was 88% of nonsmokers' CYP3A5 level (P = 0.106) (Fig. 8). The use of glucocorticoids increased the CYP3A5 level by 45% in nonsmokers (P = 0.438). Sex and age were tested as confounding factors, but they did not influence the results.
|
Discussion
CYP3A5 is the main CYP3A form in the human lung, and it is localized to
bronchial, bronchiolar, and alveolar epithelium as well as alveolar
macrophages (Kivisto et al.,
1995
,
1996
;
Anttila et al., 1997
). Compared
with CYP3A4, the CYP3A5 enzyme shows roughly the same substrate preference
pattern but lower turnover rates (Aoyama et
al., 1989
; Wrighton et al.,
1990
; Yamazaki et al.,
1995
). However, CYP3A5 cannot metabolize some CYP3A4 substrates,
such as erythromycin and quinidine
(Wrighton et al., 1990
).
We have previously shown CYP3A5 to be induced by the synthetic
glucocorticoid dexamethasone in the human A549 lung adenocarcinoma cell line,
indicating that this cell line is suitable for mechanistic studies of CYP3A5
pulmonary regulation (Hukkanen et al.,
2000
). In the current study, we demonstrate that besides
dexamethasone, beclomethasone dipropionate and budesonide, which are inhaled
glucocorticoids commonly used for the treatment of asthma, also induce CYP3A5
mRNA about 4-fold in A549 cells.
The glucocorticoid induction of CYP3A5 in human lung has several
implications on the physiological, pharmacological, and toxicological
significance of CYP3A5. The induction of CYP3A5 by low concentrations of
glucocorticoids suggests that CYP3A5 could have some physiological roles in
maintaining the steroid hormone balance in lung, since CYP3A5 is active in the
metabolism of steroid hormones (Waxman et
al., 1991
), including endogenous glucocorticoid cortisol
(Wrighton et al., 1990
). Thus,
the local concentration of endogenous glucocorticoids might be regulated by
negative feedback involving induction of CYP3A5. Maximal induction was reached
at concentrations as low as
100 nM, suggesting that CYP3A5 could be
induced in vivo in patients using these inhaled glucocorticoids. The inhaled
glucocorticoid budesonide is also metabolized by CYP3A
(Jonsson et al., 1995
),
indicating that budesonide possibly autoinduces its own metabolism in human
lung. Furthermore, the CYP3A forms are of importance in the metabolism of
inhaled xenobiotics, including tobacco-derived procarcinogens, such as PAHs
and 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone
(Hecht, 1999
). CYP3A5 is
active in the metabolism of the benzo[a]pyrene proximate carcinogen
benzo[a]pyrene-7,8-diol
(Roberts-Thomson et al., 1993
;
Shou et al., 1994
). This is
reflected in the positive correlation between PAH-DNA adducts and CYP3A5
levels in alveolar macrophages (Piipari et
al., 2000
). Also, in human pulmonary microsomes, the last step of
benzo[a]pyrene activation is stimulated by
-naphthoflavone, a
CYP3A activator (Shimada et al.,
1989
,
1992
). If CYP3A5 is induced in
human lung in vivo by glucocorticoids, it could have a modulating effect on
the individual susceptibility to lung cancer in patients using inhaled or
systemic glucocorticoids.
The mechanism of dexamethasone induction of CYP3A4 has been a target of
numerous recent studies, and the role for both GR and PXR receptors has been
suggested. The recent investigation by Pascussi et al.
(2001
) suggested dual
regulation of CYP3A4 by dexamethasone. The lower, nanomolar concentration acts
indirectly through GR by up-regulating expression of PXR, which in turn,
possibly ligand independently, moderately activates CYP3A4 transcription. The
higher micromolar concentrations would bind to and activate the PXR, resulting
in more extensive activation of CYP3A4 transcription. In the current study, we
show that the glucocorticoid induction of CYP3A5 is regulated differently from
CYP3A4. Several lines of evidence support the notion that CYP3A5 induction by
glucocorticoids is mediated by direct action of GR and not through PXR. The
induction takes place in an A549 lung adenocarcinoma cell line expressing GR
but not the other CYP3A-regulating receptors, PXR or CAR. The induction is
achieved with relatively low nanomolar concentrations of dexamethasone that
are known to result in activation of human GR but not human PXR
(Pascussi et al., 2001
). The
GR antagonist RU486 was able to inhibit glucocorticoid induction of CYP3A5.
Finally, dexamethasone was unable to activate CYP3A5 transcription in the
GR-deficient cell line COS-1, but the activation could be achieved after GR
cotransfection.
The dexamethasone induction of CYP3A5 was found to involve transcriptional
activation based on transfection experiments with CYP3A5 5'-luciferase
reporter constructs. However, the luciferase activities were increased
relatively modestly, 1.3- to 1.5-fold by dexamethasone treatment.
Overexpression of GR in A459 and HepG2 cells increased dexamethasone induction
of two copies of classical GRE elements containing pGRE2TATA-luc
construct only in HepG2 cells but not in A549 cells. This suggests that A549
cells contain a sufficient amount of GR for full glucocorticoid induction,
whereas HepG2 cells do not. However, the CYP3A5 5'-luc dexamethasone
response was efficiently increased in both cell lines by GR overexpression.
This may signal that CYP3A5 induction by glucocorticoids is mediated by
low-affinity GRE in the CYP3A5 5'. CYP3AP1 has been previously shown to
contain an atypical, functional glucocorticoid-responsive element
(Schuetz et al., 1996
). The
corresponding sequence region in CYP3A5 5' is similar, but not
identical, to the CYP3AP1 glucocorticoid response area. Therefore, this region
could play a role in the glucocorticoid induction of CYP3A5, but this needs to
be confirmed in further studies. Interestingly, dexamethasone and other tested
glucocorticoids induced CYP3A5 mRNA 4-fold in A549 cells without any GR
supplementation, suggesting that in the natural chromatin structure, the
CYP3A5 5' affinity to GR may be higher than in the context of the
plasmid. Alternatively, it is possible that additional regulatory elements may
be present in the gene regions not included in the studied reporter construct,
or that post-transcriptional mechanisms could contribute to the induction.
We tested the hypothesis that CYP3A5 would be induced by inhaled glucocorticoids in alveolar macrophages of patients with respiratory diseases in vivo. However, the differences in CYP3A5 expression in alveolar macrophages between nonsmoking current glucocorticoid users, ex-users, and nonusers were insignificant (a 45% increase of CYP3A5 in glucocorticoid users compared with nonusers, P = 0.438). This could be due to several possible reasons: 1) the observed induction of CYP3A5 in A549 cells does not occur in the corresponding cell type in vivo; 2) glucocorticoids do not induce CYP3A5 in alveolar macrophages; 3) inhaled doses of glucocorticoids do not reach alveolar macrophages in sufficient amounts; or 4) endogenous glucocorticoid levels activate CYP3A5 transcription, reducing the effect of exogenous glucocorticoid administration. A study with bronchial epithelial samples from glucocorticoid users and controls would be needed to find out whether CYP3A5 is induced in human lung tissue in vivo.
Cigarette smoking had a markedly decreasing effect on CYP3A5 mRNA levels in
alveolar macrophages. CYP3A5 expression in current smokers was only 7% of the
CYP3A5 level in nonsmokers. This is in agreement with a recent study that
demonstrated that smoking decreases CYP3A5 protein levels in alveolar
macrophages (Piipari et al.,
2000
). Importantly, it was also shown that CYP3A5 protein levels
correlate positively with PAH-DNA adducts in macrophages of smokers when the
data were normalized by the number of cigarettes smoked per day. However,
down-regulation of pulmonary CYP3A5 by cigarette smoking may reduce its
contribution to smoking-induced lung cancer. The mechanism of this repression
is unknown. Treatment of the A549 cells with
2,3,7,8-tetrachlorodibenzo-p-dioxin had no effect on CYP3A5
expression (Hukkanen et al.,
2000
).
In conclusion, the present study indicates that CYP3A5 is induced by glucocorticoids, including the compounds used for the treatment of asthma at concentrations that could be achieved in vivo. The glucocorticoid induction of CYP3A5 is regulated differently than CYP3A4, is mediated by GR, and involves transcriptional regulation of the CYP3A5 gene. In vivo, cigarette smoking represses CYP3A5 expression in alveolar macrophages by currently unknown mechanism(s). The pulmonary CYP3A5 is therefore under the regulation of environmental and medical substances, adding another level to the variation primarily determined by genetic factors.
| Acknowledgements |
|---|
| Footnotes |
|---|
ABBREVIATIONS: P450, cytochrome P450; B[a]P, benzo[a]pyrene; CAR, constitutively active receptor; GR, glucocorticoid receptor; PAH, polycyclic aromatic hydrocarbon; PXR, pregnane X receptor; RT-PCR, reverse transcriptase-polymerase chain reaction; RU486, mifepristone; PCR, polymerase chain reaction; Tamra, 5-carboxytetramethylrhodamine; ANOVA, analysis of variance; GRE, glucocorticoid response elements.
Address correspondence to: Jukka Hakkola, Department of Pharmacology and Toxicology, University of Oulu, P.O. Box 5000, FIN-90014 Oulun yliopisto, Finland. E-mail: jukka.hakkola{at}oulu.fi
| References |
|---|
|
|
|---|
Anttila S, Hietanen E, Vainio H, Camus AM, Gelboin HV, Park SS,
Heikkila L, Karjalainen A, and Bartsch H (1991) Smoking and
peripheral type of cancer are related to high levels of pulmonary cytochrome
P450IA in lung cancer patients. Int J Cancer
47:
681685.[Medline]
Anttila S, Hukkanen J, Hakkola J, Stjernvall T, Beaune P, Edwards
RJ, Boobis AR, Pelkonen O, and Raunio H (1997) Expression and
localization of CYP3A4 and CYP3A5 in human lung. Am J Respir Cell
Mol Biol 16:
242249.[Abstract]
Aoyama T, Yamano S, Waxman DJ, Lapenson DP, Meyer UA, Fischer V,
Tyndale R, Inaba T, Kalow W, Gelboin HV, et al. (1989) Cytochrome
P-450 hPCN3, a novel cytochrome P-450 IIIA gene product that is differentially
expressed in adult human liver. cDNA and deduced amino acid sequence and
distinct specificities of cDNA-expressed hPCN1 and hPCN3 for the metabolism of
steroid hormones and cyclosporine. J Biol Chem
264:
1038810395.
Autrup H (1990) Carcinogen metabolism in cultured
human tissues and cells. Carcinogenesis
11:
707712.
Bartsch H, Nair U, Risch A, Rojas M, Wikman H, and Alexandrov K
(2000) Genetic polymorphism of CYP genes, alone or in
combination, as a risk modifier of tobacco-related cancers. Cancer
Epidemiol Biomarkers Prev 9:
328.
Boobis AR (1998) Comparative physicochemical and
pharmacokinetic profiles of inhaled beclomethasone dipropionate and
budesonide. Respir Med 92 (Suppl B): 26.
Cadepond F, Ulmann A, and Baulieu EE (1997) RU486
(mifepristone): mechanisms of action and clinical uses. Annu Rev
Med 48:
129156.[CrossRef][Medline]
Denissenko MF, Pao A, Tang M, and Pfeifer GP (1996)
Preferential formation of benzo[a]pyrene adducts at lung cancer mutational
hotspots in P53. Science (Wash DC)
274:
430432.
Esmailpour N, Hogger P, and Rohdewald P (1998) Binding
kinetics of budesonide to the human glucocorticoid receptor. Eur J
Pharm Sci 6:
219223.[CrossRef][Medline]
Finta C and Zaphiropoulos PG (2000) The human
cytochrome P450 3A locus. Gene evolution by capture of downstream exons.
Gene (Amst) 260:
1323.[CrossRef][Medline]
Hakkola J, Raunio H, Purkunen R, Saarikoski S, Vahakangas K,
Pelkonen O, Edwards RJ, Boobis AR, and Pasanen M (2001)
Cytochrome P450 3A expression in the human fetal liver: evidence that CYP3A5
is expressed in only a limited number of fetal livers. Biol
Neonate 80:
193201.[CrossRef][Medline]
Hecht SS (1999) Tobacco smoke carcinogens and lung
cancer. J Natl Cancer Inst
91:
11941210.
Hukkanen J, Lassila A, Paivarinta K, Valanne S, Sarpo S, Hakkola J,
Pelkonen O, and Raunio H (2000) Induction and regulation of
xenobiotic-metabolizing cytochrome P450s in the human A549 lung adenocarcinoma
cell line. Am J Respir Cell Mol Biol
22:
360366.
Jonsson G, Astrom A, and Andersson P (1995) Budesonide
is metabolized by cytochrome P450 3A (CYP3A) enzymes in human liver.
Drug Metab Dispos 23:
137142.[Abstract]
Jounaidi Y, Guzelian PS, Maurel P, and Vilarem MJ
(1994) Sequence of the 5'- flanking region of CYP3A5:
comparative analysis with CYP3A4 and CYP3A7. Biochem Biophys Res
Commun 205:
17411747.[CrossRef][Medline]
Kawajiri K (1999) Metabolic polymorphism and
susceptibility to cancer (Vineis P, Malats N, Lang M, d'Errico A,
Caporaso N, Cuzick J, and Boffetta P, eds) vol 148, pp
159172. IARC Scientific Publications, Lyon,
France.
Kivisto KT, Fritz P, Linder A, Friedel G, Beaune P, and Kroemer HK
(1995) Immunohistochemical localization of cytochrome P450 3A in
human pulmonary carcinomas and normal bronchial tissue. Histochem
Cell Biol 103:
2529.[CrossRef][Medline]
Kivisto KT, Griese EU, Fritz P, Linder A, Hakkola J, Raunio H,
Beaune P, and Kroemer HK (1996) Expression of cytochrome P 450 3A
enzymes in human lung: a combined RT-PCR and immunohistochemical analysis of
normal tissue and lung tumours. Naunyn-Schmiedeberg's Arch
Pharmacol 353:
207212.[Medline]
Kocarek TA, Schuetz EG, Strom SC, Fisher RA, and Guzelian PS
(1995) Comparative analysis of cytochrome P4503A induction in
primary cultures of rat, rabbit and human hepatocytes. Drug Metab
Dispos 23:
415421.[Abstract]
Mace K, Bowman ED, Vautravers P, Shields PG, Harris CC, and Pfeifer
AM (1998) Characterisation of xenobiotic-metabolising enzyme
expression in human bronchial mucosa and peripheral lung tissues.
Eur J Cancer 34:
914920.
McLemore TL, Adelberg S, Liu MC, McMahon NA, Yu SJ, Hubbard WC,
Czerwinski M, Wood TG, Storeng R, Lubet RA, et al. (1990)
Expression of CYP1A1 gene in patients with lung cancer: evidence for cigarette
smoke-induced gene expression in normal lung tissue and for altered gene
regulation in primary pulmonary carcinomas. J Natl Cancer
Inst 82:
13331339.
Moilanen AM, Poukka H, Karvonen U, Hakli M, Janne OA, and Palvimo
JJ (1998) Identification of a novel RING finger protein as a
coregulator in steroid receptor-mediated gene transcription. Mol
Cell Biol 18:
51285139.
Pascussi JM, Drocourt L, Gerbal-Chaloin S, Fabre JM, Maurel P, and
Vilarem MJ (2001) Dual effect of dexamethasone on CYP3A4 gene
expression in human hepatocytes. Sequential role of glucocorticoid receptor
and pregnane X receptor. Eur J Biochem
268:
63466358.[Medline]
Piipari R, Savela K, Nurminen T, Hukkanen J, Raunio H, Hakkola J,
Mantyla T, Beaune P, Edwards RJ, Boobis AR, et al. (2000)
Expression of CYP1A1, CYP1B1 and CYP3A and polycyclic aromatic hydrocarbon-DNA
adduct formation in bronchoalveolar macrophages of smokers and non-smokers.
Int J Cancer 86:
610616.[CrossRef][Medline]
Raunio H, Husgafvel-Pursiainen K, Anttila S, Hietanen E, Hirvonen
A, and Pelkonen O (1995) Diagnosis of polymorphisms in
carcinogen-activating and inactivating enzymes and cancer
susceptibilitya review. Gene (Amst)
159:
113121.[CrossRef][Medline]
Roberts-Thomson SJ, McManus ME, Tukey RH, Gonzalez FF, and Holder
GM (1993) The catalytic activity of four expressed human
cytochrome P450s towards benzo[a]pyrene and the isomers of its proximate
carcinogen. Biochem Biophys Res Commun
192:
13731379.[CrossRef][Medline]
Schuetz JD, Schuetz EG, Thottassery JV, Guzelian PS, Strom S, and
Sun D (1996) Identification of a novel dexamethasone responsive
enhancer in the human CYP3A5 gene and its activation in human and rat liver
cells. Mol Pharmacol 49:
6372.[Abstract]
Shimada T, Martin MV, Pruess-Schwartz D, Marnett LJ, and Guengerich
FP (1989) Roles of individual human cytochrome P-450 enzymes in
the bioactivation of benzo[a]pyrene, 7, 8-dihydroxy-7,
8-dihydrobenzo[a]pyrene and other dihydrodiol derivatives of
polycyclic aromatic hydrocarbons. Cancer Res
49:
63046312.
Shimada T, Yun CH, Yamazaki H, Gautier JC, Beaune PH, and
Guengerich FP (1992) Characterization of human lung microsomal
cytochrome P-450 1A1 and its role in the oxidation of chemical carcinogens.
Mol Pharmacol 41:
856864.[Abstract]
Shou M, Korzekwa KR, Crespi CL, Gonzalez FJ, and Gelboin HV
(1994) The role of 12 cDNA-expressed human, rodent and rabbit
cytochromes P450 in the metabolism of benzo[a]pyrene and benzo[a]pyrene
trans-7, 8dihydrodiol. Mol Carcinog
10:
159168.[Medline]
Waxman DJ, Lapenson DP, Aoyama T, Gelboin HV, Gonzalez FJ, and
Korzekwa K (1991) Steroid hormone hydroxylase specificities of
eleven cDNA-expressed human cytochrome P450s. Arch Biochem
Biophys 290:
160166.[CrossRef][Medline]
Wrighton SA, Brian WR, Sari MA, Iwasaki M, Guengerich FP, Raucy JL,
Molowa DT, and Vandenbranden M (1990) Studies on the expression
and metabolic capabilities of human liver cytochrome P450IIIA5 (HLp3).
Mol Pharmacol 38:
207213.[Abstract]
Yamazaki H, Inui Y, Wrighton SA, Guengerich FP, and Shimada T
(1995) Procarcinogen activation by cytochrome P450 3A4 and 3A5
expressed in Escherichia coli and by human liver microsomes.
Carcinogenesis 16:
21672170.
This article has been cited by other articles:
![]() |
M. Volotinen, J. Maenpaa, E. Kankuri, O. Oksala, O. Pelkonen, M. Nakajima, T. Yokoi, and J. Hakkola Expression of Cytochrome P450 (CYP) Enzymes in Human Nonpigmented Ciliary Epithelial Cells: Induction of CYP1B1 Expression by TCDD Invest. Ophthalmol. Vis. Sci., July 1, 2009; 50(7): 3099 - 3105. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Song and W. A. Miller Diffuse exanthema in a patient receiving varenicline Am. J. Health Syst. Pharm., July 1, 2008; 65(13): 1239 - 1241. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Biggs, J. Wan, N. S. Cutler, J. Hakkola, P. Uusimaki, H. Raunio, and G. S. Yost Transcription Factor Binding to a Putative Double E-Box Motif Represses CYP3A4 Expression in Human Lung Cells Mol. Pharmacol., September 1, 2007; 72(3): 514 - 525. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-M. Moilanen, J. Hakkola, M. H. Vaarala, S. Kauppila, P. Hirvikoski, J. T. Vuoristo, R. J. Edwards, and T. K. Paavonen Characterization of androgen-regulated expression of CYP3A5 in human prostate Carcinogenesis, May 1, 2007; 28(5): 916 - 921. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Pearce, J. S. Leeder, and G. L. Kearns BIOTRANSFORMATION OF FLUTICASONE: IN VITRO CHARACTERIZATION Drug Metab. Dispos., June 1, 2006; 34(6): 1035 - 1040. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Poch, N. S. Cutler, G. S. Yost, and R. N. Hines MOLECULAR MECHANISMS REGULATING HUMAN CYP4B1 LUNG-SELECTIVE EXPRESSION Drug Metab. Dispos., August 1, 2005; 33(8): 1174 - 1184. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hukkanen, P. Jacob III, and N. L. Benowitz Metabolism and Disposition Kinetics of Nicotine Pharmacol. Rev., March 1, 2005; 57(1): 79 - 115. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Burk, I. Koch, J. Raucy, E. Hustert, M. Eichelbaum, J. Brockmoller, U. M. Zanger, and L. Wojnowski The Induction of Cytochrome P450 3A5 (CYP3A5) in the Human Liver and Intestine Is Mediated by the Xenobiotic Sensors Pregnane X Receptor (PXR) and Constitutively Activated Receptor (CAR) J. Biol. Chem., September 10, 2004; 279(37): 38379 - 38385. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Williams, J. Cook, and S. I. Hurst A SIGNIFICANT DRUG-METABOLIZING ROLE FOR CYP3A5? Drug Metab. Dispos., December 1, 2003; 31(12): 1526 - 1530. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||