![]() |
|
|
Vol. 303, Issue 3, 1334-1343, December 2002
Isis Pharmaceuticals Inc., Carlsbad, California (K.L.S., R.S.G., B.F.B., J.M.G., R.Z.Y., J.A.T., F.A.D.); and Guy's Drug Research Unit Ltd., London, United Kingdom (T.G.K.M.)
| |
Abstract |
|---|
|
|
|---|
ISIS 104838 is a 20-mer phosphorothioate antisense
oligonucleotide (ASO) that binds tumor necrosis factor-
(TNF-
)
mRNA. It carries a 2'-methoxyethyl modification on the five 3' and 5' nucleotide sugars, with 10 central unmodified deoxynucleotides. ISIS
104838 was identified from a 264 ASO screen in phorbol myristate acetate-activated keratinocytes, and the dose response was
assessed in lipopolysaccharide (LPS)-activated monocytes. Healthy males received multiple intravenous (i.v.) ISIS 104838 infusions in a
placebo-controlled dose escalation trial (0.1-6 mg/kg). Additional volunteers received single or multiple subcutaneous (s.c.) injections. ISIS 104838 suppressed TNF-
protein by 85% in stimulated
keratinocytes. The IC50 for TNF-
mRNA inhibition in
stimulated monocytes was <1 µM. For i.v.,
Cmax occurred at the end of infusion. The
effective plasma half-life was 15 to 45 min at 0.1 to 0.5 mg/kg and 1 to 1.8 h for higher doses. The apparent terminal plasma
elimination half-life approximated 25 days. Obese subjects had higher
plasma levels following equivalent mg/kg doses. For s.c. injections, Cmax occurred at 2 to 4 h and was lower
than with equivalent i.v. dosing. Plasma bioavailability compared with
i.v. was 82% following a 200 mg/ml s.c. injection. Transient activated
partial thromboplastin time prolongation occurred after i.v. infusions
and minimally after s.c. injections. Two subjects experienced rash, one
a reversible platelet decrease, and mild injection site tenderness was
noted. TNF-
production by peripheral blood leukocytes, induced ex
vivo by LPS, was decreased by ISIS 104838 (p < 0.01). ISIS 104838, a second-generation antisense oligonucleotide, was
generally well tolerated intravenously and subcutaneously. The
pharmacokinetics support an infrequent dosing interval. Inhibition of
TNF-
production ex vivo was demonstrated.
| |
Introduction |
|---|
|
|
|---|
Tumor
necrosis factor-
(TNF-
) is a pleiotropic cytokine that signals
through multiple kinase pathways to regulate gene expression and a wide
range of cellular processes. TNF-
overproduction is implicated in
many inflammatory diseases (Beutler, 1999
). Rheumatoid arthritis
treatment has been advanced by TNF-
inhibitors (Maini et al., 1998
,
1999
; Moreland et al., 1999
; Weinblatt et al., 1999
; Bathon et al.,
2000
; Lipsky et al., 2000
; Schattenkirchner et al., 2000
; Van de Putte
et al., 2000
), as TNF-
plays a pivotal role in both rheumatoid
inflammation (Choy and Panayi, 2001
) and the erosion of adjacent bone
(Tak and Bresnihan, 2000
). TNF-
inhibitors are additionally
indicated for the induction and maintenance of remission, and fistula
closure in Crohn's disease (Targan et al., 1997
; Present et al.,
1999
).
ISIS 104838 is a 20-base phosphorothioate (PS) oligonucleotide
identified through cell-based screening. In addition to the PS
modification, ISIS 104838 contains 2'-O-(2-methoxyethyl)
modified (2'-MOE) nucleosides at each of the five terminal 3' and 5'
nucleotide sugars, and is considered a second generation "chimeric"
chemistry. The central ten PS oligonucleotides are unmodified 2'
deoxyribose nucleotides and are termed the "gap" (Dean et al.,
2001
). Antisense oligonucleotides hybridize to their target messenger
RNA (mRNA) through Watson-Crick base pair interactions, offering a very
high level of target specificity. The mRNA in a RNA:DNA duplex is
cleaved by the ubiquitous nuclease RNase H (Crooke, 1999
). This
function is effectively supported by the ten deoxyribonucleotides
within the central gap, but not by the 2'-MOE modified nucleotides
(Baker and Monia, 1999
). The 2'-MOE modified nucleotides increase
binding affinity for the target mRNA and resist endogenous
exonucleases, thereby prolonging drug half-life (Bennett et al., 2000
;
Henry et al., 2000
; Yu et al., 2001
).
We performed two phase I trials evaluating the safety and pharmacokinetics of ISIS 104838 by i.v. or s.c. administration, representing the first report of human administration of a 2'-MOE modified antisense oligonucleotide. An ex vivo analysis of efficacy was also performed following i.v. dosing.
| |
Materials and Methods |
|---|
|
|
|---|
Identification and Characterization of ISIS 104838
Oligonucleotide screening was performed using neonatal human
epidermal keratinocytes (Cascade Biologics, Portland, OR) seeded at
nonconfluence in 96-well plates (Becton Dickinson, Franklin Lakes, NJ).
Cells were treated with oligonucleotides at 200 nM in 6 µg/ml
Lipofectin (Invitrogen, Carlsbad, CA) for 4 h at 37°C. Medium
was replaced and cells were incubated for 2 h in the presence or
absence of 100 nM phorbol myristate acetate (PMA) (Sigma-Aldrich, St.
Louis, MO). Poly A+ RNA was isolated from cell lysates using a
5'-biotin-labeled 2'-MOE modified oligonucleotide
(U)20 capture probe in combination with a
NeutrAvidin capture plate (Pierce, Rockford IL). TNF-
mRNA was
measured by real-time quantitative RT-PCR on the ABI Prism 7700 system
(Applied Biosystems Inc., Foster City, CA) as recommended by the
manufacturer (Gibson et al., 1996
; Winer et al., 1999
).
A dose response analysis was performed in keratinocytes treated with
oligonucleotides at 30, 100, or 300 nM with Lipofectin for 4 h at
37°C. Medium was replaced and cells incubated in the presence or
absence of 100 nM PMA for 12 h; then medium was collected for
quantitation of TNF-
protein by ELISA (TNF-
DuoSet kit, R&D
Systems, Minneapolis, MN).
ISIS 104838 activity and specificity were evaluated in human THP-1 monocytic cells (American Type Culture Collection, Manassas VA). Cells were transfected with oligonucleotide by eletroporation (BTX Electro Cell Manipulator 600, San Diego CA) and then recovered in RPMI-1640 medium with 10% fetal bovine serum (Invitrogen) for 5 h at 37°C. Lipopolysaccharide (LPS) at 100 ng/ml was added for 2 h. Total RNA was isolated using a RNeasy MiniKit (QIAGEN, Valencia, CA) and specific mRNA levels were determined by real-time RT-PCR.
Primers and probes used for real-time RT-PCR analysis were designed
using the Primer Express software (Applied Biosystem Inc.). Relative
amounts of target mRNA per well were determined by the standard curve
method (Winer et al., 1999
). G3PDH mRNA levels were used as an internal standard.
Drug Product
ISIS 104838 is a racemic mixture. The percentage of full length ISIS 104838 in the drug product was 93.2%, with the major impurity consisting of n-1 deletion sequences (1.8%), and 94% of the full-length oligonucleotide was fully thioated. Dosing was performed based on the quantity of full-length 20-mer. ISIS 104838 for i.v. infusion was provided by Isis Pharmaceuticals, Inc., as an isotonic, sterile 10 mg/ml solution in phosphate-buffered saline (pH 7.6). The injectates were within specified limits for bacterial endotoxin (<5 endotoxin units/ml for the 10 mg/ml, and <100 endotoxin units/ml for the 200 mg/ml solutions). The i.v. drug or placebo (0.9% saline) was administered by 1 h infusion in 100 ml of sterile 0.9% saline. The research pharmacist was not blinded.
ISIS 104838 for s.c. injection was provided by Isis Pharmaceuticals, Inc. as a 200 mg/ml solution in sterile water, adjusted with hydrochloric acid and sodium hydroxide to pH 7.4. The drug product lot was identical to that utilized for infusions. For single dose subjects, the drug was administered in a single 1-ml injection using rising ISIS 104838 concentrations of 25 to 200 mg/ml, diluted as necessary with sterile 0.9% saline by the research pharmacist, who was not blinded. The multiple dose subjects received varying volumes of the ISIS 104838 200 mg/ml solution to achieve a total dose of 0.1 to 6 mg/kg. The maximum injection volume was 1 ml; therefore, some subjects received two or three injections to achieve their calculated dose. All injections were administered s.c. using a 27-gauge needle into the abdominal wall in a rotational schema. The placebo was sterile 0.9% saline with riboflavin to provide appropriate color in matching vials.
Subjects
Healthy males aged 18 to 45 years were dosed at Guy's Drug Research Unit (GDRU), with local ethics committee approval, and the studies were carried out in accordance with the Declaration of Helsinki. Subjects underwent full medical history, physical examination, and laboratory testing including drug screens, hepatitis A, B, C, and human immunodeficiency virus I/II testing. Subjects were admitted the night before treatment after abstaining from alcohol for 72 h and remained on the unit for 24 h following every dose. They received a light breakfast at least 1 h prior to dosing and refrained from smoking, caffeine-containing drinks, and grapefruit juice for 1 h before and 12 h following each dose. They remained recumbent, with continuous EKG recording, for 4 h following the completion of each infusion or injection.
ISIS 104838 Schedule
Intravenous Dosing.
Four volunteers were recruited into each
i.v. cohort, receiving doses of 0.1, 0.5, 1, 2, 4, or 6 mg/kg on days
1, 8, 10, and 12. One subject in each cohort was randomly assigned to
receive placebo. Dose escalation was made at intervals of at least 1 week, after an assessment of safety for the previous cohort. An
additional obese cohort of two subjects subsequently received 2 mg/kg
dosing. These subjects weighed more than 10% above ideal body weight
(ideal body weight = 48 + 1.1 kg for every centimeter in height
over 152 cm) and had
25% body fat by the Harpenden skinfold caliper method. Body mass index was calculated by weight (kg)/height
(m)2; by the National Institutes of Health
guidelines obesity is defined as body mass index
30.
2 mg/kg), excluding the obese subjects, had additional samples
through day 106. Samples were collected in EDTA tubes, and plasma was
harvested. Urine for pharmacokinetics was collected for the first
24 h in four interval aliquots containing hours 0 to 2, 2 to 4, 4 to 8, and 8 to 24. Urine and plasma were stored at
70°C before analysis.
Heparinized blood samples for an analysis of ex vivo production of
TNF-
, interleukin (IL)-1
and IL-6 were obtained before dosing on
day 1, and at 24 h after the final day 12 dose.
Subcutaneous Dosing. In the single dose trial, four volunteers were recruited into each of four cohorts, and received a single 1-ml injection at a concentration of 25, 50, 100, or 200 mg/ml. One subject in each cohort was randomly assigned to placebo. Dose escalation was made at intervals of at least 1 week, after assessment of safety for the previous cohort. The single doses were evaluated prior to selecting the 200 mg/ml ISIS 104838 concentration for the multidose cohorts. In these cohorts, four volunteers were recruited into each of six cohorts, and received 0.1, 0.5, 1, 2, 4, or 6 mg/kg s.c. on days 1, 3, and 5. One subject in each cohort was randomly assigned to placebo.
Intensive pharmacokinetic blood sampling occurred for 24 h following the single doses. Additional samples were drawn on days 4 and 7. Urine for pharmacokinetics was collected for the first 24 h in four interval aliquots containing hours 0 to 2, 2 to 4, 4 to 8, and 8 to 24. The multiple dose subjects had pre-, 1-, and 3-h postdose samples drawn on days 1, 3, and 5, and additional samples on days 6, 11, and 14. Urine and plasma were stored at
70°C prior to analysis.
Safety Monitoring
In both studies, safety labs included hematology, blood chemistry, urinalysis, coagulation (aPTT, PT, and international normalized rate) and complement split product (C3a). Blood pressure and heart rate were monitored before dosing and at intervals after dosing. All laboratory tests, including virology and drug screens, were performed at GDRU. Local side effects at injection sites were assessed at 2, 12, and 24 h, and on days 4 and 7 after the single s.c. injections. The multidose subjects had an evaluation of injection sites at 2, 12, and 24 h with each injection, and on days 11 and 14.
The two i.v. subjects who developed rashes had total IgE levels and
viral titers (IgM and IgG) assayed for cytomegalovirus, mumps, measles,
herpes simplex virus type 1, herpes simplex virus type 2, and
Epstein-Barr virus (including Epstein-Barr nuclear antigen) using
plasma obtained following treatment cessation. These tests, and an
erythrocyte sedimentation rate for one of the subjects, were performed
at GDRU. Plasma cytokine levels using frozen EDTA plasma samples for
these subjects were also assayed on day 1 prior to treatment and again
following the completed infusion on day 8 (Huntingdon Life Sciences,
Huntingdon, UK) by Quantitine ELISA kits (R&D Systems Europe, Abingdon,
UK). The lower limit of detection for TNF-
was 31.2 pg/ml (kit
DTA50), 7.8 pg/ml for IL-1
(kit DLB50), and 6.25 pg/ml for IL-6 (kit D6050).
Ex Vivo Analysis of Cytokine Production
Whole blood drawn in a lithium heparin tube was cultured for
each i.v. subject at GDRU in a 24-well plate. The assay was performed with a predosing sample and a second sample from 24 h after the final day 12 infusion. Samples (8 duplicates; 10 ml each) were incubated at 38°C with agitation for 4 h in the presence of LPS (Sigma-Aldrich), at a final concentration of 0, 0.1, 1.0, and 10 ng/ml
in Hanks' balanced salt solution (Invitrogen). Cell-free supernatants
were pooled, frozen at
80°C and shipped to Huntingdon Life
Sciences, where they were assayed using the ELISA kits. Validation assays confirmed no assay interference by ISIS 104838. Standards were
assayed in duplicate and samples were assayed once at each dilution.
The day 13 data were expressed as a percentage of the day 1 control results.
ISIS 104838 Pharmacokinetics
Plasma concentrations were measured at Isis Pharmaceuticals,
Inc. by a hybridization-dependent nuclease ELISA method (lower limit of
quantitation = 0.77 ng/ml, with a 25% coefficient of variation).
Plasma was aliquoted into wells containing a complementary 20-oligomer
hybridization probe. The quality control (QC) standards run with each
ELISA were duplicates of three known ISIS 104838 concentrations (low,
medium, and high), in drug-free plasma samples (accuracy 100 ± 20%
and precision
20% for all concentrations above the lower limit of
quantitation). Stability of storage and handling conditions were fully
evaluated for up to 6 months. The assay was validated in accordance
with FDA guidelines. Negative controls (ISIS 104838 mismatches and
metabolites) were used for validation of assay selectivity and
specificity but were not run concurrently. Cross reactivity was less
than 1% for mismatches and metabolites.
Day 1 ISIS 104838 plasma levels were also measured at Isis
Pharmaceuticals, Inc. by capillary gel electrophoresis (CGE) as previously described (lower limit of quantitation = 0.154 µg/ml, with a 25% coefficient of variation) (Leeds et al., 1996
). QC standards of ISIS 104838 in drug-free reference plasma samples were run
with each assay.
Urinary concentrations were measured at Isis Pharmaceuticals, Inc. by a CGE assay (lower limit of detection = 0.039 µg/ml, with a 25% coefficient of variation) as described above. Calibration standards and three QC standards were prepared in drug-free urine containing known amounts of ISIS 104838.
ISIS 104838 metabolites in urine were analyzed by CGE. CGE peak areas
were normalized using the following equation:
nA2 = (A2/Tm2)
(A1/Tm1),
where nA2 = normalized peak area of
analyte; A2 = peak area of analyte;
Tm2 = CGE migration time of analyte; A1 = peak area of internal standard;
and Tm1 = CGE migration time of
internal standard. Normalized peak areas of calibration standards were
regressed linearly (using 1/x weighting) to define the peak response-concentration relationship. Concentrations of ISIS 104838 in
plasma and urine were determined from matrix-specific calibration curves. Concentrations of major metabolites (n-8 to n-12) were also
calculated and normalized using the extinction coefficients for
standard oligonucleotides of equivalent length.
Area under the plasma concentration-time curve (AUC) was calculated
using the linear trapezoidal rule. For s.c. dosing, the apparent
distribution half-life (t1/2) was
calculated using 0.693/Kdistribution (K = elimination rate constant). For i.v. dosing, volume of
distribution at steady-state (VSS) and
mean residence time (MRT) were calculated using statistical moment
theory, and the effective plasma disposition half-life
(t1/2eff) was estimated using MRT
multiplied by 0.693 (Perrier, 1982
). The first-order rate of
disposition from plasma (
Z) during the
apparent terminal phase was estimated using nonlinear regression
analysis (WinNonlin, version 3.1) (Pharsight, Mountain View, CA) on the
last three or more samples following drug administration. The apparent
terminal disposition half-life from plasma was estimated using
(0.693/
Z). AUC was extrapolated to infinity by
dividing the final measurable concentration
(Clast) by the slope of the disposition curve (
Z). Plasma clearance (CL)
was calculated (dose/AUC).
The amount of ISIS 104838 excreted during the first 24 h after dosing was calculated by multiplying the total oligonucleotide or intact 20-mer ISIS 104838 concentrations in each urinary aliquot with the volume and summing all collection period results. The fraction of the administered dose that was excreted was calculated by dividing the total amount of oligonucleotide in urine by the total administered dose.
Compartmental modeling was performed for all i.v. subjects with plasma
monitoring through 94 days after the final dose (WinNonlin, version
3.1). One-, two-, and three-compartment models were evaluated. The
apparent terminal elimination half-life was determined by dividing
0.693 (ln(2)) by the apparent terminal elimination rate constant
(
Z).
Statistical Analysis
Placebo and treated subjects were compared for laboratory and safety parameters using a two-tailed Student's t test. Differences in pharmacokinetic parameters for the individual dose cohorts were compared using an unpaired two-tailed Student's t test.
LPS-stimulated ex vivo cytokine production was compared for each patient before and after ISIS 104838 treatment. The trend for the ISIS 104838 dose effect was evaluated by calculating a slope for each subject's cytokine production on day 1, stimulated by placebo or one of three LPS concentrations. This slope was compared with the slope for the subject's cytokine production curve on day 13. The difference of the two slopes, and the difference in AUC below each of the two slopes, was correlated to ISIS 104838 dose level using a simple regression.
| |
Results |
|---|
|
|
|---|
Identification of ISIS 104838
ISIS 104838 was identified in a screen of 264 phosphorothioate
2'-MOE modified chimeras, 20 nucleotides in length, which spanned TNF-
mRNA. A 10 nucleotide 2'-deoxy gap was used to maximize RNase H
activity, and to concomitantly maximize the target mRNA affinity as
well as the nuclease resistance provided by the 2'-MOE modifications
(McKay et al., 1999
; Wu et al., 1999
; Zhang et al., 2000
). The ISIS
104838 sequence is GCTGATTAGAGAGAGGTCCC
(2'-MOEs underlined). This sequence shows no full homology for other
mRNA in the NCBI human genome sequence database. All cytosines were 5'-methylated to minimize lymphocyte mitogenicity (Boggs et al., 1997
).
Dose response analysis showed ISIS 104838 to be the most potent
inhibitor of TNF-
in PMA-activated keratinocytes, reducing secreted
TNF-
protein levels at 300 nM to 15% of the levels produced in the
absence of oligonucleotide (Fig. 1). The
location of the 10 nucleotide 2'-deoxy gap was optimized by
repositioning the gap, in one base increments, while maintaining a
constant nucleotide sequence. The 5-10-5 MOE structure of ISIS 104838 provided the most complete suppression of TNF-
protein production.
ISIS 104838 showed an IC50 value <1 µM for
inhibition of TNF-
mRNA in LPS-activated THP-1 monocytic cells (Fig.
2). This response was sequence-specific. A control oligonucleotide with five mismatches for the human TNF-
gene did not reduce TNF-
mRNA levels. In addition, ISIS 104838 had a
minimal effect on IL-1
mRNA production, confirming that ISIS 104838 was selective for TNF-
(Fig. 2).
|
|
Subjects
Twenty-six males (23 Caucasian, 1 Hispanic, 1 Black, 1 mixed race) aged 18 to 44 (mean 26.7 ± 6.4 years) enrolled in the i.v. trial. The 24 nonobese subjects weighed 59.8 to 86.9 kg (mean 74.9 ± 7.0 kg) and had an ideal body weight (IBW) of 61.2 to 89.8 kg (mean 75.7 ± 7.1 kg); three subjects were minimally above IBW + 10%. The two obese subjects weighed 121.1 and 134.9 kg, with IBW of 73.3 and 86.5 kg, and body mass indexes of 39.5 and 38.6. Sixteen (15 Caucasian, 1 mixed race) males aged 19 to 33 enrolled in the s.c. single dose trial. Twenty-four (23 Caucasian, 1 mixed race) males aged 21 to 35 enrolled in the s.c. multidose trial. The s.c. patients had a mean age of 25.4 (± 4.3) years, weighed 55.5 to 88.7 kg (mean 72.8 ± 7.1 kg), and had an IBW range of 59 to 86.5 kg (mean 74.5 ± 6.0 kg); 6 subjects were minimally outside IBW ± 10%. Three subjects were withdrawn by the investigator after two doses for safety considerations (one each at 4 mg/kg i.v. and 6 mg/kg i.v., and one at 6 mg/kg s.c.).
Safety
Transient and reversible aPTT prolongation was observed at the
completion of the higher dose i.v. infusions and, to a much lesser
degree, following the highest dose s.c. injections. The maximum aPTT
change occurred at the end of each infusion (EOI) and averaged 5, 7, 11, 27, and 33 s, respectively, for 0.5 mg/kg to 6 mg/kg dose
cohorts. Transient aPTT prolongation after i.v. infusions correlated
linearly with the maximal plasma concentration (Cmax) at EOI, occurring at a rate of
0.63 s of aPTT prolongation per 1 µg/ml increment in
Cmax (r = 0.94 by
Pearson correlation). This resolved within 2 to 4 h after EOI at
2 mg/kg and by 5 h after EOI for the 4 and 6 mg/kg subjects
(Fig. 3). There was no evidence of
compromised hemostasis. There were no detectable aPTT changes following
s.c. injections below 2 mg/kg. The maximum aPTT change occurred at
3 h following a 2, 4, or 6 mg/kg injection and averaged 3, 3.7, and 7.8 s, respectively. There were corresponding PT changes for
i.v. infusions at
2 mg/kg, peaking with an average PT prolongation of
3.8 s following a 6 mg/kg infusion. There were no dose-related
changes in C3a.
|
No serious or severe adverse events were reported. The two i.v.
subjects that received only two doses developed dyshidrotic eczema with
moderate knee arthralgia (4 mg/kg dose) in one case, and palmar
erythema with mild skin peeling (6 mg/kg dose) in the other case. The
subject with arthralgia had an erythrocyte sedimentation rate of
3 at 9 days following the final ISIS 104838 dose. These two subjects
had normal baseline and day 8 post-treatment plasma levels of IL-6,
IL-1
, and TNF-
. Total IgE levels were normal and viral antibody
titers were negative or IgG (no IgM) when tested on day 10 for one and
on day 21 for the other. The one s.c. subject who received only two
doses experienced a reversible platelet decrease from 191 to 113 × 10
9/liter. No particular adverse event
occurred with disproportionate frequency after active treatment, and
all reported adverse events were mild with the exception of the
arthralgia. Headache was the most commonly reported adverse event and
was considered possibly related to ISIS 104838 in one i.v. subject and
in two cases with onset at 6 to 7 h following a s.c. injection.
Skin injection sites showed some mild tenderness, erythema or induration, typically developing at 12 to 24 h and resolving by 4 days post dosing. This was more prominent with the 200 mg/ml concentration and 6 mg/kg injections. No subject developed local adenopathy. One subject incorrectly received a 4 mg/kg s.c. dose in a volume of 1.8 ml at a single abdominal location, without complication.
No changes in EKGs or vital signs were observed. The median percent change from baseline in laboratory safety variables revealed no dose-related differences between drug and placebo-treated subjects, with the exception of the described aPTT changes.
Pharmacokinetics
Intravenous Dosing.
Peak plasma concentrations
(Cmax) following i.v. infusions were
seen at the EOI and were dose-proportional over the studied dose range
(Table 1). There was minimal variability
between subjects at a single dose. Plasma concentrations decreased
rapidly after EOI (Fig. 4). By 4 to
6 h after EOI, plasma concentrations were 10- to 20-fold lower.
There were no shortened oligonucleotide metabolites observed in plasma
by the 2-h time point, and minimal evidence of metabolites in the 0- to
2-h urinary aliquot, suggesting that ISIS 104838 is metabolically
stable prior to cellular uptake.
|
|
|
|
Subcutaneous Dosing.
Following a single s.c. injection, the
time to Cmax
(Tmax) ranged between 1.5 and 4.7 h, depending upon dose and concentration (Table
2). Cmax
was dose-proportional over the studied dose range. Plasma
concentrations decreased to 10- to 20-fold lower than
Cmax by 12 h after an injection.
|
|
|
Stimulated Cytokine Production ex Vivo
The level of TNF-
production following LPS stimulation ex vivo
was diminished for each cohort in a dose-dependent manner following
treatment with ISIS 104838 (Fig. 9).
Spontaneous baseline TNF-
production without LPS stimulation was
detected in only one subject. One subject's day 13 sample was clotted,
and the assay was not performed. Labeling errors appeared to reverse
the ascending LPS concentration in two 1 mg/kg subjects (lowest TNF-
production after LPS 10 ng/ml; highest production after no LPS), and
these two subjects were excluded from the analysis.
|
Each subject's LPS-stimulated TNF-
production on day 13 was
expressed as a percentage of the pretreatment day 1 value. Variability for the assay was observed in the LPS-stimulated cultures, without study drug treatment. On day 13, placebo subjects ranged from 26 to
260% (mean 118%) of basal levels after 1 ng/ml LPS stimulation, and
from 19 to 109% (mean 78%) of basal levels after 10 ng/ml LPS stimulation.
In the 6 mg/kg ISIS 104838 cohort, TNF-
levels were an average 43 and 55% lower than levels for placebo patients, respectively, following 1 and 10 ng/ml LPS stimulation. The dose-ranging effect of
increasing ISIS 104838, across all levels of LPS stimulation (0, 0.1, 1, and 10 ng/ml), showed a significant inhibition of TNF-
production
(p = 0.0087 by mixed effect model). A comparison of
area under the curve for the day 1 and day 13 curves also showed a
significant decrease in TNF-
production with increasing ISIS 104838 dose (p = 0.0056).
The effect of ISIS 104838 on the ex vivo production of IL-6 and IL-1
was evaluated. LPS increased both IL-6 and IL-1
levels. There was a
trend for decreasing IL-6 production (p = 0.09) but no
decrease in IL-1
with increasing ISIS 104838 dose.
| |
Discussion |
|---|
|
|
|---|
This is the first report of a chimeric,
2'-O-(2-methoxyethyl)-modified phosphorothioate
oligonucleotide administered to human volunteers and overall supports
good tolerability by both s.c. and i.v. routes. The anticipated
advantages of this chemistry include greater potency, well tolerated
subcutaneous delivery, and greater stability allowing a less frequent
dosing interval (Dean et al., 2001
; Yu et al., 2001
). The antisense
approach to inhibiting gene expression at the mRNA level has recently
been reviewed (Stein, 2001
).
An assessment of pharmacologic effect was undertaken in these healthy
subjects, with nondetectable basal TNF-
levels, by evaluating their
peripheral blood leukocyte production of TNF-
after stimulation. The
level of TNF-
production following LPS coculture ex vivo was
diminished for each cohort in a dose-dependent manner following i.v.
treatment with ISIS 104838 (p < 0.01). Because the day
to day variability for individual placebo subjects was high in the
setting of LPS stimulation, this method can only provide an approximate
estimation of the physiologic effects. Future studies will be required
to evaluate the effect of ISIS 104838 in vivo in patients with
inflammatory conditions and pathological TNF-
elevations.
Significant exposure to ISIS 104838 was achieved with relatively small
pharmacokinetic variability at any dose level. Maximum plasma
concentrations were dose proportional and predictable. At the higher
i.v. doses, oligonucleotide distribution into tissues such as liver and
kidney becomes saturated, resulting in decreased plasma clearance rates
(Henry et al., 2001
). The plasma concentration-time profile showed a
rapid plasma distribution phase over the first 4 to 6 h and
subsequently at least one additional slower disposition phase. This
second phase may more directly reflect the true elimination rate of
ISIS 104838 as it exits the distributed tissues. Clearance and
half-life values from target tissues have not been evaluated in human
subjects, but would be anticipated from animal studies to show
significantly slower elimination rates (days versus hours) compared to
the plasma distribution rates (Bennett et al., 2000
; Levin et al.,
2001
; Yu et al., 2001
). Terminal elimination rate constants in plasma
supported a terminal half-life of approximately 14 to 25 days in this
study, similar to the tissue elimination half-lives determined in rats
and monkeys (10-30 days, depending on tissue). The longer terminal
elimination half-life observed at 6 mg/kg is likely due to the ability
to detect low ISIS 104838 concentrations in plasma at later time points.
Only a small fraction of the full-length parent drug was excreted in
urine following either route of administration, likely due to high
plasma protein binding, which minimizes renal loss (Dean et al., 2001
;
Geary et al., 2001b
). ISIS 104838 is ultimately excreted from the body
following endonuclease digestion and urinary excretion in mouse, rat,
and monkey (Cummins et al., 2001
; Geary et al., 2001a
), because the
shorter oligonucleotide metabolites have lower plasma protein binding
affinity. The data from these studies suggest a similar metabolism
profile for humans. Nevertheless, the residence time in tissue is long,
as evidenced by the long terminal elimination half-life. These
pharmacokinetic data support alternate week or monthly dosing, although
the residence half-life in specific tissues will vary, as the 14- to
25-day elimination half-life represents an integration of many organ
elimination curves (Yu et al., 2001
).
Obese subjects attained a higher Cmax
and AUC following 2 mg/kg i.v. dosing, compared with non-obese
subjects, most likely due to the limited distribution of
oligonucleotides into fat. Oligonucleotides are polar hydrophilic
molecules and distribute preferentially to lean body mass (Phillips et
al., 1997
). Dosing on an actual weight basis did not reflect the
patients' volume of distribution, which correlates with lean body
weight, and resulted in higher plasma levels compared with lean
subjects receiving the same 2 mg/kg dose. For more reproducible plasma
levels, it may be appropriate to dose by ideal body weight or with a
fixed ISIS 104838 dose.
Following s.c. injection, the apparent distribution half-life is
somewhat slower than with i.v. dosing due to the continued absorption
from the injection site during the distribution phase. The plasma
bioavailability of s.c. injected oligonucleotides has been shown to
underestimate the ultimate absorption and tissue availability in monkey
studies (Leeds et al., 2000
). The most likely explanation for the
discrepancy between plasma and tissue bioavailability estimates relates
to the rapid distribution from plasma into tissue, coupled with slow
absorption from the injection site. Additionally, a portion of the
absorption from the s.c. injection site in monkeys is via lymphatic
uptake, evidenced by high drug concentrations accumulating in draining
lymph nodes. Last, limitations in assay sensitivity have previously
prevented full evaluation of the plasma concentration curve following
s.c. injection. The hybridization ELISA method measuring ISIS 104838 in
plasma for this study was two orders of magnitude more sensitive than
the previous CGE assay. Regardless, the plasma bioavailability reported
here in human volunteers may still underestimate the total tissue
absorption of s.c. injected ISIS 104838, particularly for the lower
doses. Higher milligram per milliliter concentrations of s.c. ISIS
104838, and thus higher doses, result in higher net plasma
bioavailability. This phenomenon may be a consequence of a shift from
lymphatic to direct absorption into blood due to a saturation of the
lymphatic flow-limited uptake process. Additional studies will be
required to determine optimal concentration and volumes. Subcutaneous
injections at the highest concentration (200 mg/ml) were well tolerated
with mild tenderness and less commonly mild induration or erythema.
The lower Cmax following a s.c.
injection, compared with an equivalent i.v. dose, provided a greater
safety margin with regard to potential acute side effects related to
transient plasma protein binding. Reversible aPTT prolongation has been
previously reported with phosphorothioate oligodeoxynucleotides, due to
reversible protein binding of the intrinsic tenase complex, and is not
sequence-specific (Sheehan and Lan, 1998
; Sheehan and Phan, 2001
). The
amount of prolongation is similar between a phosphorothioate
oligodeoxynucleotide i.v. and this MOE gapmer. The mean aPTT
prolongation was 12.9 s, or a 56% increase over pretreatment,
following a 2-h infusion of the first generation phosphorothioate
oligonucleotide ISIS 2302 at 2 mg/kg (Glover et al., 1997
). This
compared with 10.7 s aPTT prolongation, or 36% increase over
pretreatment, following a 1 h infusion of ISIS 104838 at 2 mg/kg.
These findings appear to be attributable to the overall chemical class
and not to the specific antisense target. The transient aPTT change did
not compromise clinical hemostasis and was minimal following s.c.
injections. At high doses, particularly in preclinical studies,
complement activation has also been seen due to binding of complement
Factor H (Henry et al., 1997
, 2002
). There was no evidence for
complement activation in this trial following normal volunteer
treatment at a maximum MOE gapmer dose of 6 mg/kg.
Rashes were observed following i.v. administration but were not
definitively linked to ISIS 104838, because there was no evidence for
either cytokine release or IgE-mediated hypersensitivity. The transient
change in platelet count was minor (191 to 113 × 10
9/liter) and resolved the next day,
suggesting sequestration. Previous experience with first generation
oligonucleotides in rheumatoid arthritis patients showed treatment to
be well tolerated (Maksymowych et al., 2002
), and this initial
evaluation of a TNF-
antisense oligonucleotide will permit future
testing of ISIS 104838 in active rheumatoid arthritis patients.
| |
Acknowledgments |
|---|
We acknowledge John Matson, Alfred Chappell, and Jamie Powell for extensive technical assistance with quantitation of ISIS 104838 in plasma and urine, Shuting Xia for excellent statistical analysis, and Wanda Scheulke and Tracy Reigle for graphics support.
| |
Footnotes |
|---|
Accepted for publication September 10, 2002.
Received for publication April 15, 2002.
DOI: 10.1124/jpet.102.036749
Address correspondence to: Dr. K. Lea Sewell, Isis Pharmaceuticals, Inc., 2292 Faraday Ave., Carlsbad, CA 92008-7208. E-mail: klsewell{at}isisph.com
| |
Abbreviations |
|---|
TNF-
, tumor necrosis factor-
;
PS, phosphorothioate;
2'-MOE, 2'-methoxyethyl;
aPTT, activated partial
thromboplastin time;
PMA, phorbol myristate acetate;
LPS, lipopolysaccharide;
RT-PCR, reverse transcriptase polymerase chain
reaction;
GDRU, Guy's Drug Research Unit;
Cmax, maximal plasma concentration;
ELISA, enzyme-linked immunosorbent assay;
QC, quality control;
CGE, capillary
gel electrophoresis;
AUC, area under the plasma concentration-time
curve;
MRT, mean residence time;
CL, clearance;
IBW, ideal body weight;
EOI, end of infusion;
PT, prothrombin time.
| |
References |
|---|
|
|
|---|
for Crohn's disease.
N Engl J Med
337:
1029-1035This article has been cited by other articles:
![]() |
N. Goebl, B. Berridge, V. J. Wroblewski, and P. L. Brown-Augsburger Development of a Sensitive and Specific in Situ Hybridization Technique for the Cellular Localization of Antisense Oligodeoxynucleotide Drugs in Tissue Sections Toxicol Pathol, June 1, 2007; 35(4): 541 - 548. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Z. Yu, T.-W. Kim, A. Hong, T. A. Watanabe, H. J. Gaus, and R. S. Geary Cross-Species Pharmacokinetic Comparison from Mouse to Man of a Second-Generation Antisense Oligonucleotide, ISIS 301012, Targeting Human Apolipoprotein B-100 Drug Metab. Dispos., March 1, 2007; 35(3): 460 - 468. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Swayze, A. M. Siwkowski, E. V. Wancewicz, M. T. Migawa, T. K. Wyrzykiewicz, G. Hung, B. P. Monia, and a. C. F. Bennett Antisense oligonucleotides containing locked nucleic acid improve potency but cause significant hepatotoxicity in animals Nucleic Acids Res., January 28, 2007; 35(2): 687 - 700. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Geary, R. Z. Yu, T. Watanabe, S. P. Henry, G. E. Hardee, A. Chappell, J. Matson, H. Sasmor, L. Cummins, and A. A. Levin PHARMACOKINETICS OF A TUMOR NECROSIS FACTOR-{alpha} PHOSPHOROTHIOATE 2'-O-(2-METHOXYETHYL) MODIFIED ANTISENSE OLIGONUCLEOTIDE: COMPARISON ACROSS SPECIES Drug Metab. Dispos., November 1, 2003; 31(11): 1419 - 1428. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||