![]() |
|
|
Vol. 303, Issue 2, 487-496, November 2002
Division of Pharmaceutical Sciences, College of Pharmacy (J.A., P.J.M.), and Department of Pediatrics (X.L., J.A.M.), University of Kentucky, Lexington, Kentucky
| |
Abstract |
|---|
|
|
|---|
Transporter-mediated processes in the lactating mammary gland may explain the significant accumulation of certain drugs in breast milk. The purpose of this study was to identify potential candidate drug transport proteins involved in drug accumulation in milk. Quantitative reverse transcription-polymerase chain reaction methods were developed to determine the relative RNA levels of 30 different drug transporter genes. Transporter gene RNA levels in lactating mammary epithelial cells (MEC) purified from pooled fresh breast milk samples were compared with levels in nonlactating MEC, liver, and kidney tissue. Transcripts were detected in lactating MEC for OCT1, OCT3, OCTN1, OCTN2, OATP-A, OATP-B, OATP-D, OATP-E, MRP1, MRP2, MRP5, MDR1, CNT1, CNT3, ENT1, ENT3, NCBT1, PEPT1, and PEPT2. No transcripts were detected for OCT2, OAT1, OAT2, OAT3, OAT4, OATP-C, MRP3, MRP4, CNT2, ENT2, and NCBT2. Lactating MEC demonstrated more than 4-fold higher RNA levels of OCT1, OCTN1, PEPT2, CNT1, CNT3, and ENT3, and more than 4-fold lower RNA levels of MDR1 and OCTN2 relative to nonlactating MEC. Lactating MEC showed significantly higher RNA levels of CNT3 relative to liver and kidney, increased PEPT2 RNA levels relative to liver, and increased OATP-A RNA levels relative to kidney. These data imply CNT3 may play a specialized role in nucleoside accumulation in milk and may identify an important role for PEPT2 and OATP-A transporters at the lactating mammary epithelium. Furthermore, transporters expressed in lactating MEC identify a potential role for these transporters in drug disposition at the mammary gland.
| |
Introduction |
|---|
|
|
|---|
Drugs
present in human breast milk may pose a significant exposure risk to a
nursing infant. Infant pharmacokinetics and the concentration of drug
in breast milk are the two most critical determinants of the extent and
risk of infant drug exposure with breastfeeding. All drugs appear in
the breast milk. Further, in the first months of life, infants have a
reduced capacity to eliminate drugs. These two characteristics have
heightened the concern over maternal drug exposures while
breastfeeding. Despite guidelines concerning drug indications and
contraindications during breastfeeding (American Academy of Pediatrics
Committee on Drugs, 2001
), the data on drug transfer into breast milk
and the risk of exposure to the nursing infant remain sparse. The
present study focuses on active processes governing drug accumulation
into breast milk as a critical determinant of infant drug exposure.
Passive transport processes principally govern the transfer of many
drugs into breast milk. In vitro models of passive drug transfer
identify drug protein binding, drug ionization, and fat partitioning as
the critical determinants of passive drug transfer (Fleishaker et al.,
1987
; Begg and Atkinson, 1993
). These factors may be measured by in
vitro techniques to predict a milk-to-serum ratio (M/S) for drugs in
which transfer into milk is governed by passive diffusion in the
absence of clinical data (Fleishaker et al., 1987
; Begg and Atkinson,
1993
). Some drugs, however, have observed M/S values significantly
greater than predicted M/S values (Taddio et al., 1994
; Oo et al.,
1995
; Gerk et al., 2001
). Active transport processes may explain this
observation. Active processes may contribute to significant drug
accumulation into milk, which may enhance infant exposure risk with
breast-feeding. Identification of the active processes present at the
lactating mammary epithelium becomes paramount to the identification of
drugs for which active transport mechanisms might govern their transfer
into breast milk.
During lactation, the mammary gland epithelium has differentiated into
a highly active secretory tissue. Other secretory epithelia, such as
the renal and hepatic epithelia, express a diversity of transport
proteins, including members of the OCT, OAT, OATP, MRP, MDR,
nucleoside, nucleobase, and oligopeptide transporter families (Koepsell, 1998
; Hogue and Ling, 1999
; Klein et al., 1999
; Borst et
al., 2000
; Sekine et al., 2000
; Pennycooke et al., 2001
; Shen et al.,
2001
). The distribution of transporters in organs such as the liver and
kidney is believed to reflect the physiological requirements of these
organs for the clearance and/or detoxification of a multitude of
hydrophilic organic ions and other hydrophobic substances. Furthermore,
the literature suggests these transporter proteins have important roles
in drug disposition. Drug accumulation into milk may involve such
transporter proteins, and their expression may reflect an endogenous
function in the formation and modulation of breast milk composition.
Characterization of RNA levels of transporter genes in the lactating
MEC may identify a potential list of candidate transporters involved in
the transepithelial transport of drugs in the lactating mammary gland.
Furthermore, expression levels of these transporters in lactating MEC
relative to nonlactating breast, liver, and kidney tissue may identify
a more significant subset of transporters involved in drug accumulation
into milk. Although several techniques exist to evaluate RNA expression
in tissues, real-time RT-PCR has become the method of choice (Ferre,
1992
) for the rapid quantitative analysis of gene transcript levels in
different tissues and in the same tissue subjected to different
regulatory controls (Pan et al., 2000
; O'Reilly et al., 2001
; Pfaffl
et al., 2001
). Therefore, real-time RT-PCR will be used to compare the
relative RNA levels between lactating mammary epithelial cells and
nonlactating breast, liver, and kidney tissue to identify candidate
transporters involved in drug disposition in the lactating mammary gland.
| |
Materials and Methods |
|---|
|
|
|---|
Materials
Monoclonal rat anti-epithelial basement membrane antigen (IgGa subtype) was purchased from Harlan SeraLab (Loughborough, England). M-450 sheep anti-rat IgG Dynabeads, magnetic particle concentrator (MPC-L), and Dynal sample mixer were purchased from Dynal Biotech (www.dynal.net; Lake Success, NY). PeCap polyester filters (54-um gauze) were purchased from Sefar America, Inc. (Kansas City, MO). RPMI 1640 medium (containing 25 mM Hepes buffer and 2 mM L-glutamine), IMEM (improved minimal essential medium Zn2+ option Richter's modification) medium, media supplements, antibiotic/antimycotic (100×) solution, fetal bovine serum (FBS), Dulbecco's phosphate-buffered saline (no calcium or magnesium) (PBS), trypsin/EDTA (0.05%/0.02% in PBS), cell culture freezing medium, and a superscript preamplification system for first-strand cDNA synthesis kit were obtained from Invitrogen (Invitrogen, Carlsbad, CA). Collagenase type 1A, hyaluronidase type 1-S, and other chemicals were obtained from Sigma-Aldrich (St. Louis, MO). Deoxyribonuclease 1 and LightCycler DNA master SYBR Green I (1×) were supplied by Roche Diagnostics (Indianapolis, IN). Human total RNA from liver, kidney, and placenta was purchased from BD Biosciences Clontech (Palo Alto, CA). All human cell lines were obtained from American Type Culture Collection (www.atcc.org; Manassas, VA). An RNeasy mini kit for total RNA isolation was obtained from QIAGEN (Valencia, CA).
Tissue Sources
The University of Kentucky Medical Institutional Review Board approved all tissue collection and study protocols. The University of Kentucky Tissue Procurement Service provided normal mammary epithelial tissue from four individual surgical reduction mammoplasty specimens (left and right breast). All tissue samples were stored in RPMI 1640 medium containing 5% FBS and 1% antibiotic/antimycotic solution at 4°C and processed within 24 h of initial collection. Milk samples from six healthy, lactating women volunteers (lactation stage breakdown: 1, 1, 1.5, 9, 10, and 11 months) provided the source of lactating mammary epithelial tissue. Expressed milk was stored on ice and processed within 1 h of collection. Individual specimens for each tissue source were pooled before mammary epithelial cell purification procedures and transporter gene RNA expression profiling.
Mammary Epithelial Cell Isolation and Purification Procedures
Heterogeneous Single-Cell Suspensions from Reduction Mammoplasty
Tissue.
To achieve a single-cell suspension from normal mammary
tissue, breast organoids were first prepared from reduction mammoplasty tissue according to the method of Gomm et al. (1995)
. Briefly, skin and
grossly fatty areas were removed, and the reduction mammoplasty tissue
was minced into 0.5-cm cubed pieces with two opposing scalpel blades.
The minced tissue was transferred to 50-ml polypropylene conical
centrifuge vials (one third the volume of the vial) and digestion mix
[RPMI 1640 medium containing 5% FBS, 1% antibiotic/antimycotic solution, hyaluronidase (1 mg/ml), and collagenase (1 mg/ml)] was
added such that only a small air space remained to allow for gentle
mixing. After a 24-h incubation (37°C) with gentle agitation, breast
organoids (ductal and lobuloalveolar fragments obtained from the
digestion of reduction mammoplasty tissue) were pelleted by
centrifugation (600g at 4°C for 5 min) and aspiration of
the fat layer and remaining supernatant. The pelleted organoids were washed three times with 20 ml of 5% RPMI 1640 medium containing 5%
FBS and 1% antibiotic/antimycotic solution (5% RPMI 1640) (37°C). To remove blood cells, the organoids underwent three sedimentation steps (1g at 37°C) in 30 ml of 5% RPMI 1640 medium, with
careful aspiration of supernatant between each sedimentation step.
Following sedimentation, the breast organoids were frozen in 1-ml cell
culture-freezing medium and stored at
80°C until sufficient
quantities of breast organoids were collected. To achieve a single-cell
suspension, thawed breast organoids (37°C) were pooled and washed
three times with 30 ml of RPMI 1640 medium (4°C) containing 1% FBS
and 1% antibiotic/antimycotic solution, followed by a single wash with 30 ml of PBS (4°C). Addition of trypsin/EDTA containing 0.4 mg/ml deoxyribonuclease 1 (in a 1:2 organoid/trypsin ratio) allowed for
digestion (30 min at 37°C) of the breast organoids, and digestion was
terminated by the addition of 30 ml of RPMI 1640 medium (4°C) containing 10% FBS and 1% antibiotic/antimycotic solution. The digestion product was pelleted (600g for 5 min at 4°C) and
washed three times in 10 ml of 1% RPMI 1640 medium (4°C). The cells
were resuspended in 10 ml of 1% RPMI 1640 medium (4°C) and filtered through a 54-µm PeCap polyester filter to achieve a single cell suspension. The cells were counted in a Coulter counter, and a small
volume of cell suspension was saved for cytospin and immunocytostaining.
Heterogeneous Single-Cell Suspensions from Milk. Milk samples were centrifuged in 50-ml conical polypropylene vials at 600g for 20 min. The fat layer was removed with a spatula, and the remaining skim milk layer was aspirated with a pipette. The cell pellet was washed with 30 ml of PBS (4°C), pooled, and resuspended in 20 ml of 5% RPMI 1640 medium. The cells were counted in a Coulter counter, and a small volume of cell suspension was saved for cytospin and immunocytostaining.
Isolation of a Pure Population of Mammary Epithelial Cells.
Immunomagnetic separation techniques were used to isolate a pure
population of mammary epithelial cells according to the method of Gomm
et al., (1995)
with some modifications. Briefly, M-450 Sheep anti-rat
IgG Dynabeads were coated with primary rat monoclonal antibody to
epithelial membrane antigen (EMA) specific for human mammary epithelial
cells before incubation with mammary tissue cell suspensions. A
12.5-µl (5 × 106 beads or 18.72-mg beads)
aliquot of Dynabead suspension (4 × 108
beads/ml) was added to six 15-ml polypropylene round-bottomed tubes. To
remove the preservative, each aliquot of Dynabeads was washed three
times with 7 ml of RPMI 1640 medium (4°C). The medium was removed
each time after placement of the tubes on the magnetic particle
concentrator (MPC) for 2 min. The Dynabeads were resuspended in 1 ml
RPMI 1640 medium (4°C) and transferred to 1.5-ml microcentrifuge tubes. To each 12.5-µl aliquot of washed second antibody-coated bead
suspension, 187.2 µl of rat monoclonal antibody to EMA (500 µg/ml)
was added to achieve a concentration of 5 µg of antibody/mg of beads.
An overnight incubation (4°C) with rotation allowed the coating of
the Dynabeads with the primary antibody to EMA. Excess unbound antibody
was removed following the aspiration of the supernatant after placement
of the Dynabead-antibody suspension on the MPC for 2 min. The coated
Dynabeads were resuspended with 1 ml of RPMI 1640 medium (4°C) and
transferred to new 15-ml tubes. The primary antibody/secondary antibody
bead complexes were washed 4 times with 7 ml of RPMI 1640 medium
(4°C) by rotation for 30 min, and placed on the MPC to remove any
further unbound antibody. The coated Dynabeads were resuspended in 100 µl of RPMI 1640 medium (4°C).
|
Immunocytostaining
Cytospins of each cell population aliquot were made. Cytocentrifuge preparations were air dried and fixed with alcohol. The cell preparations were stained using the Vectastain ABC kit (Vector Laboratories, Inc., Burlingame, CA) and a monoclonal mouse anti-human (IgG1) cytokeratin cocktail CK22 (40-68 kDa) (Biomeda Corp. Foster City, CA) specific for simple epithelial cells.
Total RNA Extraction and Reverse Transcription. Total RNA was extracted from purified lactating and nonlactating mammary epithelial cells using an RNeasy mini kit following the manufacturer's protocol. Pelleted cells were resuspended and counted using a Coulter counter before RNA extraction to assess cell yields following cell isolation and purification procedures and to prevent overloading of the RNeasy columns. Cells were homogenized using a roto-stator tissue homogenizer. Total RNA concentration was determined by the measurement of optical density at 260 nm with an ultraviolet spectrophotometer (Beckman spectrophotometer; Beckman Coulter, Inc., Fullerton, CA). Total RNA integrity was verified by an OD260/OD280 absorption ratio greater than 1.7. From each sample preparation, 1 µg of total RNA was used to synthesize first-strand cDNA by reverse transcription with Invitrogen's Superscript RT kit following the manufacturer's instructions.
Transporter Gene-Specific Primer Design
Gene sequences for primer design were obtained from the National
Center for Biotechnology Information's GenBank. Primer pairs for each
transporter gene, EMA, common acute lymphocytic leukemia antigen
(CALLA),
-actin,
-casein, and
-lactalbumin were chosen with
assistance from the primer design software Oligo 4.0 (National Biosciences, Inc., Plymouth, MN) to give amplification products between
~250 to 800 base pairs. Forward and reverse primer sequences for each
gene and their corresponding amplicon size are provided in Table
1. The primer sequences for EMA (EMA
forward primer: 5'-3': TACCACCCTTGCCAGCCATAG; EMA reverse primer:
5'-3': CGCAACCAGAACACAGACCAG) and for CALLA (CALLA forward primer:
5'-3': TAAGCAGCCTCAGCCGAACCTACA; CALLA reverse primer: 5'-3':
GACCAAGACCTCCATTATCAGCAA) gave amplification products of 511 and 831 base pairs, respectively.
|
Optimization of LightCycler PCR Conditions
For reliable quantification of transporter gene expression, LightCycler PCR conditions specific for each gene were optimized with respect to primer concentration, MgCl2 concentration, annealing temperature (TM), and cycle number using the LightCycler (Roche Molecular Biochemicals, Indianapolis, IN) and positive control tissues. Positive control tissues consisted of the human hepatocellular carcinoma cell line HepG2, the human breast carcinoma cell line ZR-75-1, the human renal adenocarcinoma cell line 786-0, the human colon adenocarcinoma cell line HT-29, and kidney tissue. Conditions were established to give specific melting peaks following a melting curve analysis. To differentiate desired from undesired amplification products, specific melting peaks were correlated with gel electrophoresis results. Amplification products were separated by 1.5% agarose gel electrophoresis using a 1× Tris borate-EDTA running buffer (0.09 M Tris-borate, 0.002 M EDTA, pH 7.8) and analyzed with a photoimager following ethidium bromide staining. A specific band corresponding to the appropriate size of the amplicon for each gene and to a specific melting peak was positive identification of the appropriate amplification product. These optimized conditions were used for transporter gene expression profiling.
LightCycler PCR Master Mix
A SYBR Green I DNA master kit was used for LightCycler PCR.
Table 2 gives the concentrations of the
reaction components in the master mix used for each transporter
gene-specific LightCylcer reaction and the corresponding annealing
temperature and total cycle number. A total volume of 18 µl of the
LightCycler master mix was filled into LightCycler glass capillaries
under reduced light conditions, and 2 µl of cDNA product (from 1 µg
of total RNA) was added as PCR template. The capillaries were capped,
briefly centrifuged, and placed in the LightCycler carousel with
minimal delays.
|
LightCycler PCR Time and Temperature Profiles
A standard LightCycler amplification cycle protocol was established for the transporter genes. Thermal cycling was carried out as follows. The first segment of the amplification cycle consisted of a denaturation program at 95°C for 30 s. The second segment consisted of a four-step primer annealing, amplification, and quantification program repeated for a set number of cycles (see Table 2) with a ramp rate set at 20°C/s. The conditions were 95°C for 0 s, annealing TM for the specific transporter (see Table 2) for 10 s, elongation at 72°C for 40 s, and a single fluorescence acquisition point at the end of the elongation phase. A higher temperature fluorescence acquisition point was required in the amplification cycle program for several transporter genes (see Table 2) to improve the specificity of SYBR green I quantification. The third segment consisted of a melting curve program. The conditions were 95°C for 0 s and 72°C for 10 s with a linear temperature transition at 0.1°C/s from 72°C to 94°C (except for OATP-E, which required the melting curve analysis to proceed to 98°C) with continuous fluorescence acquisition. The melting curve analysis is necessary to differentiate fluorescence associated with specific amplification products from nonspecific amplification products. The last segment consisted of a final cooling program to 40°C.
Data Analysis and Calibration Curves
The LightCycler analysis software allowed quantitative analysis
of the PCR reactions. A calibration curve for each transporter gene and
for the housekeeping gene
-actin was generated from serial dilutions
of template cDNA (based on 1 µg of total RNA) from respective control
tissues. To remove background fluorescence, an arbitrary threshold
fluorescence level in the exponential phase of the amplification curve
was set to exceed the mean baseline fluorescence emissions (noise
level) of each amplification plot. A crossing point defined the cycle
number at which the best-fit line through the log-linear portion of
each amplification plot intersected the threshold level. The
calibration curve was constructed from the plot of crossing points
against the log value of serially diluted standard samples. Only
crossing points associated with a specific melting peak were used in
the construction of the calibration curve and in the assessment of
unknown samples. Interpolation of the standard curve using the crossing
points calculated for each transporter gene and
-actin in the
unknown samples allowed quantification of the respective genes. A
nontemplate negative control was incorporated in all PCR reactions.
| |
Results |
|---|
|
|
|---|
Purity of Mammary Epithelial Cell Population.
Before
purification procedures, immunocytostaining of cytospins from cells
isolated from breast milk samples and from reduction mammoplasty tissue
demonstrated only 10 to 20 and 10 to 30% staining, respectively, of
cells by cytokeratin antibody cocktail specific for mammary epithelial
cells (Fig. 1). Consequently, purification procedures for the
respective cell populations were necessary before transporter
expression profiling experiments. Following purification, cell
populations isolated from breast milk and from reduction mammoplasty
gave >90% purity for mammary epithelial cells in all preparations
(Fig. 1). Cell purity was confirmed by normal RT-PCR assessment of EMA
(an epithelial cell surface membrane antigen) and CALLA (a
myoepithelial and fibroblast cell surface membrane antigen) expression
as specific markers of each cell population. Moreover,
-casein and
-lactalbumin expression, specific molecular markers of mammary gland
differentiation (Levine and Stockdale, 1985
; Hahm et al., 1990
), in
heterogeneous and purified populations were assessed. Electrophoresis
gels indicated strong positive bands for EMA,
-casein, and
-lactalbumin in the purified populations and with a very slight band
for CALLA (data not shown). Strong positive bands for EMA, CALLA,
-casein, and
-lactalbumin were demonstrated in the cell
populations isolated from milk and reduction mammoplasty before
purification procedures (data not shown). These results suggest the
purity of the preparations was sufficient to allow a comparison of
transporter expression profiles between the respective tissues.
Real-Time RT-PCR Assay Validation.
Table 2 provides the
specific set of PCR conditions for each transporter gene. Verification
of appropriate RT-PCR products for each transporter gene was determined
by PCR product separation on 1.5% agarose gel electrophoresis.
Amplified PCR products showed a single band and the expected amplicon
size (Table 2) for each gene assessed. Specificity of the RT-PCR
product was also confirmed with melting curve analysis using
LightCycler software. A specific melting curve and annealing
temperature for each transporter gene analyzed was associated
with a specific band of appropriate size on gel electrophoresis. The
calibration curves gave linear quantification ranges over 2 to 4 orders
of magnitude, depending upon the transporter gene and level of
expression in the control tissue, as indicated by a correlation
coefficient of >0.99. To ensure high PCR efficiency, every attempt was
made to achieve calibration curve slopes close to the theoretical
optimum (
3.322) and y-intercepts near the threshold cycle
value for the negative control. Replicates of each transporter gene in
the various tissues were not performed due to template limitations.
Several transporter genes required fluorescence acquisition at higher
temperatures (see Table 2) than the elongation cycle temperature during
the amplification program to eliminate nonspecific fluorescence signals
due to primer dimers and to ensure a more accurate quantification of
the desired product. The relative expression level for each gene in
each tissue sample was interpolated from the calibration curve. The
expression level for the housekeeping gene
-actin was similarly
calculated in each tissue, and all expression data were normalized to
-actin to control for systematic variation in sample preparation and analysis. Hence, the final results were expressed as the ratio of
relative transporter expression levels/
-actin expression levels.
RNA Expression Analysis of Transporter Genes in Mammary Epithelial
Cells.
Table 3 summarizes the
relative RNA (transporter gene/
-actin ratios) expression levels of
representative members of the OCT, OCTN, OAT, OATP, MRP, MDR,
nucleoside, nucleobase, and peptide transporter families. All values
recorded fall within the calibration curve range. RNA levels that were
detectable (specific gel electrophoresis band and specific melting peak
following melting curve analysis) but below the calibration curve range
are denoted as below the level of quantification. Since their
values fall outside the calibration curve range, the ratios were not
determined. RNA levels defined as below the limit of detection show no
specific melting peak and no band on gel electrophoresis. Since the
principal purpose of the study was to compare the relative expression
levels of the various transporters in lactating mammary epithelial
cells with tissues known for their secretory activity as a means of identifying candidate transporters in drug accumulation into milk, the
LightCycler assays were not optimized to achieve maximum sensitivity of
quantification. Therefore, entries below the limit of detection do not
preclude possible expressions at low levels. Entries with "E" refer
to positive controls and tissues that demonstrated a specific melting
curve and appropriately sized band on gel electrophoresis, but
primer-dimer interference precluded accurate quantification in some
tissues. Limitation in template quantity prohibited rerun analyses
resulting in incomplete data for some of the transporters.
|
RNA Gene Transcript Levels in Lactating Mammary Epithelial Cells
Relative to Renal, Hepatic and Placental Tissues.
To assess the
relevance of transporter RNA expression levels in lactating MEC,
individual transporter RNA levels were compared with kidney and liver
tissues in which these transporters are known to have an important
function in drug disposition. Figure 2
summarizes the RNA expression levels for transporter genes as a ratio
of expression levels in lactating MEC relative to liver or kidney
expression levels. Lactating MEC expression levels of most transporter
genes compare reasonably well with liver and/or kidney levels. Notable
exceptions include OCT1, OCT3, OATP-B, and CNT1, which demonstrate
>10-fold higher expression levels in the liver, and OCTN2 and MDR1,
which demonstrate >10-fold higher levels of expression in the kidney.
Neither the liver nor the kidney expressed CNT3, but significant CNT3
RNA levels were demonstrated in lactating MEC. PEPT2 and OATP-A were
not expressed at quantifiable levels in the liver and kidney,
respectively, in contrast to high levels of expression in lactating
MEC. Placental expression of transporter genes relative to lactating
MEC shows more variable results, with less than 7.5-fold differences in
RNA levels for most transporter genes. However, MDR1, PEPT1, and ENT3
demonstrate much greater (>15-fold) expression levels than lactating
MEC (Table 3).
|
Comparison of Transporter RNA Expression Levels between
Nonlactating and Lactating Mammary Epithelial Cells.
To determine
whether lactation alters transporter gene expression, individual
transporter RNA expression levels were compared in nonlactating and
lactating MEC. Table 4 gives the -fold
difference in transporter RNA expression levels between lactating and
nonlactating MEC. In general, a stable expression pattern was observed
with a 2- to 3-fold difference or less in transcript levels between lactating and nonlactating MEC. This difference may reflect normal physiological variation and interindividual differences in the levels
of transporter expression. A greater difference in RNA expression
levels, however, was observed for OCT1, OCTN1, OCTN2, MDR1, PEPT2,
CNT1, CNT3, and ENT3. Lactating MEC demonstrated ~8-, ~6-, ~28-,
~9-, ~7-, and ~4-fold higher RNA levels for OCT1, OCTN1, PEPT2,
CNT1, CNT3, and ENT3, respectively, compared with nonlactating MEC.
Conversely, transporter RNA expression levels of OCTN2 and MDR1 were
~4- and ~52-fold lower in lactating MEC relative to nonlactating
MEC.
|
| |
Discussion |
|---|
|
|
|---|
Quantitative Analysis of 30 Transporter Proteins in Mammary
Epithelial Cells.
Detection of transporter gene expression in the
human lactating mammary epithelium is a necessary first step in the
identification of candidate transporter proteins involved in drug
transfer across the lactating mammary epithelium. This study is the
first to describe the parallel analysis of RNA expression levels for 30 different representative members of these transporter families in
lactating and nonlactating MEC. LightCycler RT-PCR analysis revealed
lactating MEC express members from the OCT, OCTN, OATP, MRP, MDR,
nucleoside, nucleobase, and oligopeptide transporter families at levels
generally comparable to liver and/or kidney expression levels. OCT2,
OAT1, OAT2, OAT3, OAT4, OATP-C, MRP3, MRP4, CNT2, ENT2, and NCBT2 were not expressed at levels above the detection threshold of the
LightCycler PCR assay. Although examples of RNA expression without
protein expression exist (Chesterman et al., 2001
), such data may still identify a potential role for these expressed transporters in drug
disposition at the mammary gland.
Comparison of Transporter Gene RNA Levels Between Lactating Mammary
Epithelial Cells and Liver and Kidney Tissue.
In the present
study, liver and kidney transporter expression profiles were consistent
qualitatively with the literature, which affirms the validity of the
results of the present study (Cass et al., 1998
; Koepsell, 1998
; Ritzel
et al., 1998
; Hogue and Ling, 1999
; Klein et al., 1999
; Borst et al.,
2000
; Sekine et al., 2000
; Lahjouji et al., 2001
; Pennycooke et al.,
2001
; Shen et al., 2001
). In general, transporter RNA levels in
lactating MEC compared reasonably well to liver and/or kidney
expression levels. Although the liver expressed OCT1, OCT3, OATP-B, and
CNT1 at levels considerably higher than lactating MEC, kidney
expression levels of these transporters were comparable. High liver
expression levels of such transporters are consistent with the liver's
physiological role in the clearance of organic ions and hydrophobic
molecules and, hence, does not necessarily preclude a role for these
transporters at the lactating mammary epithelium. Significantly higher
hepatic and renal MDR1 RNA levels relative to lactating MEC suggests
MDR1 may have a limited role in drug disposition in the lactating
mammary gland. An absence of CNT3 expression in the liver and kidney
suggests CNT3 may have an important and specialized role in nucleoside accumulation in milk. Lactating MEC also exhibited increased PEPT2 RNA
levels relative to the liver and increased OATP-A RNA levels relative
to kidney suggesting these transporters may have a significant role in
lactating MEC.
Comparison of Transporter Gene RNA Levels Between Lactating and Nonlactating Mammary Epithelial Cells. The expression of members of the OCT, OATP, MDR, MRP, nucleoside, nucleobase, and peptide transporter families in lactating MEC may relate to a physiological role for these transporters in milk production. An endogenous function in the mammary gland suggests drug transport across the mammary epithelium may interfere with the normal physiological function of the transporter. This inhibition may adversely affect milk composition and infant health. Any consideration of drug disposition in the mammary gland must acknowledge the exposure risk associated with both the potential for drug accumulation in breast milk and the potential changes in milk composition associated with inhibition of endogenous transporter function.
The transcriptional up-regulation of OCT1, OCTN1, PEPT2, CNT1, CNT3, and ENT3 and down-regulation of MDR1 and OCTN2 may suggest a significant endogenous role for these transporters during lactation. Furthermore, demonstration of lactation-induced alteration in transporter gene expression may identify potential players (i.e., hormones and extracellular matrix components) in transcriptional regulation of these genes. A role for OCT1 and OATP transporters at the mammary gland remains unknown. Nevertheless, given their basolateral membrane localization (http://www.med.rug.nl/mdl/) and their function in organic cation and organic anion uptake, respectively, these transporters may transport various minor constituents of milk (Picciano, 2001| |
Conclusions |
|---|
|
|
|---|
Mammary epithelial RNA expression of members from the OCT, OCTN, OATP, MDR, MRP, nucleoside, nucleobase, and oligopeptide transport families identifies candidate transporters involved in drug disposition across the mammary epithelium. RNA expression profiling of transporters in the mammary epithelium, however, is only a first step toward elucidating the molecular mechanisms underlying substrate transfer across the mammary epithelium. Further investigations into transporter activity and membrane localization in the polarized mammary epithelium will define an unequivocal role for transporter function in mammary epithelial cells. This will facilitate identification of drugs in which their disposition in the mammary gland may be governed by transporter proteins, especially as substrate binding characteristics and substrate specificities of these transporters become further elucidated. In addition, functional studies are needed to identify the physiological and pharmacological role of these transporters in the mammary gland.
| |
Acknowledgments |
|---|
We thank Gaye Whelan and Sue Eisner for their assistance with volunteer recruitment. The General Clinical Research Center at the University of Kentucky provided the environment and necessary resources for collection of breast milk.
| |
Footnotes |
|---|
Accepted for publication June 25, 2002.
Received for publication May 2, 2002.
The University of Kentucky Research Challenge Trust Fund provided financial support for J.A. This work was supported by National Institutes of Health Grant HD37463.
DOI: 10.1124/jpet.102.038315
Address correspondence to: Patrick J. McNamara, Division of Pharmaceutical Sciences, College of Pharmacy, University of Kentucky, Rose St., Lexington, KY 40536-0082. E-mail: pmcnamar{at}emailuky.edu
| |
Abbreviations |
|---|
M/S, milk drug concentration to serum drug concentration ratio; OCT, organic cation transporter; OAT, organic anion transporter; OATP, organic anion transporting polypeptide; MRP, multidrug resistance-associated protein; MDR, multidrug resistance transporter; MEC, mammary epithelial cells; RT-PCR, reverse transcription-polymerase chain reaction; FBS, fetal bovine serum; PBS, phosphate-buffered saline; EMA, epithelial membrane antigen; MPC, magnetic particle concentrator; CALLA, common acute lymphoblastic leukemia antigen; CNT, concentrative nucleoside transporter; ENT, equilibrative nucleoside transporter; NCBT, nucleobase transporter; OCTN, organic cation/carnitine transporter; PEPT, oligopeptide transporter.
| |
References |
|---|
|
|
|---|
and ER
mRNA with real-time RT-PCR.
Apmis
109:
345-355[CrossRef][Medline].This article has been cited by other articles:
![]() |
L. Wang, M. Leggas, M. Goswami, P. E. Empey, and P. J. McNamara N-(4-[2-(1,2,3,4-Tetrahydro-6,7-dimethoxy-2-isoquinolinyl)ethyl]-phenyl)-9,10-dihydro-5-methoxy-9-oxo-4-acridine Carboxamide (GF120918) As a Chemical ATP-Binding Cassette Transporter Family G Member 2 (Abcg2) Knockout Model to Study Nitrofurantoin Transfer into Milk Drug Metab. Dispos., December 1, 2008; 36(12): 2591 - 2596. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. E. Meyer zu Schwabedissen, R. G. Tirona, C. S. Yip, R. H. Ho, and R. B. Kim Interplay between the Nuclear Receptor Pregnane X Receptor and the Uptake Transporter Organic Anion Transporter Polypeptide 1A2 Selectively Enhances Estrogen Effects in Breast Cancer Cancer Res., November 15, 2008; 68(22): 9338 - 9347. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Ling and J. Alcorn Acute Administration of Cefepime Lowers L-Carnitine Concentrations in Early Lactation Stage Rat Milk J. Nutr., July 1, 2008; 138(7): 1317 - 1322. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Boutinaud, M. H. Ben Chedly, E. Delamaire, and J. Guinard-Flament Milking and Feed Restriction Regulate Transcripts of Mammary Epithelial Cells Purified from Milk J Dairy Sci, March 1, 2008; 91(3): 988 - 998. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Govindarajan, A. H. Bakken, K. L. Hudkins, Y. Lai, F. J. Casado, M. Pastor-Anglada, C.-M. Tse, J. Hayashi, and J. D. Unadkat In situ hybridization and immunolocalization of concentrative and equilibrative nucleoside transporters in the human intestine, liver, kidneys, and placenta Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2007; 293(5): R1809 - R1822. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Libra, C. Fernetti, V. Lorusso, M. Visigalli, P. L. Anelli, F. Staud, C. Tiribelli, and L. Pascolo Molecular Determinants in the Transport of a Bile Acid-Derived Diagnostic Agent in Tumoral and Nontumoral Cell Lines of Human Liver J. Pharmacol. Exp. Ther., November 1, 2006; 319(2): 809 - 817. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Swales, M. Korbonits, R. Carpenter, D. T. Walsh, T. D. Warner, and D. Bishop-Bailey The farnesoid x receptor is expressed in breast cancer and regulates apoptosis and aromatase expression. Cancer Res., October 15, 2006; 66(20): 10120 - 10126. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Kwok, A. Yamauchi, R. Rajesan, L. Chan, U. Dhillon, W. Gao, H. Xu, B. Wang, S. Takahashi, J. Semple, et al. Carnitine/xenobiotics transporters in the human mammary gland epithelia, MCF12A Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2006; 290(3): R793 - R802. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Klapper, H. Daniel, and F. Doring Cytosolic COOH terminus of the peptide transporter PEPT2 is involved in apical membrane localization of the protein Am J Physiol Cell Physiol, February 1, 2006; 290(2): C472 - C483. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Miki, T. Suzuki, K. Kitada, N. Yabuki, R. Shibuya, T. Moriya, T. Ishida, N. Ohuchi, B. Blumberg, and H. Sasano Expression of the Steroid and Xenobiotic Receptor and Its Possible Target Gene, Organic Anion Transporting Polypeptide-A, in Human Breast Carcinoma Cancer Res., January 1, 2006; 66(1): 535 - 542. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Edwards, J. Alcorn, J. Savolainen, B. D. Anderson, and P. J. McNamara Role of P-Glycoprotein in Distribution of Nelfinavir across the Blood-Mammary Tissue Barrier and Blood-Brain Barrier Antimicrob. Agents Chemother., April 1, 2005; 49(4): 1626 - 1628. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hirano, K. Maeda, Y. Shitara, and Y. Sugiyama Contribution of OATP2 (OATP1B1) and OATP8 (OATP1B3) to the Hepatic Uptake of Pitavastatin in Humans J. Pharmacol. Exp. Ther., October 1, 2004; 311(1): 139 - 146. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Pizzagalli, Z. Varga, R. D. Huber, G. Folkers, P. J. Meier, and M. V. St-Pierre Identification of Steroid Sulfate Transport Processes in the Human Mammary Gland J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3902 - 3912. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||