![]() |
|
|
Vol. 302, Issue 3, 1046-1054, September 2002
Diabetes and Endocrine Research Group, Departments of Pharmacology and Therapeutics (B.A.-A., S.J.W., M.D.H.) and Medicine (M.D.H.), University of Calgary, Faculty of Medicine, Calgary, Alberta, Canada
| |
Abstract |
|---|
|
|
|---|
Activation of rat proteinase-activated receptor 2 (PAR2) by trypsin
involves the unmasking of the tethered sequence
S37LIGRL42 that either tethered or on its own
as a free peptide, activates PAR2. We aimed to determine whether
different peptide sequences acting either as trypsin-revealed tethered
ligands or as soluble peptides had the same relative activities for
triggering the receptor. A comparison was also made between the
different soluble and tethered receptor activating sequences in
receptor constructs with extracellular loop 2 (ECL2) residues
E232E233 (PAR2SR/EE) mutated to
R232R233 (PAR2SR/RR). Using site-directed
mutagenesis, we prepared PAR2 constructs with trypsin-revealed tethered
ligand sequences corresponding to the synthetic receptor-activating
peptides (PAR2APs): SLIGRL-NH2 (SR-NH2),
SLIGAL-NH2 (SA-NH2), and SLIGEL-NH2
(SE-NH2). Kirsten virus-transformed rat kidney cells
stably expressing 1) wild-type PAR2 with site-mutated tethered ligands
(PAR2SA/EE and PAR2SE/EE); 2) wild-type PAR2 with ECL2 mutated to
R232R233 (PAR2SR/RR); and 3) PAR2 constructs
with both the RR mutation in ECL2 and a mutation in the tethered ligand
(PAR2SA/RR and PAR2SE/RR) were assessed for receptor-mediated calcium
signaling and cell growth inhibition, upon activation either by trypsin
or the above-mentioned PAR2APs. Trypsin exerted equivalent and full
agonist activity on the PAR2 constructs, causing a maximum response
between 20 to 80 nM. In contrast, the PAR2APs as free peptide agonists
showed marked potency differences in all wild-type receptors with
mutated tethered ligands (SR-NH2
SA-NH2
SE-NH2) and in all ECL2 RR mutated constructs
(SE-NH2 > SR-NH2
SA-NH2).
We conclude that for receptor activation, the trypsin-revealed PAR2
tethered ligand sequence interacts differently for receptor activation
than does the same peptide sequence as a free peptide.
| |
Introduction |
|---|
|
|
|---|
PAR2
activation by trypsin involves the proteolytic unmasking of an amino
terminal receptor sequence that acts as a tethered ligand (Nystedt et
al., 1994
). Remarkably, short synthetic peptides, PAR2APs, based on the
proteolytically revealed receptor sequence, beginning with serine-37 in
the rat receptor, can mimic the action of trypsin in a variety of
tissues (Al-Ani et al., 1995
; Hollenberg et al., 1997
; Cocks et al.,
1999
). Previously, the amino terminus and ECL2 domain for PAR1
(Gerszten et al., 1994
), and the ECL2 domain for PAR2 (Lerner et al.,
1996
) were found to be directly involved in PAR1 and PAR2 activation by
the soluble peptides SFLLRN and SLIGRL, respectively. Replacement of
the Xenopus PAR1 amino terminus and ECL2 with their
corresponding human domains to generate a Xenopus/human
chimeric PAR1 receptor, caused an increase in the activity of the
human-derived soluble peptide SFLLRN by more than 50- and 100-fold,
compared with the activity of SFLLRN on Xenopus PAR1
(Gerszten et al., 1994
). The substitution of ECL2 of PAR2 in human PAR1
has been found to render this chimeric receptor responsive to the
soluble PAR2-activating peptide SLIGRL, whereas SLIGRL is inactive on
the PAR1 receptor. The role of the acidic residues in ECL2 for
ligand-mediated activation for PAR1 and PAR2 has been explored
(Nanevicz et al., 1995
; Al-Ani et al., 1999a
). Such studies have
pointed out the importance of ECL2 as a primary determinant of peptide
agonist specificity. In human PAR1, E260 is
thought to play either a direct role in agonist binding or a regulatory
function in modulating agonist access to a receptor-docking site
(Nanevicz et al., 1995
). In rat PAR2 the acidic ECL2 tripeptide P231E232E233
plays an important role in receptor activation by the free peptides, but did not seem to have as marked an effect on receptor activation by
the trypsin-revealed tethered ligand (Al-Ani et al., 1999a
). The
structure-activity relationship (SAR) studies for short six amino acid
receptor-activating peptides derived from the tethered ligand sequences
of PAR1 and PAR2 (Natarajan et al., 1995
; Hollenberg et al., 1996
) have
shown the importance of the arginine residue at position 5 of PAR1AP
and 2AP, such as SFLLRN-NH2 and
SLIGRL-NH2. The substitution of an amino acid
with an acidic side chain (e.g., glutamic acid) at position 5 of a
PAR1AP (e.g., SFLLEN-NH2) has been found to
reduce peptide potency for activating PAR1 by at least 2 orders of
magnitude. Similarly, the substitution of an amino acid with a neutral
side chain (e.g., alanine) at position 5 of PAR2AP (e.g., SLIGAL) has
been found to reduce peptide potency for activating PAR2 by at least
200-fold (Hollenberg et al., 1996
). Although a number of
structure-activity studies have been done to evaluate the activities of
soluble PAR2-activating peptides (Hollenberg et al., 1996
, 1997
;
Maranoff et al., 2001
), it is unclear as to whether the activity of
these amino acid sequences acting as a tethered ligand would or would
not reflect their activities as peptides in solution. We hypothesized
that the SARs for the activation of the receptor by the
trypsin-revealed tethered ligand sequences may differ from their SARs
when acting as soluble peptides. To test this hypothesis, we focused on
the PAR2-activating peptide sequences SLIGRL... , SLIGAL... , and
SLIGEL... These sequences were selected because, as indicated above,
our previous work (Hollenberg et al., 1996
, 1997
; Al-Ani et al., 1999a
)
showed that substitution of either alanine or glutamic acid at position
5 of the parent PAR2-activating peptide
SLIGRL-NH2 results in a marked reduction in
peptide potency for activating PAR2. Therefore, we prepared and
expressed receptor mutants in which the arginine at position 41 of the
revealed tethered ligand was changed to either alanine or glutamic
acid. When revealed by trypsin, the mutated receptor tethered ligands
would then correspond to the synthetic receptor-activating peptides
SLIGAL-NH2 and SLIGEL-NH2.
Compared with the wild-type receptor, designated PAR2SR/EE, these
receptors with mutations in the tethered ligand sequence were
designated PAR2SE/EE (corresponding to the PAR2AP,
SLIGEL-NH2) and PAR2SA/EE (corresponding to the PAR2AP, SLIGAL-NH2). Furthermore, we prepared
receptors with double mutations, not only in the tethered ligand
sequence but also in the acidic tripeptide of ECL2:
(PE232E233/PR232
R233; Fig. 1). The
ECL2 mutations had either the wild-type tethered ligand (PAR2SR/RR) or
glutamic acid/alanine mutations in the tethered ligand sequence,
designated PAR2SE/RR and PAR2SA/RR. The concentration-effect curves for
activation of all receptor constructs by the soluble PAR2APs were
compared with the concentration-effect curves for receptor activation
by trypsin, which reflected the activity of the tethered ligand
sequences.
|
| |
Materials and Methods |
|---|
|
|
|---|
PAR2 Cloning and Expression.
Based on the previously
determined rat PAR2 sequence (Saifeddine et al., 1996
) and in keeping
with our previous work (Al-Ani et al., 1999a
,b
) rat kidney cDNA was
prepared using the first-strand cDNA synthesis kit (Pharmacia AB,
Uppsala, Sweden) according to manufacturer's recommendations at 37°C
for 60 min; 3 µl of this solution was used for polymerase chain
reaction (PCR) amplification to prepare a full-length receptor cDNA
with primer pairs flanking the entire coding region, designed on the
basis of the published rat PAR2 sequence (Saifeddine et al., 1996
). The
primer pairs were forward primer, PAR2-F: (containing a Hind III site
and Kozak sequence shown in bold), 5'
TCAAGCTTCCACCATGCGAAGTCTCAGCCTGGC 3', and reverse primer,
PAR2 R: (containing SmaI site shown in bold) 5'
CCCGGGCTCAGTAGGAGGTTTTAACAC3'. Routinely, amplification was
done using 2.5 U of Taq DNA polymerase (Promega, Madison, WI) in a 10 mM Tris-HCl buffer, pH 9.0 (final volume, 50 µl)
containing 1.5 mM MgCl2, 50 mM KCl, 0.1% (v/v)
Triton X-100, and 0.2 mM concentration of each dNTPs. Amplification was
allowed to proceed for 35 cycles beginning with a 1-min denaturing
period at 94°C, followed by a 1-min reannealing time at 55°C, and a
primer extension period of 2 min at 72°C. The PCR products were
separated by 1.5% agarose gel electrophoresis and visualized with
ethidium bromide. The PCR product was "gene-cleaned" (Magic PCR
Preps DNA purification system; Promega) and ligated (Ready To Go T4
ligase; Amersham Biosciences, Baie D'Urfé, QC, Canada) into the
PGEM-T vector (Promega). Two microliters of this ligation mixture was
used to transform Escherichia coli strain DH5
to produce
permanent clones for both manual and automated sequencing by the
dideoxynucleotide chain termination method (Sanger et al., 1977
), using
a T7 DNA sequencing kit (Amersham Biosciences, Dorval, QC, Canada) or
via the DNA Services Facility at the University of Calgary, Faculty of
Medicine. Then, the rat PAR2 cDNA was further subcloned into the pcDNA3
mammalian expression vector (Invitrogen, San Diego, CA), which was used
to prepare all six receptor mutants shown in Fig. 1A. The receptor
mutants were prepared using the QuikChange site-directed mutagenesis
kit (Stratagene, La Jolla, CA), according to the manufacturer's
instructions. In PAR2R36A, the trypsin cleavage/activation site
(R36) was changed to A; in PAR2SA/EE and
PAR2SE/EE, R41, which is the fifth amino acid of
the revealed tethered ligand sequence, was changed to A and E,
respectively.1 In PAR2SR/RR,
possessing the wild-type tethered ligand sequence, the two acidic amino
acids E232 and E233 in ECL2
were changed to R232 and
R233. In PAR2SA/RR and PAR2SE/RR,
R41 was changed to A and E, respectively, and
ECL2 amino acids E232and
E233 were changed to R232
and R233. The wild-type PAR2 and PAR2 mutants in
pcDNA3 were then transfected into Kirsten virus-transformed rat kidney
cells (KNRK; American Type Culture Collection, Manassas, VA). Cells
were transfected using the LipofectAMINE method, according to the
manufacturer's instructions (Invitrogen) with 5 µg of each
construct used per KNRK cell monolayer (60-mm2
flask; 50-70% confluent). Transfected cells, including wild-type receptor-expressing cells prepared in parallel for this new study, were
subcloned in geneticin containing medium (0.6 mg/ml), and receptor-bearing cells were isolated by fluorescence-activated cell
sorting (FACS) to yield permanent cell lines with the use of the
anti-receptor B5 antibody (Kong et al., 1997
; Al-Ani et al., 1999b
)
generated against a peptide representing the cleavage/activation sequence: GPNSKGR/SLIGRLDTP-YGGC (/, cleavage site; YGGC added for
conjugation). In the cell lines so isolated, >95% of the populations were found to exhibit reactivity with the B5 antibody. In addition, in
all mutants the B5 fluorescence intensity on a per cell basis was
equivalent. In keeping with our previous work (Al-Ani et al., 1999a
),
we only maintained and used permanent cell lines that expressed high
levels of PAR2 and exhibited equivalent average fluorescence yields on
a per cell basis with the B5 antibody. Using the FACS fluorescence
signal yielded with the B5 antiserum, the fluorescence intensity of
each mutated receptor clone, reflecting cell surface receptor density
was expressed (relative fluorescence intensity, RFI,
PAR2SR/EE; Table 1) relative
to the fluorescence yield of the wild-type receptor clone (PAR2SR/EE).
In previous work (Al-Ani et al., 1999a
), we determined that the
wild-type receptor clone expressed about 80,000 cell surface receptor
per cell. Cell lines were routinely propagated in genecitin (0.6 mg/ml) containing Dulbecco's modified Eagle's medium (DMEM) supplemented with 5% (v/v) fetal calf serum, using 80-cm2
plastic T-flasks. Cells were subcultured by resuspension in
calcium-free isotonic saline/EDTA solution, without the use of trypsin.
|
Immunocytochemistry.
The wild-type and PAR2 variant cell
lines were grown to 90% confluence on eight-chamber Lab-Tek II glass
slides (Nalge-Nunc, Naperville IL) in DMEM with geneticin (0.6 mg/ml)
and 5% (v/v) fetal calf serum, and fixed in 95% ethanol for 30 min.
The cells were washed with phosphate-buffered saline, pH 7.4, between
all incubations except after blocking with nonimmune goat serum. After reacting with 3% H2O2 for
10 min, avidin and biotin (Zymed, South San Francisco, CA) for 15 min
each and 10% (v/v) nonimmune goat serum (Zymed) for 10 min, the cells
were incubated overnight at 4°C with the primary B5 antiserum that
detected PAR2 (Al-Ani et al., 1999b
) at a dilution of 1:1000. The cells
were then incubated with a secondary biotinylated goat anti-rabbit
polyclonal antibody (1:100 dilution; Sigma-Aldrich, St. Louis, MO) for
40 min and extravidin-peroxidase (1:100 dilution; Sigma-Aldrich) for 40 min. Finally, the cells were incubated with the 3,3'-diaminobenzidine chromogen (Sigma-Aldrich) at 0.25 µg/ml for 10 min, counterstained with Gill's #1 hematoxylin (Fisher Scientific, Fair Lawn, NJ), dehydrated through an increasing alcohol gradient and xylene, and
mounted in an organic mounting medium (Acrytol; Surgipath, Richmond, IL).
Measurement of Calcium Signaling Using Fluorescence
Emission.
Cells to be used for measurements of the trypsin and
peptide-stimulated fluorescence emission (reflecting an increase in
intracellular calcium) were grown at 37°C in
80-cm2 T-flasks under an atmosphere of 5%
CO2 in room air to about 85% confluence and were
disaggregated with calcium-free isotonic phosphate-buffered saline
containing 0.2 mM EDTA. Disaggregated cells were pelleted by
centrifugation and were resuspended in 1 ml of DMEM/10% fetal calf
serum for loading with the intracellular calcium indicator Fluo-3
(Molecular Probes, Eugene, OR) at a final concentration of 22 µM (25 µg ml
1) of Fluo-3AM ester. Indicator uptake
was established over 20 to 25 min at room temperature in the presence
of 0.25 mM sulfinpyrazone, after which time cells were washed twice by
centrifugation and resuspensed with the buffer described below, to
remove excess dye. Fluo-3-loaded cells were then resuspended to yield a
stock solution (about 6 × 106 cells
ml
1) in a buffer of the following composition:
150 mM NaCl, 3 mM KCl, 1.5 mM CaCl2, 20 mM HEPES,
10 mM glucose, and 0.25 mM sulfinpyrazone. Fluorescence measurements,
reflecting elevations of intracellular calcium, were conducted at
24°C using a fluorescence spectrometer (PerkinElmer Life Sciences,
Boston, MA), with an excitation wavelength of 480 nm and an emission
recorded at 530 nm. Cell suspension (about 2 ml of approximately 3 × 105 cells ml
1) was
maintained in suspension with a stirred (magnetic flea bar) thermostatted cuvette (total volume, 4 ml), and peptide stock solutions
were added directly to the suspension to monitor peptide-induced changes in fluorescence. To construct concentration-response curves for
fluorescence yield, the signals caused by the addition of test agonists
(trypsin or PAR2APs) were expressed as a percentage (%A23187) of the
fluorescence peak height yielded by replicate cell suspensions when
treated with 2 µM of the ionophore A23187 (Sigma-Aldrich). This
concentration of A23187 was at the plateau of its
concentration-response curve for a fluorescence response. Previous work
(Kawabata et al., 1999
; Compton et al., 2000
) has shown that the
fluorescence response of a cell preparation relative to 2 µM A23187
is a valid reference standard in the determination of
concentration-response curves for all PAR agonists. In addition, in
previous work we have observed, as expected, that the presence of the
extracellular PAR2APs in the cell suspensions does not affect the
Fluo-3 signal generated by intracellular calcium indicator, in response
to other agonists such as lysophosphatidic acid (Kawabata et al.,
1999
). Under the assay conditions, the addition of proteinase inhibitors (e.g., amastatin) did not potentiate or diminish the fluorescence response caused by the PAR2APs. Thus, routinely, proteinase inhibitors were not added to the assay cuvettes.
Measurements were done using three or more replicate cell suspensions
derived from two or more independently grown crops of cells. For
calcium transcients, figures show exact tracings of the chart-recorder printouts from the fluorescence spectrometer. Values in the histogram and concentration-effect figures represent the average ± S.E.M. (bars).
Cell Growth Assay.
In six-well
(9.6-cm2) culture plates (Nunclon; VWR Canlab,
Ontario, ON, Canada) KNRK-rPAR2 cells were subcultured without the use
of trypsin at 105 cells/well in genecitin (0.6 mg/ml) containing DMEM supplemented with 5% (v/v) fetal calf serum and
incubated at 37°C for 24 h under an atmosphere of 5%
CO2 in room air. Medium was aspirated and cells
washed with phosphate-buffered saline before the addition of a
low-serum medium (0.2% fetal calf serum) and incubated further for
another 24 h. Test agents, trypsin (20 nM), and peptides (50-200 µM) were added in the absence of serum for 1-h incubation at 37°C, before a final concentration of 0.2% fetal calf serum was added. Cells
were incubated with the test agents for 48 h, rinsed with phosphate-buffered saline, and harvested for counting, using an improved Neubauer hemacytometer (American Optics, Buffalo, NY). At the
low trypsin concentration (20 nM), cells remained attached to the
culture dish, as for the peptide-treated samples. Cell cultures showed
an increase in cell numbers (
Nt) over the 48-h time period.
Inhibition of cell growth was expressed as (1
(
Nt/
Nc)) × 100, where
Nt is the increase in cell number
for agonist-treated cells and
Nc is the increase in cell number for
untreated cells.
Peptides and Other Reagents.
All peptides were synthesized
by solid-phase methods at the Peptide Synthesis Facility, University of
Calgary, Faculty of Medicine (director Dr. Denis MacMaster).
High-performance liquid chromatography analysis, mass spectral
analysis, and quantitative amino acid analysis confirmed the
composition and purity of all peptides. Stock solutions, prepared in 25 mM HEPES buffer, pH 7.4, were standardized by quantitative amino acid
analysis to verify peptide concentration and purity. Porcine trypsin
(14,900 U mg
1) was obtained from Sigma-Aldrich.
A maximum specific activity of 20,000 U mg
1 was
used to calculate the approximate molar concentration of trypsin in the
incubation medium (1 U ml
1
2 nM.
| |
Results |
|---|
|
|
|---|
Expression of PAR2 variants.
A KNRK cell line that lacks the
expression of a functional PAR2 (Böhm et al., 1996
; Al-Ani et
al., 1999b
) was used as a recipient cell to express the transfected rat
wild-type and mutated PAR2 receptors. Figure 1A shows the substituted
amino acids (shaded) in the putative trypsin cleavage/activation and
ECL2 sites for the six PAR2 mutants compared with the wild-type
receptor. The mutations were targeted to the trypsin cleavage residue
(R36), to R41 in the
tethered ligand, and to E232 and
E233 in ECL2 domain. The construct PAR2R36A was
used as a negative control for receptor activation by the enzyme
trypsin, because changing arginine to alanine abolished the trypsin
cleavage site. The sketch in Fig. 1B depicts the PAR2 receptor model
with the targeted residues for mutation shown (shaded).
|
Functional Analysis of PAR2 Variants and Comparison of Agonist
Potencies.
Because the seven receptor-bearing cell lines shown
schematically in Fig. 1A were observed to have equivalent receptor
densities (Fig. 2; Table 1; data not shown), it was possible to
determine the relative potency of the PAR2 agonists in each cell line
using the calcium assay method, and to study the impact on PAR2
activation of mutations at selected points in the PAR2 receptor
tethered ligand sequence, versus receptor activation by comparable
soluble peptides having the tethered ligand sequences. Representative calcium signaling responses of PAR2 variants are shown in Fig. 3. Equivalent responses were produced by
trypsin in the PAR2 wild type (PAR2SR/EE, Fig. 3A, middle trace) and in
all mutant cell lines (Fig. 3, B-D), whereas the magnitude of the
responses caused by the soluble peptides differed from each other. In
PAR2SR/RR, with the EE232,233RR mutation in ECL2 (Fig. 3B), the
trypsin-revealed tethered ligand SLIGRL... fully activated the
receptor compared with a minimal activation by the corresponding
soluble peptide SLIGRL-NH2
(SR-NH2). Similarly, in PAR2SE/EE (Fig. 3C) and
PAR2SA/EE (Fig. 3D), with mutations in the tethered ligand, the
trypsin-revealed tethered ligands SLIGEL... and SLIGAL... fully
activated the receptors compared with minimal activation by the
corresponding soluble free peptides, SLIGEL-NH2
(SE-NH2) and SLIGAL-NH2
(SA-NH2), respectively. The reverse peptide
LSIGRL-NH2 (400 µM) elicited no calcium signal in any of the cell lines tested, and trypsin at 40 nM failed to elicit
a calcium signal in the negative control construct, PAR2R36A that lacks
the trypsin cleavage/activation site (data not shown).
|
Concentration-Effect Curves for Trypsin and PAR2APs in PAR2
Variant-Transfected Cell Lines.
Concentration-effect curves were
obtained for the stimulation of cytosolic calcium release by the action
of trypsin and the soluble PAR2APs SLIGRL-NH2,
SLIGAL-NH2, and SLIGEL-NH2
in the PAR2 variants (Figs. 4 and
5). In agreement with our previous observations (Al-Ani et al., 1999a
) and as shown in Fig. 4A, the soluble peptide SLIGRL-NH2 was a very weak
agonist in activating the mutant PAR2 receptor (PAR2SR/RR) that has the
ECL2 acidic residues
E232E233 mutated to basic
R232R233 residues but has
the wild-type tethered ligand sequence (SLIGRL... ). Compared with
wild type PAR2SR/EE, the activity of the soluble peptide
SLIGRL-NH2 was reduced over 100-fold in
PAR2SR/RR. In marked contrast, the corresponding trypsin-revealed
tethered ligand SLIGRL... was equally effective in activating either
the wild-type or the mutated receptor with basic residues in ECL2
(PAR2SR/RR; Fig. 4B). Because we had previously observed that the
soluble peptides SLIGEL-NH2 and
SLIGAL-NH2 had markedly (more than 100-fold) reduced activity for activating PAR2, we next changed the
parent-tethered ligand (SLIGRL... ) to SLIGEL... and SLIGAL...
and compared the activity of these tethered ligand mutants with
corresponding soluble peptides SLIGEL-NH2 and
SLIGAL-NH2. There were disparate
concentration-effect curves for the soluble PAR2APs but only small
shifts in the trypsin concentration-effect curves in the PAR2 wild-type
and mutant cells in the calcium signaling assay (Fig. 4, C-F). The
activity of SLIGEL-NH2 (Fig. 4C) and
SLIGAL-NH2 (Fig. 4E) were markedly reduced in
PAR2SR/EE, PAR2SE/EE, and PAR2SA/EE compared with
SLIGRL-NH2. In contrast, the corresponding
trypsin-revealed tethered ligands SLIGEL... (Fig. 4D) and
SLIGAL... (Fig. 4F) were equivalent in activity compared with the
parent wild-type tethered ligand SLIGRL... (Fig. 4, B, D, and F).
|
|
Relative Activities (REC values) of Trypsin and PAR2APs
for Activating PAR2 Variants.
The activities of trypsin and the
soluble peptide agonists in the mutated receptor constructs (calcium
response) were calculated relative to their activities in the wild-type
PAR2, as we have done previously for PAR2 receptor mutants (Al-Ani et
al., 1999a
) (REC, PAR2R/EE; Tables 1 and
2). Use of the REC
values permits potency comparisons between agonist concentration-effect
curves without requiring a precise estimate of
Emax and EC50
values. As an alternative way of expressing the relative activities of the soluble peptides SLIGAL-NH2 and
SLIGEL-NH2, their potencies in each cell line
were expressed relative to the action of
SLIGRL-NH2, which represents the wild-type
soluble PAR2AP (REC, SLIGRL-NH2; Table
3). Half-maximum effective concentration
(EC50) values for trypsin in the different PAR2
constructs were also determined from trypsin concentration-effective
curves, wherein it was possible to estimate
Emax (Table 1).
|
|
SLIGRL-NH2
SLIGAL-NH2
SLIGEL-NH2; and 2) for all ECL2 EE232,233RR mutated constructs: trypsin
>
SLIGEL-NH2 > SLIGRL-NH2
SLIGAL-NH2. Notwithstanding, as already
pointed out the potency of trypsin for receptor activation via the
revealed tethered ligand was equivalent among all of the receptor
variants, including the wild-type receptor (Table 1).
Cell Growth Inhibition.
We also wanted to investigate whether
the observed differences in the potencies for receptor activation by
trypsin and the soluble peptides as monitored in the rapid calcium
response might also be reflected by differences in potencies for
causing a delayed cellular response (inhibition of cell growth).
However, we do recognize the complexity of monitoring a delayed
cellular response, in this case, inhibition of cell growth, in response
to PAR2 activation. This complexity arises because of a lack of
knowledge about intracellular signals that regulate growth inhibition
and because of a possible interaction of other unknown factors in this
process. In our study, we compared the cell growth inhibition obtained
from activation of the PAR2SR/RR and wild-type PAR2SR/EE constructs
having the same revealed tethered ligand sequences but a difference in
ECL2 motif. Cell growth inhibition was monitored in KNRK cells
transfected with the rat PAR2 variants after challenging these cells
with either trypsin or PAR2APs. As shown in Fig.
6, activation of the PAR2 variants by
trypsin caused equivalent inhibition of cell growth (about 25%),
whereas there were marked differences between the PAR2SR/EE and
PAR2SR/RR in the ability of the soluble PAR2APs to cause an inhibition
of cell growth. Also, a comparable inhibition of cell growth
(about 25%: same as for the wild-type receptor) was obtained by
trypsin activating the PAR2SE/EE variant (data not shown). As in the
calcium assay, the reverse peptide, LSIGRL-NH2 (200 µM) failed to inhibit cell growth in all of the PAR2 variants.
|
| |
Discussion |
|---|
|
|
|---|
A principal objective of our study was to determine whether PAR2
peptide sequences acting either as trypsin-revealed tethered ligands or
as free soluble peptides had the same relative activities for
triggering the receptor. Therefore, structure-activity relationship studies were done both for mutated receptors, with changes in the
trypsin-revealed tethered ligand sequence and with soluble receptor-activating peptides having a sequence identical to the first
six amino acids of the trypsin-revealed tethered ligand. The activities
of these sequences either as tethered ligands or as soluble peptides
were evaluated in receptors having either wild-type extracellular loop
2 or a mutated ECL2 sequence (EE232,233RR) at a site thought to play a
major role in receptor activation by soluble peptides (Lerner et al.,
1996
; Al-Ani et al., 1999a
). The relative activities of the tethered
ligand sequences were reflected by the relative potencies of trypsin
for receptor activation.
One of our main findings was that there were very small differences in
the potency (EC50 values) or maximum effect for
trypsin, working via the revealed tethered ligand, to activate a number of PAR2 variants with mutations: 1) in the tethered ligand sequence (position 5 of the trypsin-exposed peptide), 2) in extracellular loop 2 (EE232,233RR) or 3) concurrently at sites both in the tethered ligand
and in ECL2. The data obtained with trypsin therefore indicated that,
irrespective of the mutated receptor sequences studied, full receptor
activation was achieved. These results, demonstrating comparable
potencies and effects for trypsin in the several receptor mutants, were
entirely in accord with our preliminary work with the ECL2 receptor
mutant PAR2SR/RR (Al-Ani et al., 1999a
). In keeping with our previous
work, the data in Fig. 4, A and B, illustrate the proximity of the
concentration-response curves for trypsin in PAR2SR/EE and PAR2SR/RR,
but the marked separation between distinct concentration-effect curves
for the soluble PAR2AP SLIGRL-NH2 in the same two
receptor constructs. From the data obtained for activation of the
receptors with trypsin, one can conclude that the trypsin-revealed
tethered ligand sequences SLIGRL... , SLIGAL... , and
SLIGEL... display equivalent abilities to activate the receptor, whether or not ECL2 possesses the EE232,233RR acidic to basic mutation.
In contrast with the comparable EC50 values for
trypsin in the various receptor mutants, the relative potencies of the
soluble PAR2APs SLIGRL-NH2,
SLIGAL-NH2, and SLIGEL-NH2
differed considerably. These EC50 differences
were evident not only in the wild-type receptor (PAR2SR/EE; Table 3),
in keeping with our previous findings in intact tissue and
receptor-expressing cells (Hollenberg et al., 1996
; Al-Ani et al.,
1999a
), but also in receptors with the EE232,233RR mutation in ECL2
(Tables 2 and 3). For instance, in all receptors with the wild-type
ECL2 (E232E233), either
SLIGAL-NH2 or SLIGEL-NH2 as
free peptides were 20- to 130-fold less potent than the tethered
ligand-derived peptide SLIGRL-NH2. These large
differences can be compared with the relatively small (2-fold at most)
differences in the EC50 values for trypsin in receptors possessing the
corresponding mutated tethered ligand sequences (see PAR2SA/EE and
PAR2SE/EE; Table 1). In the receptors with the mutation in ECL2
(EE232,233RR), SLIGAL-NH2 was about 10-fold less
potent than SLIGRL-NH2 (Table 3), whereas the
comparable tethered ligand SLIGAL... revealed by trypsin was only 2- to 3-fold less active than the parent sequence SLIGRL... (Table 1).
In line with our previous observations (Al-Ani et al., 1999a
), and in keeping with E260 mutations in human PAR1
(Nanevicz et al., 1995
), SLIGEL-NH2, relative to
SLIGRL-NH2, was somewhat more active in all of
the EE232,233RR mutants (Table 3) than it was in those receptors having
the wild-type ECL2 sequence
(E232E233). In comparing
the relative activities (REC,PAR2SR/EE; Table 2)
of SLIGEL-NH2 between those receptors with the
EE232,233RR ECL2 mutation and the receptors with the wild-type
E232E233 sequence in ECL2,
it was possible to calculate about a 2- to 5-fold increase
in the potency of SLIGEL-NH2 conferred by the basic residues in ECL2. In contrast, there was essentially no difference in the activity of the trypsin-revealed tethered ligand acting either in the wild-type receptor (PAR2SR/EE), or in the receptor
having the complementary charge changes both in the tethered ligand
sequence (SLIGEL... ) and in ECL2, i.e., PAR2SE/RR, with ECL2
possessing R232R233 (Table
1). Notwithstanding, in no way did the acidic to basic changes in the
ECL2 mutant EE232,233RR compensate sufficiently to bring the potency of
SLIGEL-NH2 back to that of
SLIGRL-NH2 in the wild-type receptor (PAR2SR/EE;
compare Figs. 4, A, C, and E with 5, A and C). The differential
activation of calcium signaling by trypsin and agonist peptide implies
an increased efficacy of the tethered ligand versus the free peptide.
Whether this increase is due to differential ligand-receptor binding,
receptor-G protein coupling and signaling, or both remains to be
determined. It is also feasible that the intact N-terminal sequence
might partially hinder access of the peptide to its binding site.
However, the lack of shift of the concentration-effect curve for
trypsin in the SR/EE and SR/RR receptors (Fig. 4B) would argue against
a dramatic change in receptor conformation that might be responsible for the marked difference in potency of
SLIGRL-NH2 in the two PAR2 receptors (Fig. 4A).
Observations with the soluble PAR-APs SFLLEN-NH2
and SLIGEL-NH2 in human PAR1 (Nanevicz et al.,
1995
) and in rat PAR2 (Al-Ani et al., 1999a
), respectively, using
receptors with complementary acidic-to-basic changes in ECL2 (human
PAR1, E260R; rat PAR2, EE232,233RR) indicate that there may be charge
complementation between the basic arginine residue at position 5 of the
soluble PAR-APs, and acidic glutamic acid receptor residues in ECL2
(E260 for human PAR1;
E232E233 in rat PAR2). It
was suggested (Nanevicz et al., 1995
; Al-Ani et al., 1999a
) that the
ECL2 acidic motif (E260 in human PAR1 or
E232E233 in rat PAR2) might
play an important role in interacting with the basic arginine residue
in the proteinase revealed tethered ligand (SFLLRN... for
human PAR1; SLIGRL... for rat PAR2). Our new data, although
supporting that hypothesis for the action of soluble PAR-APs, argue
strongly against such a charge complementation for the
proteinase-revealed tethered ligand sequence. The strongest data
arguing against charge complementation between position 5 of the
revealed tethered PAR2 ligand and the charge(s) at position(s) E232E233 of ECL2 can be
seen in Figs. 4, B and F, 5D, and 6. Clearly, having either the same or
complementary side chain charges at positions 5 of the tethered ligand
and positions 232/233 in ECL2 of PAR2 had little impact on the
activation of the receptor by the trypsin-revealed tethered ligand.
This conclusion was supported by data obtained both with the calcium
signaling assay (Figs. 4 and 5) and with the growth inhibition assay,
where trypsin was equally effective in either the wild-type receptor or
the PAR2SR/RR mutant (Fig. 6). Conversely, as mentioned above, such
charge changes in ECL2 of the PAR1 and PAR2 receptors have been
observed to have a marked influence on the activities of the soluble
PARAPs with differing charges at position 5. Our data complement well
and considerably extend work done with human PAR1 (Blackhart et al., 2000
). In that study, which appeared upon completion of our work, the
change of an acidic to neutral mutation in ECL2 (E260A) had a very
modest effect on activation by thrombin and essentially no effect on
activation by the soluble PAR1AP SFLLRN-NH2
(Nanevicz et al., 1995
). Indeed, other data obtained with PAR1 mutants
imply a much more prominent role for the aspartic acid residue at
position 256 and the glutamic acid residue at position 347 of human
PAR1 for the activity of soluble PAR1APs compared with
E260 (Blackhart et al., 2000
). Because our data
for trypsin activation of the PAR2 variants would argue against a
charge-charge interaction of the tethered ligand with the ECL2 site at
E232E233 of PAR2, we
suggest looking elsewhere in the extracellular loops for the site(s) of
tethered ligand docking.
As outlined above, our results indicating marked differences in the
activation of PAR2 by the soluble PARAPs, compared with equivalent
activation by the trypsin-revealed tethered ligands extend the work
done with mutants of PAR1 that do not respond to soluble PAR1APs, but
do respond to thrombin (Blackhart et al., 2000
). For instance, in human
PAR1 receptor mutants either missing a portion of extracellular loop 3 (hPAR1:
EC339-344) or with an aspartic acid to alanine mutation at
position 256 of ECL2 (hPAR1 D256A), the soluble PAR1AP
SFLLRNP-NH2 that still bound to the mutated
receptor lacked activity, whereas the same sequence revealed by
thrombin as a tethered ligand seemed active (Blackhart et al., 2000
).
The work with the PAR1 mutants did not, however, explore in any way the
structure-activity relationships for the tethered ligand sequence.
Taken together, our new work with PAR2 variants with alterations in the
tethered ligand sequence and the parallel work with PAR1 receptors
resistant to activation by a soluble PAR1AP, but activated by thrombin,
indicate that the SARs for the receptor-triggering sequence acting as a
tethered ligand seem to differ from the SARs for the soluble
receptor-activating peptides. Thus, further work remains to be done to
identify with confidence, the extracellular receptor docking site(s) of
the revealed tethered ligands for both PAR1 and PAR2.
| |
Footnotes |
|---|
Accepted for publication February 7, 2002.
Received for publication December 14, 2001.
1 Amino acids are abbreviated by their one-letter code.
These studies were supported in large part by a Term Grant from the Canadian Institutes of Health Research (formerly Medical Research Council of Canada) and by ancillary support from a Kidney Foundation of Canada operating grant and a Health Research Foundation Rx and D Graduate Studentship (to S.J.W.).
Address correspondence to: Dr. Bahjat Al-Ani, Department of Pharmacology and Therapeutics, Health Sciences Centre University of Calgary, 3330 Hospital Dr. NW., Calgary AB, Canada T2N 4N1. E-mail: alani{at}ucalgary.ca
| |
Abbreviations |
|---|
PAR, proteinase-activated receptor; AP, activating peptide; ECL2, extracellular loop 2; SAR, structure-activity relationship; PCR, polymerase chain reaction; KNRK, Kirsten virus-transformed rat kidney; FACS, fluorescence-activated cell sorting; B5, antibody targeted to the cleavage/activation sequence (GPNSKGRSLIGRLDTP) of rat PAR2; DMEM, Dulbecco's modified Eagle's medium; REC, relative effective concentration.
| |
References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. Afkhami-Goli, F. Noorbakhsh, A. J. Keller, N. Vergnolle, D. Westaway, J. H. Jhamandas, P. Andrade-Gordon, M. D. Hollenberg, H. Arab, R. H. Dyck, et al. Proteinase-Activated Receptor-2 Exerts Protective and Pathogenic Cell Type-Specific Effects in Alzheimer's Disease J. Immunol., October 15, 2007; 179(8): 5493 - 5503. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Ayoub, D. Maurel, V. Binet, M. Fink, L. Prezeau, H. Ansanay, and J.-P. Pin Real-Time Analysis of Agonist-Induced Activation of Protease-Activated Receptor 1/G{alpha}i1 Protein Complex Measured by Bioluminescence Resonance Energy Transfer in Living Cells Mol. Pharmacol., May 1, 2007; 71(5): 1329 - 1340. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. McLaughlin, L. Shen, M. Holinstat, J. D. Brooks, E. DiBenedetto, and H. E. Hamm Functional Selectivity of G Protein Signaling by Agonist Peptides and Thrombin for the Protease-activated Receptor-1 J. Biol. Chem., July 1, 2005; 280(26): 25048 - 25059. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Noorbakhsh, N. Vergnolle, J. C. McArthur, C. Silva, M. Vodjgani, P. Andrade-Gordon, M. D. Hollenberg, and C. Power Proteinase-Activated Receptor-2 Induction by Neuroinflammation Prevents Neuronal Death during HIV Infection J. Immunol., June 1, 2005; 174(11): 7320 - 7329. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Al-Ani, K. K. Hansen, and M. D. Hollenberg Proteinase-Activated Receptor-2: Key Role of Amino-Terminal Dipeptide Residues of the Tethered Ligand for Receptor Activation Mol. Pharmacol., January 1, 2004; 65(1): 149 - 156. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Al-Ani and M. D. Hollenberg Selective Tryptic Cleavage at the Tethered Ligand Site of the Amino Terminal Domain of Proteinase-Activated Receptor-2 in Intact Cells J. Pharmacol. Exp. Ther., March 1, 2003; 304(3): 1120 - 1128. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||