|
|
|
|
Vol. 302, Issue 2, 795-803, August 2002
-Hydroxylase and Its Truncated Protein Isoform in Vitro
but Distribute Poorly into A549 Tumors in Vivo
Bristol-Myers Squibb Company, Wilmington, Delaware
| |
Abstract |
|---|
|
|
|---|
Alternative splicing of the human
-aspartyl (asparaginyl)
hydroxylase (BAH) gene results in the expression of
humbug, a truncated form of BAH that lacks the catalytic
domain of the enzyme. Overexpression of BAH and humbug
has been associated with a variety of human cancers, and although
humbug lacks enzymatic activity, it is expressed at
levels comparable with that of BAH in various cancer cell lines. Phosphorothioate antisense oligonucleotides (ONs) were designed to
dissect out the function of these hydroxylase protein isoforms. In A549
cells, these ONs differentially down-regulated BAH and humbug at the mRNA and protein level. Phosphorothioate
ON uptake and antisense studies were conducted in parallel in nude mice bearing A549 tumor xenografts. Microscopic examination of the tumor
after administration of a fluorescein-labeled ON showed strong labeling
of the outer layers of the tumor connective tissue but cells within the
interior of the tumor were sparsely labeled. A modest but significant
effect on tumor growth was observed in animals treated with an
antisense ON directed against both BAH and humbug
transcripts. However, Northern analysis of tumor RNA did not indicate a
down-regulation of the targeted mRNA species. These results demonstrate
the successful development of antisense ONs that selectively
differentiate between the closely related
-hydroxylase protein
isoforms. However, determination of the biological function of these
proteins in vivo was limited by the poor uptake properties of
phosphorothioate ONs in A549 tumors.
| |
Introduction |
|---|
|
|
|---|
Analysis of gene function with
the aid of antisense technology provides an opportunity to dissect out
the biological function among proteins that share significant sequence
homology. Recently a locus was identified in which three different
genes (BAH, humbug, and junctin) share
exons but differ significantly in sequence composition based upon the
use of alternative terminal exons (Dinchuk et al., 2000
). Although
junctin has been assigned a function as an integral member
of the ryanodine receptor complex (Jones et al., 1995
; Zhang et al.,
1997
, 2001
), the possible functions of BAH and humbug remain
unclear. In the mouse, there are three BAH-related transcripts that are
2.8, 4.5, and 6.6 kb. The two larger transcripts encode full-length
catalytically active BAH protein and differ only in the use of
alternative polyadenylation signals. The shortest transcript,
humbug, which is also known as junctate, encodes a highly
charged protein with no known catalytic function (Dinchuk et al.,
2000
). Full-length BAH protein catalyzes the addition of hydroxyl
groups to particular Asp or Asn residues within cEGF domains of
numerous proteins, including clotting factors, Notch and its ligands,
and a variety of other biologically important molecules (Rebay et al.,
1991
; Stenflo, 1991
; Downing et al., 1996
; Goruppi et al., 1997
). The
function(s) of this hydroxylation has not yet been defined, although
the fact that some of these motifs are involved in protein-protein
interaction has raised the possibility that hydroxylation may modulate
certain receptor-ligand interactions (Monkovic et al., 1992
;
Lavaissiere et al., 1996
). Some data suggest that the charged region of
humbug may play a role in modulating calcium release
(Dinchuk et al., 2000
; Treves et al., 2000
).
Because overexpression of BAH and humbug has been
associated with a variety of human cancers, a possible role for BAH in
tumorigenesis has been suggested (Lavaissiere et al., 1996
; Ince et
al., 2000
). There are three BAH-related transcripts in humans that are
5.2, 4.5, and 2.9 kb. Interestingly, humbug (2.9 kb), which
lacks catalytic activity, is as abundantly expressed as BAH (5.2 and
4.5 kb) in all the different cell lines examined (vide infra). To
investigate possible functions of the
-hydroxylase isoforms,
antisense ON tools capable of distinguishing between full-length BAH
and humbug were developed. Ability of these ONs to inhibit
mRNA and protein expression was demonstrated in vitro in the A549 human
lung carcinoma line, and several ONs were further characterized through
dose-response and time course studies. Application of
fluorescein-labeled phosphorothioate ONs to an in vivo xenograft model
revealed a surprising inability of these antisense reagents to
effectively penetrate the tumor. Modest effects on tumor growth,
together with the absence of
-hydroxylase down-regulation in the
tumor upon antisense treatment are consistent with the poor tumor
uptake of ONs observed. Investigation into the possible functions of
-hydroxylase was therefore inconclusive. These data highlight the
need for strategies that will enhance delivery of phosphorothioate ONs
to solid tumors.
| |
Materials and Methods |
|---|
|
|
|---|
ON Synthesis.
All ONs used in these studies, with the
exception of ON 1001, were 20 nucleotide 2'-deoxyribonucleotide
phosphorothioate ONs and were synthesized and purified as described
previously (Ho et al., 1996
). Sequences of ONs used are as follows: ON
79, GGCATTCTTACGCTGGGCCA; ON 79M,
GGAATTGTTAGGCTCGGACA;
ON 1302, GGGACATCAGGTAGGCTGGC; ON 1302M,
GGGCATGAGGAAGGGTGGC; ON 1001, agcTTTAAGTATCTGGTGGTac; ON 1001M,
agcGTTAGTAACTCGTGTac; and ON 962 (an ON
sequence unrelated to the
-hydroxylase gene), TGACGCAGCGGCACCAGACC.
Uppercase bases denote 2'-deoxyribonucleotide residues, and lowercase
bases denote 2'-methoxy-ribonucleotide residues. Underlined nucleotides
form mismatches with the target RNA. ONs conjugated with fluorescein at
the 5' end were synthesized using fluorescein phosphoramidites (Glen
Research, Sterling, VA) according to manufacturer's instructions.
Cell Culture. Human A549 lung carcinoma cells were obtained from the American Type Culture Collection (Rockville, MD) and cultured in Dulbecco's modified Eagle's medium containing 1 g/l glucose (Invitrogen, Carlsbad, CA). The medium was supplemented with 10% fetal bovine serum (FBS), 2 M glutamine, 100 units/ml penicillin, and 10 µg/ml streptomycin. Cells were routinely passaged at 85 to 90% confluence in T-225 flasks. The cells were plated onto 60-mm culture dishes and 100-mm culture dishes for Northern or Western blot analysis, respectively.
Treatment of Cells with ONs. A549 cells at 80 to 85% confluence were washed twice with prewarmed Opti-MEM (Invitrogen). Opti-MEM containing lipofectin (Invitrogen; 10 µg/ml for Northern analysis or 12.5 µg/ml for Western analysis) was added to the cells. The ONs were then added from a 10 µM stock (0.4 µM final ON concentration). The cells were incubated for 4 h at 37°C, and the medium containing the lipofectin was aspirated off. The cells were washed twice with Dulbecco's modified Eagle's medium/10% FBS and incubated with Dulbecco's modified Eagle's medium/10% FBS. Cells used for Northern blot analysis were incubated for 16 h, whereas cells used for Western blot analysis were incubated for 72 h or longer, and a second application of ON was applied at the 48-h time point.
Northern Blot Analysis.
Total cellular RNA was isolated
using the RNeasy Mini kit (QIAGEN, Valencia, CA) according to the
manufacturer's protocol. Total RNA (10-15 µg) was
poly(A)+ selected using the MicroPoly(A)
+ Pure kit (Ambion, Austin, TX). The mRNA was
precipitated and separated on a 1.2% agarose/formaldehyde gel,
transferred to a nylon membrane (Hybond N; Amersham Biosciences,
Piscataway, NJ) by capillary action, and cross-linked. The blots were
prehybridized for 1 h at 42°C in UltraHyb (Ambion) and
simultaneously probed using cDNAs specific for BAH and for
glyceraldehyde-3-phosphate dehydrogenase (G3PDH). The probes were
generated by random priming and radiolabeled using
[
-32P]dCTP according to manufacturer's
protocol (DECAprime II; Ambion). G3PDH, BAH, and humbug
bands were visualized and quantified using a PhosphorImager (Molecular
Dynamics, Sunnyvale, CA). Potential unequal loading of the lanes was
corrected for by normalizing the BAH and humbug bands to the
G3PDH present in each lane.
Western Analysis.
Cells treated with antisense ONs were
harvested and resuspended in 1.1× LDS sample buffer (Invitrogen) to a
final concentration of 2 × 106 cells/ml.
Protein quantitation was performed using the DC protein assay (Bio-Rad,
Hercules, CA). Twenty-five micrograms of protein lysate was
fractionated on a 4 to 20% acrylamide Tris glycine gel (Novex, San
Diego, CA) for 1 h at 150 V. Protein was transferred onto a
nitrocellulose membrane by electrotransfer and blocked in 5% nonfat
milk in phosphate-buffered saline/0.5% Tween. Blots were probed with
primary antibody (FB-50, 1:5000 dilution; anti-G3PDH, 1:300 dilution;
or actin). FB-50 was the kind gift of Dr. Jack R. Wands (Lavaissiere et
al., 1996
). FB-50 incubations were carried out at 4°C overnight,
whereas the G3PDH antibody was incubated for 1 h at room
temperature. Secondary antibody detection was performed using the
Western Breeze kit (Invitrogen) according to manufacturer's instructions.
Experimental Animals. Female athymic Swiss nu/nu mice at 6 to 8 weeks of age were obtained from Taconic Farms (Germantown, NY) and were free of known pathogens at the time of use. The animals were housed 10 per cage in polycarbonate, filter-capped micro-isolation cages in temperature-controlled rooms maintained in a barrier facility on 12-h light/dark cycles and provided food and water ad libitum. All animal studies were conducted in a facility accredited by The American Association for the Accreditation of Laboratory Animal Care.
A549 Xenograft Study.
A549 human lung epithelial cells were
implanted s.c. in the inguinal area of the nude mice at 1 × 107 (0.01 ml) per mouse. Tumors were measured
using perpendicular diameters, and the volume was calculated using the
formula for a prolate ellipsoid as described previously (Wexler et al.,
2000
). Before the first dose, the animals were randomized so there were no significant differences in tumor volumes among groups (75 ± 5 mm3). Starting on day 21, the ONs 79 and 79M were
injected s.c. at 13.5 mg/kg/day, rotating injection sites to prevent
scarring. At the termination of the study, tumors were removed and
weighed. Tumor tissue was trimmed, connective tissue was removed, and
the tumor was cut into four pieces and stored in RNALater (Ambion) at
20°C until processed for Northern blot analysis.
Visualization of Fluorescent ONs.
In the first uptake
experiment, tumor-bearing mice from the above-described xenograft study
were injected with fluorescein-labeled ON 79 after having received 13.5 mg/kg of ON 79 for 14 days. In the second study, tumor-bearing mice
were injected with 13.5 mg/kg of either ON 79, ON 1302, or ON 962. All
mice were euthanized 4 and 24 h after administration of
fluorescein-labeled ON and the tumor, liver, and kidney were collected
immediately into 10% neutral buffered formalin. Tissues were processed
and paraffin embedded according to the following schedule: 6 h in
10% neutral buffered formalin; 3 h in 80% ethanol; 1 h in
95% ethanol 2×; 1 h in 100% xylene 3×; 1 h in paraffin;
and finally, 0.5 h in paraffin (Tissue Processor Tissue-Tek II;
Labtek, Tokyo, Japan). Tissue blocks were sectioned at 4 µm
(Microtome Cut 4055; Olympus, Lake Success, NY), and sections were
placed onto silane-coated glass slides (Polysciences, Warrington, PA)
and stored at
80°C. Samples were rehydrated the day of
visualization, counterstained, and coverslipped with Vectashield
containing propidium iodide (Vector Laboratories, Burlingame,
CA). Separate photomicrographs of the tissue for fluorescein and
propidium iodide were collected and overlaid to create two color images
of the distribution of the ONs within the tissues. Fields were viewed
at 10, 40, and 100× in oil, using the AX70 microscope (Olympus), the
MCID M5 image collection system (Imaging Research, St. Catherines,
Ontario, Canada), and a videocamera (DXC-970MD; Sony, Tokyo, Japan).
Processing of Tumor for Northern Analysis.
Tumor sections
were removed from buffer and cut into smaller pieces in a sterile Petri
dish. The pieces were placed in a 14-ml Falcon tube with buffer RLT
(QIAGEN Midi RNA kit) and homogenized with a polytron for 30 to 45 s. The resulting lysate was frozen at
80°C until ready for use. The
samples were thawed in a 37°C bath to eliminate any precipitation.
Total RNA was isolated using the QIAGEN Midi RNA kit.
Statistics. Statistical differences were determined using the Student's t test. A p < 0.05 was considered significant.
| |
Results |
|---|
|
|
|---|
BAH RNA transcripts obtained from an expression plasmid encoding
the full-length coding sequence of the BAH gene were probed with ON
libraries to identify sites in the RNA that may be accessible to
antisense ON hybridization (Ho et al., 1996
, 1998
, 1999
). Such regions
in the BAH RNA were located by using ribonuclease H, which produces
endonucleolytic cleavages in the RNA only at sites that are hybridized
with DNA (from the ON libraries). Sequencing of the resulting RNA
fragments revealed the location of these accessible sites. Antisense
ONs, 20 nucleotides in length and consisting of the
2'-deoxyribonucleotide phosphorothioate chemistry, were synthesized to
target these sites (Fig. 1A).
|
To determine the ability of these ONs to interfere with BAH expression,
RNA isolated from ON-treated A549 cells was examined by Northern blot
analysis. The degree of reduction of
-hydroxylase RNA transcripts
was determined relative to RNA obtained from cells incubated in the
absence of any ON. Alternate splicing at nucleotide position 1011 results in the 2.9-kb humbug message. Most of the ONs tested
produced substantial reductions of BAH RNA (Fig. 1B). Sequences
upstream of nucleotide 1011 down-regulated both BAH and
humbug expression. However, sequences targeted downstream of
nucleotide 1011 were complementary only to the full-length BAH
transcript and were ineffective at reducing levels of
humbug.
Eight different antisense ONs directed against exon 14a of
humbug (Fig. 2A) were chosen
based on thermodynamic considerations (Oligo Primer Analysis Software,
version 5.0; National Biosciences, Plymouth, MN). Although all eight
sequences (ONs A-H) reduced humbug expression (Fig. 2B),
these ONs did not exhibit the desired selectivity for humbug
but reduced expression of full-length BAH RNA to approximately the same
degree as well.
|
To enable selective targeting of humbug, an ON was designed to hybridize across the exon 13-exon 14a junction that is unique to the humbug transcript (Fig. 2A). Analysis of this antisense sequence revealed that the ON possessed low thermodynamic stability due to a preponderance of A-T base pairs, and this was confirmed by the poor efficacy of the ON when tested in A549 cells. The 2'-methoxy-ribonucleotide chemistry was therefore incorporated to increase the affinity of this sequence for its target RNA. The resulting ON 1001 effectively reduced levels of humbug without producing significant effects on BAH mRNA.
In addition to ON 1001, which is selective for humbug, two other sequences, ON 79 (which targets both BAH and humbug) and ON 1302 (which is selective for BAH RNA), were chosen for further characterization. Mismatch control ONs were synthesized and dose-response experiments were conducted on the antisense and mismatch molecules. Although the antisense ONs produced dose-dependent effects on RNA expression (ON 79 on all three RNA molecules, ON 1302 on BAH RNA, and ON 1001 on humbug RNA), their mismatch control sequences had minimal effects (Fig. 2C).
Examination of protein lysates by Western analysis showed a substantial
degree of protein inhibition 72 h after antisense treatment with
ONs 79, 1302, and 1001 (Fig. 3A). As in
the Northern analyses, target selectivity was observed. ON 79 inhibited
expression of BAH and humbug proteins, whereas ON 1302 selectively reduced BAH protein expression. ON 1001 reduced
humbug and not BAH protein levels. The mismatch control ONs
did not alter BAH and humbug protein expression levels to
any appreciable extent. An 8-day study showed that protein expression
could be reduced for an extended period by repeated administration of
ON 1302 (on days 0 and 2) (Fig. 3B). BAH protein expression recovered
upon withdrawal of the antisense ON. The pattern of expression of BAH
and humbug was examined in several lung cell lines,
including A549 cells (Fig. 4). Northern
analysis showed the presence of BAH and humbug mRNA in all
cells lines with the exception of the adenocarcinoma H522 cells (Fig.
4A). Interestingly, despite the absence of catalytic activity in
humbug, the message and protein of this
-hydroxylase isoform are expressed in substantial quantities relative to full-length BAH.
|
|
Nude mice bearing A549-derived tumors were dosed subcutaneously once a
day at 13.5 mg/kg with ON 79 and its mismatch control sequence ON 79M.
An uptake study designed to determine the efficiency of
phosphorothioate ON uptake and distribution in A549 tumors was
conducted simultaneously as part of the xenograft experiment. Because
fluorescence microscopy is among the simplest and most sensitive of
methods for determining ON localization (Butler et al., 1997
), uptake
was investigated using fluorescein-labeled ON 79. Two of the mice were
injected with a single dose of fluorescein-labeled ON 79 after 14 consecutive days of dosing with unlabeled ON 79. H&E staining revealed
tumors that were encapsulated, poorly vascularized, and heterogeneous
in nature (Fig. 5, A and B). Areas in the
periphery of the tumor seemed viable, whereas regions within the tumor
interior contained a mixture of necrotic cells and morphologically
viable cells. Although fluorescein-labeled ON 79 was consistently
observed within the connective tissue and the periphery of the tumor
(Fig. 5, C and E), there was poor penetrance of the ON to the interior regions of the tumor (Fig. 5, D and E). However, fluorescent signals that were observed in the tumor interior were in the same planes of
focus as the nuclei and the cytoplasm of the tumor cells (Fig. 5E),
indicating some intracellular localization.
|
Figure 6A shows the tumor volumes of the
mice from days 21 to 44. The average tumor volume of the
antisense-treated group was significantly less (p < 0.05) than either of the other two control groups on days 39 and 44 of
the study. ON 79 produced a 23% reduction in tumor volume. At the
conclusion of the experiment, RNA from the tumors was examined by
Northern analysis (Fig. 6B). No differences in BAH or humbug
RNA levels were observed among the various treatment groups. This
finding was confirmed by real-time polymerase chain reaction analysis
of the RNA.
|
In a separate experiment, three different ONs were injected
subcutaneously into nude mice to determine whether a sequence-dependent effect on ON uptake exists in tumors. The results obtained do not
reveal any appreciable differences in the pattern of ON uptake (Fig.
7, A-D). Consistent with data obtained
previously using ON 79, ONs 1302 (Fig. 7C) and 962 (Fig. 7D) did not
penetrate into the tumor interior to any significant extent but seemed
to be largely associated with the extracellular matrix. This
observation is in contrast with Fig. 7, E and F, which shows effective
penetration of ON into the liver and kidney. As with the tumor cells,
fluorescent ON was found within the hepatocytes (Fig. 7E) and
epithelial cells of the kidney (Fig. 7F) (fluorescent signals were in
the same planes of focus as the nuclei and the cytoplasm). The
distribution pattern of ON in all the tissues examined was stable for
at least 5 months.
|
| |
Discussion |
|---|
|
|
|---|
Overexpression of
-hydroxylase protein has been reported in
various carcinomas and transformed cell lines (Lavaissiere et al.,
1996
). In those studies,
-hydroxylase was detected using the FB-50
antibody, which we now know recognizes both full-length and truncated
forms of the protein (Dinchuk et al., 2000
). humbug lacks
the catalytic domain of the
-hydroxylase protein, but in spite of
the absence of enzymatic activity, it is abundantly expressed in
various lung cell lines (Fig. 4) and other transformed lines (data not
shown). These observations raise the question of the role of BAH and
humbug in pathophysiology, particularly in cancer. Therefore, in an attempt to study the biological role of BAH and humbug, an antisense ON approach was used to selectively and
differentially down-regulate the expression of the various
-hydroxylase isoforms.
Because RNA molecules have extensive secondary and tertiary structure,
not all regions of an RNA molecule are equally accessible to
hybridization with an antisense ON. The RNA mapping approach facilitated the identification of numerous active sequences both upstream and downstream of the exon 13-exon 14 splice junction of BAH,
with ONs targeting regions downstream of the splice junction being
selective for only BAH mRNA (Fig. 1B). Antisense ONs directed against
the 3'-untranslated region of humbug (exon 14a) unexpectedly reduced both humbug and BAH mRNA expression. In addition,
each of these ONs (A-H) reduced BAH and humbug to
similar levels (Fig. 2B). These observations suggest the possibility
that ONs A through H may be acting on a molecular target common to BAH
and humbug, the precursor mRNA of the hydroxylase gene
before splicing, and imply that inhibitory activity of the hydroxylase
antisense ONs may be occurring in the nucleus. A strategy to target a
site that is unique to mature humbug mRNA, the exon 13-exon
14a junction, yielded a sequence that selectively down-regulates
humbug mRNA. Western blot analyses with FB-50 show the
presence of three protein bands. Western blotting analysis of antisense
studies with ONs 79, 1302, and 1001 demonstrates that the higher
molecular weight proteins (Mr,
~130,000) are encoded for by the 5.2- and 4.5-kb BAH transcripts, and
allows the correlation of the 2.9-kb humbug transcript with
the lower molecular weight protein
(Mr, ~55,000) [The small
differences in relative molecular weights of these hydroxylase
proteins, compared with the molecular weights reported previously
(Dinchuk et al., 2000
), are due to the different gel systems used in
these two studies]. The ability of these particular antisense ONs to
selectively modulate expression of BAH and humbug at the
mRNA and protein level highlights their potential as tools to dissect
out the biological function of BAH and humbug.
Although the pharmacokinetics of phosphorothioate ONs in tumors has
been reported previously (DeLong et al., 1997
), to the best of our
knowledge, the spatial localization of these ONs in tumors has not been
investigated. Hence, a fluorescence microscopy uptake experiment was
conducted concurrently with the antisense tumor xenograft study. The
pattern of distribution and persistence of ON in the peripheral organs
we examined were consistent with the findings of other investigators
(Rifai et al., 1996
; Butler et al., 1997
). For example, prominent ON
labeling was observed in the proximal tubule cells of the kidney, but
there was little uptake in the glomerulus and cells in Bowman's
capsule. ON was also observed in hepatocytes. The penetrance of
fluorescein-labeled ON 79 into the tumor, however, was in stark
contrast to its abundant distribution in the liver and kidney. Although
a strong presence of ON was observed in the connective tissue capsule
and extracellular space in the outer layers of the tumor, regions
within the interior of the tumor were sparsely labeled. Hence,
although tumors seem to accumulate modest amounts of phosphorothioate
ON (2-3% of total injected dose per gram of tumor tissue) (DeLong et
al., 1997
), in A549 tumors this study shows that ON is largely absent
from the tumor cells themselves. Nonspecific binding of
phosphorothioate ONs to extracellular matrix proteins such as laminin
and fibronectin (Guvakova et al., 1995
; Khaled et al., 1996
) may
account for the retention of ON in the stroma and may have hindered
efficient ON penetration from the extracellular matrix into the tumor cells.
In in vivo studies with ON 79, a modest, although significant
reduction in tumor volume was observed. However, analysis of the RNA
derived from those tumors did not reveal inhibition of BAH or
humbug mRNA. Because RNA was processed from opposing
quadrants of the tumor mass, the majority of the RNA extracted would
have come from regions of the tumor with poor ON accumulation. This may
explain the lack of down-regulation of
-hydroxylase message. A tumor
uptake study with phosphodiester ONs has been reported (Plenat et al.,
1995
). In that study, 3'-fluorescein or 3'-digoxigenin-conjugated phosphodiester ONs were reported to penetrate the extracellular matrix
into the tumor interior, a finding that is contradictory to our
results. This difference may be due to the decreased stability of
phosphodiester ONs, even when partially protected at the ends (Hoke et
al., 1991
; Fisher et al., 1993
; Sands et al., 1995
). The half-lives of
various 3'-protected phosphodiester ONs in mouse serum ranged from 10 to 60 min (Sands et al., 1995
). In contrast, phosphorothioate ON
incubated in mouse serum remained unchanged even after 5 h (Sands
et al., 1994
). The Plenat study did not provide any direct evidence
that the fluorescein or digoxigenin signal observed within the tumors
derived from intact, full-length ON.
We explored the possibility that ON penetrance into tumors may be
sequence-dependent. Rifai compared the uptake of two ON sequences that
differed substantially in their purine content and found differences in
the amount of ON taken up by the heart, liver, and skin (Rifai et al.,
1996
). However, our study comparing three different ON sequences that
also differed considerably in their purine content did not reveal a
sequence-dependent effect on uptake by A549 tumors.
In light of the poor ON penetrance into A549 tumors, and the absence of
down-regulation of
-hydroxylase mRNAs, we are uncertain as to
whether the modest inhibition of tumor growth observed derived from
actual antisense effects. The finding of poor tumor penetrance suggests
additional areas of investigation and highlights the importance of
demonstrating significant uptake of ON by the target tissue of
interest. A possible approach to increasing ON delivery to the tumor
may be through an i.v. route of administration. The i.v. route produces
5-fold greater peak plasma levels of ON than subcutaneous dosing
(Phillips et al., 1997
) and was used in other A549 xenograft studies
(Dean et al., 1996
; Monia et al., 1996
; Monia, 1999
). For poorly
vascularized tumors such as these A549 tumors, the higher peak plasma
levels may help produce more effective ON delivery to the tumor. An
alternative approach may involve continuous infusion of the ON through
osmotic mini pumps. Because a high concentration of ON seems to be
retained by the extracellular matrix of the tumor, strategies that
decrease adherence to extracellular matrix proteins may allow better
diffusion and penetration of the ON into the tumor cells. The
polyanionic nature of phosphorothioate ONs contributes to its affinity
for numerous heparin-binding proteins, including proteins of the
extracellular matrix (Guvakova et al., 1995
; Khaled et al., 1996
).
Although phosphodiester ONs also suffer from this nonsequence-specific
effect, the presence of the sulfur moiety on phosphorothioate ONs
enhances such protein-binding substantially (Khaled et al., 1996
). A
possible solution to this problem may be to replace a portion of the
phosphorothioate residues with uncharged, nuclease-resistant nucleotide
analogs such as methylphosphonates (Giles et al., 1995
) and polyamide
nucleic acids (Pooga et al., 1998
) or with second generation nucleotide
analogs such as methoxyethyl-ribonucleotide residues (Zhang et al.,
2000
), phosphoramidate nucleotides (Faria et al., 2001
), or locked
nucleic acids (Wahlestedt et al., 2000
).
In summary, antisense ONs capable of selectively down-regulating the
expression of closely related isoforms of
-hydroxylase have been
developed. Studies to investigate phosphorothioate ON uptake in tumors
after subcutaneous administration revealed poor penetrance of the ONs
in A549 tumors. This finding is consistent with the modest effect on
tumor growth observed and the lack of
-hydroxylase mRNA
down-regulation. Although investigation into the in vivo function(s) of
BAH and humbug was inconclusive, nonetheless, the work
reported above provides a foundation for additional studies on this
important family of proteins.
| |
Acknowledgments |
|---|
We thank Leslie-Ann Hall and Roseanne Wexler for technical assistance, Drs. Andrew Stern and Arthur Roach for helpful discussions, and Drs. Paul Hartig and Andrew Slee for support and encouragement.
| |
Footnotes |
|---|
Accepted for publication December 18, 2001.
Received for publication October 8, 2001.
Address correspondence to: Siew Peng Ho, Bristol-Myers Squibb Co., Experimental Station E336, Route 141 and Henry Clay Rd., Wilmington, DE 19880-0400. E-mail: siew.ho{at}bms.com
| |
Abbreviations |
|---|
BAH,
-aspartyl (asparaginyl) hydroxylase;
kb, kilobase;
ON, oligonucleotide;
G3PDH, glyceraldehydes-3-phosphate
dehydrogenase;
H&E, hematoxylin and eosin.
| |
References |
|---|
|
|
|---|
expression.
Cancer Res
56:
3499-3507
-hydroxylase (Asph) and an evolutionarily conserved isoform of Asph missing the catalytic domain share exons with junctin.
J Biol Chem
275:
39543-39554
-hydroxylase is associated with malignant transformation.
Cancer Res
60:
1261-1266
-hydroxylase in hepatocellular carcinoma and cholangiocarcinoma.
J Clin Invest
98:
1313-1323[Medline].
a correction.
Nat Med
5:
127[CrossRef][Medline].
-hydroxylase: potential modification of endogenous epidermal growth factor-like modules.
Biochem Biophys Res Commun
189:
233-241[CrossRef][Medline].
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||