|
|
|
|
Vol. 302, Issue 1, 36-42, July 2002
Division of Gastroenterology, Tohoku University Graduate School of Medicine, Sendai, Japan
| |
Abstract |
|---|
|
|
|---|
Alcohol is a major cause of both acute and chronic pancreatitis.
Activated pancreatic stellate cells (PSCs) have recently been
implicated in the pathogenesis of pancreatic inflammation and fibrosis.
Herein, we examined the effect of ethanol and acetaldehyde on the
activation of transcription factors and mitogen-activated protein (MAP)
kinases in PSCs. PSCs were isolated from rat pancreas tissue and used
in their culture-activated, myofibroblast-like phenotype. PSCs were
treated with ethanol and acetaldehyde at clinically relevant
concentrations (50 mM and 200 µM, respectively). Ethanol and
acetaldehyde activated activator protein-1 but not nuclear factor-
B.
In addition, they activated three classes of MAP kinases: extracellular
signal-regulated kinase 1/2, c-Jun N-terminal kinase/stress-activated
protein kinase, and p38 MAP kinase. Ethanol- and acetaldehyde-induced
activation of activator protein-1 and MAP kinases was blocked by
the antioxidant N-acetyl-cysteine, suggesting a role of
oxidative stress in the signal transduction. Ethanol and acetaldehyde
induced
1(I) procollagen gene expression but did not induce
intercellular adhesion molecule-1 and monocyte chemoattractant
protein-1. The acetaldehyde-induced increase of
1(I) procollagen
gene expression was inhibited by the p38 MAP kinase inhibitor
4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)imidazole (SB203580) but not by the MAP kinase inhibitor
2'-amino-3'-methoxyflavone (PD98059). Specific activation of these
signal transduction pathways may play a role in the pathogenesis of
alcohol-induced pancreatic injury.
| |
Introduction |
|---|
|
|
|---|
Recently,
star-shaped cells in the pancreas, namely pancreatic stellate cells
(PSCs), have been identified and characterized (Apte et al., 1998a
;
Bachem et al., 1998
). They are morphologically similar to the hepatic
stellate cells that play a central role in the fibrogenesis of the
liver (Friedman, 1993
). In normal pancreas, stellate cells are
quiescent and can be identified by the presence of vitamin A-containing
lipid droplets in the cytoplasm. In response to pancreatic injury or
inflammation, they are transformed ("activated") from their
quiescent phenotype into highly proliferative myofibroblast-like cells,
which express the cytoskeletal protein
-smooth muscle actin
(
-SMA), and produce type I collagen and other extracellular matrix
components. PSCs are activated in response to cytokines such as
transforming growth factor-
and platelet-derived growth factor,
which are secreted during inflammation and tissue repair (Apte et al.,
1998a
; Bachem et al., 1998
). Many of the morphological and metabolic
changes associated with the activation of PSCs in animal models of
fibrosis also occur when these cells are grown in culture on plastic.
There is accumulating evidence that PSCs, like hepatic stellate cells,
are responsible for the development of pancreatic fibrosis and
inflammation (Wells and Crawford, 1998
; Haber et al., 1999
).
A relationship between alcohol and pancreatitis has been suggested for
more than 50 years (Comfort et al., 1946
; Apte et al., 1998b
), and
alcohol is now accepted as a major cause of both acute and chronic
pancreatitis in industrialized nations worldwide (Apte et al., 1998b
).
It was reported that abundant vitamin A-storing cells were surrounded
by collagen fibers in areas of fibrosis in the pancreas from human
subjects with chronic pancreatitis, suggesting a role of PSCs in the
alcohol-induced pancreatic fibrosis (Ikejiri, 1990
). One mechanism
relevant to alcohol-induced pancreatic fibrosis might be PSC activation
by inflammatory mediators released during pancreatic injury. Recently,
Apte et al. (2000)
reported that both ethanol and acetaldehyde
increased the synthesis of type I collagen in rat PSCs, suggesting a
direct effect of alcohol on PSCs. To elucidate the underlying molecular
mechanisms, we examined the effect of ethanol and acetaldehyde on the
activation of transcription factors and mitogen-activated protein (MAP)
kinases. Herein, we report that ethanol and acetaldehyde at clinically relevant concentrations activated activator protein-1 (AP-1), but not
nuclear factor-
B (NF-
B), in PSCs. Ethanol and acetaldehyde induced the activation of three classes of MAP kinases. In addition, acetaldehyde-induced expression of
1(I) procollagen gene was inhibited by the p38 MAP kinase inhibitor SB203580. Specific activation of these signal transduction pathways may play a direct role in the
pathogenesis of alcohol-induced pancreatic injury.
| |
Experimental Procedures |
|---|
|
|
|---|
Materials.
Poly(dI.dC)-poly(dI.dC),
[
-32P]dCTP, and
[
-32P]ATP were purchased from
Amersham Biosciences UK, Ltd. (Buckinghamshire, England). Recombinant human interleukin (IL)-1
was from Roche Applied
Science (Mannheim, Germany). Rabbit antibodies against phosphospecific MAP kinases, pan-MAP kinases, and I
B-
were purchased from Cell Technologies, Inc. (Beverly, MA). PD98059 and SB203580 were from Calbiochem (La Jolla, CA). All other reagents were from
Sigma-Aldrich (St. Louis, MO) unless specifically described.
Cell Culture.
Rat PSCs were prepared from the pancreas
tissues of male Wistar rats (Japan SLC, Inc., Hamamatsu, Japan),
weighing 200 to 250 g, as previously described using the Nycodenz
solution (Nycomed Pharma, Oslo, Norway) (Apte et al., 1998a
). All
animal procedures were performed in accordance with the National
Institutes of Health Animal Care and Use Guidelines. Isolated stellate
cells were cultured in Ham's F-12 medium containing 10%
heat-inactivated fetal bovine serum, penicillin sodium, and
streptomycin sulfate. On the day of experimentation, cells were refed
with serum-free medium, incubated for 6 h, and treated with
IL-1
(10 ng/ml), ethanol (50 mM), or acetaldehyde (200 µM). In
experiments involving N-acetyl-cysteine (NAC), PD98059, or
SB203580, these reagents were added at 30 min before the
addition of ethanol or acetaldehyde. All experiments were performed
using cells between passages two and five.
Nuclear Extract Preparation and Electrophoretic Mobility Shift
Assay.
Nuclear extracts were prepared and electrophoretic mobility
shift assay performed as previously described (Masamune et al., 1996
).
Double-stranded oligonucleotide probes for NF-
B
(5'-AGTTGAGGGGACTTTCCCAGGC-3') or AP-1 (5'-CGCTTGATGAGTCAGCCGGAA-3')
were end-labeled with [
-32P]ATP. Nuclear
extracts (approximately 5 µg) were incubated with the labeled
oligonucleotide probe for 20 min at 22°C and electrophoresed through
a 4% polyacrylamide gel. Gels were dried and autoradiographed at
80°C overnight. A 100-fold excess of unlabeled oligonucleotide was
incubated with nuclear extracts for 10 min before the addition of the
radiolabeled probe in the competition experiments.
Luciferase Assay.
Luciferase expression vectors containing
two consensus AP-1 binding sites (TGACTCA) or two consensus NF-
B
binding sites (GGGACTTTCC) were kindly provided by Dr. Naofumi Mukaida
(Kanazawa University, Kanazawa, Japan). For the luciferase
assay, approximately 1 × 106 PSCs were
transfected with 2 µg of each luciferase expression vector, along
with 40 ng of pRL-TK vector (Promega, Madison, WI) as an internal
control, using the LipofectAMINE reagent (Invitrogen, Rockville, MD).
After 24 h, the transfected cells were treated with ethanol or
acetaldehyde for an additional 24 h. At the end of the incubation,
cell lysates were prepared using a Pica Gene kit (Toyo Ink Co., Tokyo,
Japan), and the light intensities were measured using a model Lumat
LB9507 luminescence reader (EG&G Berthold, Bad Wildbad, Germany).
Western Blotting.
The levels of activated, phosphorylated
MAP kinases in the samples were determined by Western blotting using
anti-phosphospecific MAP kinase antibodies [extracellular
signal-regulated kinase (ERK)1/2, c-Jun N-terminal
kinase/stress-activated protein kinase (JNK/SAPK), or p38 MAP kinase],
as previously described (Masamune et al., 2002c
). Briefly, cells were
treated with ethanol or acetaldehyde and lysed in SDS. The samples were
then sonicated, heated, and centrifuged to remove insoluble cell
debris. Whole cell extracts (approximately 100 µg) were fractionated
on a 10% SDS-polyacrylamide gel and transferred to a nitrocellulose
membrane (Bio-Rad, Hercules, CA). The membrane was incubated with
anti-phosphospecific MAP kinase antibodies overnight. After incubation
with the secondary antibody (goat anti-rabbit, horseradish peroxidase
conjugated), proteins were visualized by using the ECL kit (Amersham
Biosciences UK, Ltd.). Levels of pan-MAP kinases and I
B-
were
examined in a similar manner.
Northern Blotting.
Total RNA was isolated using an RNeasy
total RNA preparation kit (QIAGEN, Valencia, CA). Ten micrograms of
total RNA were separated on a 1% agarose-2.2 M formaldehyde gel and
transferred to a nylon membrane filter (Amersham Biosciences UK, Ltd.).
Blots were hybridized for 16 h at 42°C to the
32P-labeled DNA probes of c-jun,
c-fos, or
1(I) procollagen generated by a polymerase
chain reaction. Specific primer sets were as follows (listed 5'-3',
sense and antisense, respectively): c-jun,
CCCTAAGATTCTGAAGCAGAG and TCCTGAGACTCCATGTCGAT; c-fos,
ACAGGACTTTTGCGCAGATC and AGGTCATTGGGGATCTTGCA;
1(I) procollagen,
CCTGCTGGACCCCGAGGAAAC and TCACACCAGTTCACCAGGT. Polymerase chain
reactions were performed by 30 cycles at 94°C (for 1 min), at 55°C
(for 1 min), and at 72°C (for 1 min). The identity of the products
was confirmed by direct sequencing. After the hybridization, the filter
was washed three times with 2× standard saline citrate (3 M NaCl, 0.3 M sodium citrate) and 0.1% SDS at 42°C for 10 min. The washed filter
was subjected to autoradiography at
80°C for 3 days for
c-jun and c-fos or for 12 h for
1(I) procollagen.
Enzyme-Linked Immunosorbent Assay.
After the incubation for
24 h, cell culture supernatants were harvested and stored at
80°C until the measurement. Monocyte chemoattractant protein-1
(MCP-1) levels in the culture supernatants were measured by
enzyme-linked immunosorbent assay (Endogen, Woburn, MA), according to
the manufacturer's instructions. Cell-surface expression of
intercellular adhesion molecule-1 (ICAM-1) was determined by
enzyme-linked immunosorbent assay, as previously reported (Masamune et al., 1999
).
Statistical Analysis. Differences between experimental groups were evaluated by the two-tailed unpaired Student's t test. A p value less than 0.05 was considered statistically significant.
| |
Results |
|---|
|
|
|---|
Ethanol and Acetaldehyde Increased AP-1, but not NF-
B, Binding
Activity.
It has been shown that PSCs are activated (express
-SMA) after approximately 48 h of culture on plastic (Apte et
al., 1998a
; Bachem et al., 1998
). As mentioned earlier, all experiments
used passaged stellate cells, which were considered activated. Indeed, the increased expression of
-SMA was confirmed by immunostaining (data not shown). We first examined the effects of ethanol and acetaldehyde on the activation of the transcription factors NF-
B and
AP-1. These transcription factors are important regulators of gene
expression in response to many stimuli, including proinflammatory cytokines and growth factors (Grilli et al., 1993
; Karin et al., 1997
).
Culture-activated PSCs were incubated with ethanol or acetaldehyde at
clinically relevant concentrations (50 mM and 200 µM, respectively) or IL-1
for 1 h. Nuclear extracts were prepared, and the
specific binding activities of NF-
B and AP-1 were examined by
electrophoretic mobility shift assay. Both ethanol and acetaldehyde, as
well as IL-1
, increased the AP-1 binding activity (Fig.
1). The specificity of AP-1-specific DNA
binding activity was demonstrated by the addition of a 100-fold molar
excess of unlabeled AP-1 oligonucleotide, but not by unrelated NF-
B
oligonucleotide, in competition assays (Fig. 1; data not shown). In
these experiments, the treatment did not affect the morphology or cell
viability as assessed by a trypan blue exclusion test (data not shown).
In contrast, NF-
B binding activity was induced by IL-1
but not by
ethanol and acetaldehyde (Fig. 1). Octamer transcription
factor-1 binding activity was not altered by the treatment (data
not shown), suggesting that the effect of ethanol and acetaldehyde on
AP-1 was specific.
|
Ethanol and Acetaldehyde Increased AP-1-Dependent, but not
NF-
B-Dependent, Transcriptional Activity.
To confirm that AP-1
activation observed by electrophoretic mobility shift assay was
functional, the effects of ethanol and acetaldehyde on AP-1-dependent
transcriptional activity was examined. PSCs were transiently
transfected with AP-1- or NF-
B-luciferase gene reporter constructs
and assayed for the luciferase activity. As shown in Fig.
2A, ethanol and acetaldehyde increased
AP-1-dependent, but not NF-
B-dependent, luciferase activity.
Phosphorylation and degradation of the inhibitory protein I
B-
and
subsequent dissociation of this protein from NF-
B are thought to be
necessary for the activation (Grilli et al., 1993
). We also examined
the effect on the degradation of I
B-
by Western blotting.
IL-1
, but not ethanol and acetaldehyde, induced transient
degradation of I
B-
, further supporting that ethanol and
acetaldehyde did not activate NF-
B (Fig. 2B).
|
Ethanol and Acetaldehyde Activated MAP Kinases.
Induction of
the expression of AP-1 components c-Fos and c-Jun by a variety of
stimuli such as growth factors and cytokines is mediated by the
activation of three distinct MAP kinases: ERK1/2, JNK/SAPK, and p38 MAP
kinase (Karin et al., 1997
; Robinson and Cobb, 1997
). These kinases
function in protein cascades that play a critical role in the
regulation of cellular responses to cytokines and stresses. Activation
of these kinases occurs through phosphorylation (Karin et al., 1997
;
Robinson and Cobb, 1997
). We determined the activation of these MAP
kinases by Western blotting using anti-phosphospecific MAP kinase
antibodies. These antibodies recognize only phosphorylated form of MAP
kinases, thus allowing the assessment of activation of these kinases.
Both ethanol and acetaldehyde at clinically relevant concentrations
activated these three classes of MAP kinases in a time-dependent
manner, with peaking around 5 to 15 min (Fig. 3). The levels of pan-MAP kinases were
unaffected by the treatment, indicating that the lanes had been equally
loaded.
|
c-fos and c-jun Gene Expression Was
Induced by Ethanol and Acetaldehyde.
The c-jun gene
contains two AP-1 binding sites in its promoter region (Karin et al.,
1997
). On the other hand, regulation of AP-1 occurs by induced
transcription of c-jun and c-fos or by
post-transcriptional modification of their products (Karin et al.,
1997
). The ability of ethanol and acetaldehyde to activate AP-1-dependent transcriptional activity predicted that they would activate transcription of c-jun and c-fos genes.
Both ethanol and acetaldehyde induced c-fos and
c-jun gene expression, as assessed by Northern blotting
(Fig. 4).
|
Activation of AP-1 and MAP Kinases Was Inhibited by Antioxidant
NAC.
There is accumulating evidence of oxidant stress in the
pancreas after both short-term and long-term ethanol exposure in
experimental animals (Altomare et al., 1996
; Norton et al., 1998
). On
the other hand, activation of MAP kinases and AP-1 may be dependent on
the intracellular production of oxygen free radicals (Karin et al., 1997
; Robinson and Cobb, 1997
). We examined whether the activation of
AP-1 and MAP kinases was mediated by reactive oxygen species. We
pretreated PSCs with an antioxidant, NAC, and examined the effects on
the activation of AP-1 and MAP kinases. NAC has been shown to enter
cells readily and scavenge oxidants directly or indirectly by its
conversion to L-cysteine and by increasing intracellular glutathione (Aruoma et al., 1989
). NAC inhibited the inducible AP-1
binding activity and transcriptional activity (Fig.
5, A and B). In addition, NAC inhibited
the activation of MAP kinases (Fig. 5C), suggesting a role of oxidative
stress in the activation of these signal transduction pathways.
|
Acetaldehyde Induced Type I Collagen Gene Expression through p38
MAP Kinase.
It has been shown that activated PSCs express
-SMA
and produce type I collagen. Indeed,
-SMA expression has been
accepted as a marker of PSC activation (Apte et al., 1998a
), and in
situ hybridization techniques showed that
-SMA-positive cells were the principal source of collagen in the fibrotic pancreas (Haber et
al., 1999
). In addition, activated PSCs acquire the proinflammatory phenotype; they may modulate the recruitment and activation of inflammatory cells through the expression of IL-8, MCP-1 (Andoh et al.,
2000
; Masamune et al., 2002a
), and ICAM-1 (Masamune et al., 2002b
). In
agreement with the article of Apte et al. (2000)
, both ethanol and
acetaldehyde increased the steady-state mRNA levels of
1(I)
procollagen (Fig. 6A). In contrast,
ethanol and acetaldehyde did not increase ICAM-1 and MCP-1 expression
(Fig. 6B). To clarify the role of MAP kinases for the
acetaldehyde-induced expression of
1(I) procollagen gene, we used
specific inhibitors to block these pathways. The selective p38 MAP
kinase inhibitor SB203580 (Cuenda et al., 1995
) decreased the
acetaldehyde-induced increase of
1(I) procollagen mRNA (Fig. 6A). In
contrast, PD98059 (Dudley et al., 1995
), a specific inhibitor of MAP
kinase activation and consequent ERK1/2 activation, did not affect the
1(I) procollagen gene expression. These results suggested that
acetaldehyde induced type I collagen expression at least in part
through the activation of the p38 MAP kinase, but not ERK1/2, pathway.
|
| |
Discussion |
|---|
|
|
|---|
There is accumulating evidence that activated PSCs play a central
role in the pathogenesis of pancreatic fibrosis and inflammation (Wells
and Crawford, 1998
; Haber et al., 1999
). However, alcohol-induced signal transduction pathways in PSCs remain unknown. In this study, we
have shown for the first time that ethanol and acetaldehyde at
clinically relevant concentrations (50 mM and 200 µM, respectively) activated AP-1 but not NF-
B. This selective pattern of activation is
distinct from that elicited by IL-1
and tumor neurosis factor-
, which also activate NF-
B (Masamune et al., 2002b
). In addition, ethanol and acetaldehyde activated three classes of MAP kinases (ERK1/2, JNK/SAPK, and p38 MAP kinase). Acetaldehyde-induced expression of
1(I) procollagen gene was inhibited by SB203580, a p38 MAP kinase
inhibitor, suggesting a role of p38 MAP kinase in the collagen gene
expression. The concentrations of ethanol and acetaldehyde used in this
study were higher than the mean blood levels reported in alcoholics
after oral (Korsten et al., 1987
) or intravenous (Peters and Ward,
1988
) administration of ethanol but not dissimilar to those reported
during experimental ethanol administration to rats (Eriksson and
Sippel, 1977
). It is also possible that tissue concentrations of
acetaldehyde are significantly higher than circulating levels of the
compound, as has been shown in the liver of alcohol-fed rats (Eriksson
and Sippel, 1977
).
Because antioxidant NAC inhibited the alcohol-induced activation of MAP
kinases and AP-1 in this study, reactive oxygen species may mediate the
activation of these signal transduction pathways. This is in agreement
with the idea that activation of MAP kinases and AP-1 is dependent on
the intracellular production of oxygen free radicals (Karin et al.,
1997
; Robinson and Cobb, 1997
). Indeed, hydrogen peroxide activated MAP
kinases and AP-1 in PSCs (K. Kikuta, unpublished observation).
There is accumulating evidence of oxidant stress in the pancreas after
both short-term and long-term ethanol exposure in experimental animals
(Altomare et al., 1996
; Norton et al., 1998
). Such an oxidative stress
has been observed in the absence of pancreatic necrosis or
inflammation, suggesting that it is a primary, not secondary, event to
ethanol-induced tissue injury. The development of oxidative stress
within the pancreas during ethanol consumption may be related to
increased free radical generation during ethanol metabolism and to
compromised antioxidant defense mechanisms (Altomare et al., 1996
). It
is likely that PSCs are exposed to oxidative stress during ethanol
consumption because PSCs, in addition to pancreatic acinar cells (Haber
et al., 1998
), have the capacity to metabolize ethanol to acetaldehyde via alcohol dehydrogenase-mediated oxidation of ethanol (Apte et al.,
2000
). Apte et al. (2000)
showed that intracellular oxidant stress is
an early occurrence in PSCs exposed to ethanol and acetaldehyde. They
also showed that the alcohol-induced activation of PSCs and increased
collagen synthesis were prevented by the antioxidant vitamin E,
suggesting that these effects occurred by the oxidative stress that
developed during ethanol consumption.
Activated PSCs acquire the proinflammatory phenotype; they may modulate
the recruitment and activation of inflammatory cells. ICAM-1 and MCP-1
are important cell adhesion and chemokine mediators of leukocytes and
PSC interactions. We and others have reported that activated PSCs
express MCP-1 (Andoh et al., 2000
; Masamune et al., 2002a
) and ICAM-1
(Masamune et al., 2002b
) in response to IL-1
and tumor neurosis
factor-
in vitro. Indeed, MCP-1 expression by activated PSCs is
shown to be increased in fibrous tissue sections from patients with
chronic pancreatitis (Saurer et al., 2000
). In this study, alcohol
failed to induce NF-
B activation and the consequent expression of
ICAM-1 and MCP-1. The failure of alcohol to induce ICAM-1 and MCP-1
expression is not surprising because the activation of NF-
B has been
shown to play a central role in ICAM-1 and MCP-1 expression in PSCs
(Andoh et al., 2000
; Masamune et al., 2002b
). This is in contrast to
human endothelial cells in which the AP-1 proteins c-Fos and c-Jun
directly induce expression of ICAM-1 and MCP-1 independently of the
NF-
B pathway (Wang et al., 1999
). Recent articles (Li and Karin,
1999
; Bowie and O'Neill, 2000
) have emphasized that a redox-dependent
activation of NF-
B is cell- and stimulus-specific as opposed to the
idea that oxidative stress is a common mediator of diverse NF-
B
activators. Li and Karin (1999)
reported that when a redox-regulated
effect on NF-
B is observed, it appears to occur downstream from the
I
B kinase, at the level of ubiquitination and/or degradation
of I
B. Lindros et al. (1999)
reported that acetaldehyde protected
against necrosis and inflammation in the liver of ethanol-fed rats
through the decreased activation of NF-
B in the Kupffer cells. On
the other hand, it has been shown that alcohol inhibits the expression
of proinflammatory cytokines through the decreased activation of NF-
B in monocytes (Mandrekar et al., 1999
), at least in part accounting for the immune dysfunction frequently observed in patients who abuse alcohol (Lieber, 1992
).
Effects of alcohol on MAP kinases depend on the method (i.e., in vivo
or in vitro) and duration of the exposure (i.e., acute or chronic) and
on the cell type. For example, acute exposure to ethanol had no effect
on either basal or serum-stimulated activity of MAP kinases in a normal
mouse embryonic liver cell line (BNLCL2), whereas chronic exposure to
ethanol potentiated the serum-stimulated activity (Reddy and Shukla,
1996
). In vascular smooth muscle cells, acute ethanol treatment reduced
serum-stimulated ERK1/2 activity in a dose-dependent manner
(Hendrickson et al., 1998
). Treatment of rat hepatocytes in vitro for
16 h prolonged the activation of ERK 1/2 and p38 MAP kinase
induced by various agonists (Chen et al., 1998
). Such a treatment also
increased basal JNK/SAPK activity but did not potentiate or prolong
agonist-induced JNK/SAPK activation. In contrast, chronic ethanol
consumption in vivo inhibited the activation of ERK1/2, p38 MAP kinase,
and JNK/SAPK either by partial hepatectomy or by various agonist (Chen
et al., 1998
). Although little is known about the MAP kinase cascades
in PSCs, MAP kinase pathways in hepatic stellate cells have been
previously examined. Reeves et al. (2000)
reported that constitutive
activity of p38 MAP kinase was higher in transformed versus quiescent
cells and that its inhibitor reduced activation of hepatic stellate cells in culture as assessed by
-SMA expression, suggesting a role
of p38 MAP kinase in the activation of hepatic stellate cells. Whether
similar mechanisms are responsible for the activation of PSCs remains
to be determined.
Pancreatic fibrosis is an important morphological feature of
alcohol-induced pancreatic injury, and activated PSCs are the principal
source of collagen, mainly type I, during the pancreatic fibrosis. In
agreement with the previous study (Apte et al., 2000
), alcohol
increased the steady-state mRNA levels of
1(I) procollagen in this
study. This finding is particularly important in light of the
generation of fibrosis in the pancreas during ethanol abuse. The
up-regulation of
1(I) procollagen mRNA was inhibited by SB203580 but
not by PD98059, suggesting a role of p38 MAP kinase pathway in
acetaldehyde-induced
1(I) procollagen gene expression. The precise
mechanism of type I collagen expression is unclear in PSCs. In hepatic
stellate cells, there are several articles dealing with this topic. For
example, serum stimulated
1(I) collagen gene expression via ERK and
JNK/SAPK pathways through different regions of the 5'-upstream promoter
sequence of the gene (Chen and Davis, 1999
). Although the
ERK-stimulatory signal was mapped to the most proximal nuclear factor-1
and specificity protein-1 (Sp-1) binding domains, a distal
guanine cytosine (GC) box located at
1484 to
1476 base pairs played
a central role in receiving extracellular signals through the JNK
pathway (Chen and Davis, 1999
). JNK/SAPK and AP-1 activation were also
required for the ultraviolet- and acetaldehyde-induced increase in
1(I) collagen gene expression (Chen and Davis, 1999
, 2000
). The
ultraviolet- and acetaldehyde-responsive elements were located in the
distal GC box, and the GC box was bound by a DNA-binding protein termed basic transcription-binding protein. On the other hand, treatment of
rat hepatic stellate cells with a 5-lipoxygenase-specific inhibitor reduced
1(I) procollagen mRNA transcript abundance, which suggested that leukotriene production might be involved in maintaining the activated cell's high level of collagen production (Chen et al., 1996
). Suppression of the gene transcription was localized to a nuclear
factor-1 binding domain in the proximal promoter and an AP-2 binding
domain adjacent to it. An increase in AP-2 binding adjacent to the
nuclear factor-1 site was likely to be the transmodulator responsible
for the suppression of the nuclear factor-1-dependent gene expression
(Chen et al., 1996
).
In summary, we have shown that ethanol and acetaldehyde induced the
activation of MAP kinases and AP-1, but not NF-
B, in activated PSCs.
This specific activation of signaling pathways may depend on the
generation of reactive oxygen species and reflect gene activation
pathways distinct from that used by proinflammatory cytokines. The
signaling pathways in PSCs remain largely unknown and elucidation of
the pathways would provide better understanding and rational approaches
for the control of pancreatic inflammation and fibrosis targeting PSCs.
| |
Acknowledgments |
|---|
We thank Dr. Naofumi Mukaida for the luciferase vectors.
| |
Footnotes |
|---|
Accepted for publication March 11, 2002.
Received for publication December 26, 2001.
This work was supported in part by a grant-in-aid for the Encouragement of Young Scientists from Japan Society for the Promotion of Science (to A.M.) and by Pancreas Research Foundation of Japan (to A.M.).
Address correspondence to: Dr. Atsushi Masamune, Division of Gastroenterology, Tohoku University Graduate School of Medicine, 1-1 Seiryo-cho, Aoba-ku, Sendai 980-8574 Japan. E-mail: amasamune{at}int3.med.tohoku.ac.jp
| |
Abbreviations |
|---|
PSCs, pancreatic stellate cells;
-SMA,
-smooth muscle actin;
MAP, mitogen-activated protein;
AP-1, activator protein-1;
NF-
B, nuclear factor-
B;
SB203580, 4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)imidazole;
IL, interleukin;
I
B, inhibitor of NF-
B;
PD98059, 2'-amino-3'-methoxyflavone;
NAC, N-acetyl-cysteine;
ERK, extracellular signal-regulated kinase;
JNK/SAPK, c-Jun N-terminal
kinase/stress-activated protein kinase;
MCP-1, monocyte chemoattractant
protein-1;
ICAM-1, intercellular adhesion molecule-1;
GC, guanine
cytosine.
| |
References |
|---|
|
|
|---|
B activation: a reassessment of the evidence in the light of recent discoveries.
Biochem Pharmacol
59:
13-23[CrossRef][Medline].
1(I) collagen gene expression in rat hepatic stellate cells.
J Biol Chem
274:
158-164
I(I) collagen gene expression in rat hepatic stellate cells.
Mol Cell Biol
20:
2818-2826
B and Rel: participants in a multiform transcriptional regulatory system.
Int Rev Cytol
143:
1-62[Medline].
B the sensor of oxidative stress.
FASEB J
13:
1137-1143
B activation and hepatic inflammation in ethanol-fed rats.
Lab Invest
79:
799-806[Medline].
B activation by ethanol in human monocytes.
Int Immunol
11:
1781-1790
-induced E-selectin expression in human umbilical vein endothelial cells.
J Biol Chem
271:
9368-9375
block activation of pancreatic stellate cells.
J Biol Chem
272:
141-147.
induce apoptosis in AR42J cells.
Pancreas
24:
130-138[CrossRef][Medline].This article has been cited by other articles:
![]() |
J. Ren and L. E. Wold Mechanisms of alcoholic heart disease Therapeutic Advances in Cardiovascular Disease, December 1, 2008; 2(6): 497 - 506. [Abstract] [PDF] |
||||
![]() |
A. Masamune, T. Watanabe, K. Kikuta, K. Satoh, and T. Shimosegawa NADPH oxidase plays a crucial role in the activation of pancreatic stellate cells Am J Physiol Gastrointest Liver Physiol, January 1, 2008; 294(1): G99 - G108. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Asaumi, S. Watanabe, M. Taguchi, M. Tashiro, and M. Otsuki Externally applied pressure activates pancreatic stellate cells through the generation of intracellular reactive oxygen species Am J Physiol Gastrointest Liver Physiol, November 1, 2007; 293(5): G972 - G978. [Abstract] [Full Text] [PDF] |
||||
![]() |
J A McCarroll, P A Phillips, N Santucci, R C Pirola, J S Wilson, and M V Apte Vitamin A inhibits pancreatic stellate cell activation: implications for treatment of pancreatic fibrosis Gut, January 1, 2006; 55(1): 79 - 89. [Abstract] [Full Text] [PDF] |
||||
![]() |
G Perides, X Tao, N West, A Sharma, and M L Steer A mouse model of ethanol dependent pancreatic fibrosis Gut, October 1, 2005; 54(10): 1461 - 1467. [Abstract] [Full Text] [PDF] |
||||
![]() |
S J Pandol Are we studying the correct state of the stellate cell to elucidate mechanisms of chronic pancreatitis? Gut, June 1, 2005; 54(6): 744 - 745. [Full Text] [PDF] |
||||
![]() |
A. Masamune, K. Kikuta, M. Satoh, N. Suzuki, and T. Shimosegawa Protease-Activated Receptor-2-Mediated Proliferation and Collagen Production of Rat Pancreatic Stellate Cells J. Pharmacol. Exp. Ther., February 1, 2005; 312(2): 651 - 658. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Masamune, K. Kikuta, N. Suzuki, M. Satoh, K. Satoh, and T. Shimosegawa A c-Jun NH2-Terminal Kinase Inhibitor SP600125 (Anthra[1,9-cd]pyrazole-6 (2H)-one) Blocks Activation of Pancreatic Stellate Cells J. Pharmacol. Exp. Ther., August 1, 2004; 310(2): 520 - 527. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yeh, N. M. Gharavi, J. Choi, X. Hsieh, E. Reed, K. P. Mouillesseaux, A. L. Cole, S. T. Reddy, and J. A. Berliner Oxidized Phospholipids Increase Interleukin 8 (IL-8) Synthesis by Activation of the c-src/Signal Transducers and Activators of Transcription (STAT)3 Pathway J. Biol. Chem., July 16, 2004; 279(29): 30175 - 30181. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-Y. Li, M. Gomelsky, J. Duan, Z. Zhang, L. Gomelsky, X. Zhang, P. N. Epstein, and J. Ren Overexpression of Aldehyde Dehydrogenase-2 (ALDH2) Transgene Prevents Acetaldehyde-induced Cell Injury in Human Umbilical Vein Endothelial Cells: ROLE OF ERK AND p38 MITOGEN-ACTIVATED PROTEIN KINASE J. Biol. Chem., March 19, 2004; 279(12): 11244 - 11252. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Li and K. H. Kim Effects of Ethanol on Embryonic and Neonatal Rat Testes in Organ Cultures J Androl, September 1, 2003; 24(5): 653 - 660. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Baron, B. F. Cole, L. Mott, R. Haile, M. Grau, T. R. Church, G. J. Beck, and E. R. Greenberg Neoplastic and Antineoplastic Effects of {beta}-Carotene on Colorectal Adenoma Recurrence: Results of a Randomized Trial J Natl Cancer Inst, May 21, 2003; 95(10): 717 - 722. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Masamune, M. Satoh, K. Kikuta, Y. Sakai, A. Satoh, and T. Shimosegawa Inhibition of p38 Mitogen-Activated Protein Kinase Blocks Activation of Rat Pancreatic Stellate Cells J. Pharmacol. Exp. Ther., January 1, 2003; 304(1): 8 - 14. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||