JPET Assistant Professor of Medicine (Clinician-Educator)

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Masamune, A.
Right arrow Articles by Shimosegawa, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masamune, A.
Right arrow Articles by Shimosegawa, T.

Vol. 302, Issue 1, 36-42, July 2002


Alcohol Activates Activator Protein-1 and Mitogen-Activated Protein Kinases in Rat Pancreatic Stellate Cells

Atsushi Masamune, Kazuhiro Kikuta, Masahiro Satoh, Akihiko Satoh and Tooru Shimosegawa

Division of Gastroenterology, Tohoku University Graduate School of Medicine, Sendai, Japan

    Abstract
Top
Abstract
Introduction
Experimental Procedures
Results
Discussion
References

Alcohol is a major cause of both acute and chronic pancreatitis. Activated pancreatic stellate cells (PSCs) have recently been implicated in the pathogenesis of pancreatic inflammation and fibrosis. Herein, we examined the effect of ethanol and acetaldehyde on the activation of transcription factors and mitogen-activated protein (MAP) kinases in PSCs. PSCs were isolated from rat pancreas tissue and used in their culture-activated, myofibroblast-like phenotype. PSCs were treated with ethanol and acetaldehyde at clinically relevant concentrations (50 mM and 200 µM, respectively). Ethanol and acetaldehyde activated activator protein-1 but not nuclear factor-kappa B. In addition, they activated three classes of MAP kinases: extracellular signal-regulated kinase 1/2, c-Jun N-terminal kinase/stress-activated protein kinase, and p38 MAP kinase. Ethanol- and acetaldehyde-induced activation of activator protein-1 and MAP kinases was blocked by the antioxidant N-acetyl-cysteine, suggesting a role of oxidative stress in the signal transduction. Ethanol and acetaldehyde induced alpha 1(I) procollagen gene expression but did not induce intercellular adhesion molecule-1 and monocyte chemoattractant protein-1. The acetaldehyde-induced increase of alpha 1(I) procollagen gene expression was inhibited by the p38 MAP kinase inhibitor 4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)imidazole (SB203580) but not by the MAP kinase inhibitor 2'-amino-3'-methoxyflavone (PD98059). Specific activation of these signal transduction pathways may play a role in the pathogenesis of alcohol-induced pancreatic injury.

    Introduction
Top
Abstract
Introduction
Experimental Procedures
Results
Discussion
References

Recently, star-shaped cells in the pancreas, namely pancreatic stellate cells (PSCs), have been identified and characterized (Apte et al., 1998a; Bachem et al., 1998). They are morphologically similar to the hepatic stellate cells that play a central role in the fibrogenesis of the liver (Friedman, 1993). In normal pancreas, stellate cells are quiescent and can be identified by the presence of vitamin A-containing lipid droplets in the cytoplasm. In response to pancreatic injury or inflammation, they are transformed ("activated") from their quiescent phenotype into highly proliferative myofibroblast-like cells, which express the cytoskeletal protein alpha -smooth muscle actin (alpha -SMA), and produce type I collagen and other extracellular matrix components. PSCs are activated in response to cytokines such as transforming growth factor-beta and platelet-derived growth factor, which are secreted during inflammation and tissue repair (Apte et al., 1998a; Bachem et al., 1998). Many of the morphological and metabolic changes associated with the activation of PSCs in animal models of fibrosis also occur when these cells are grown in culture on plastic. There is accumulating evidence that PSCs, like hepatic stellate cells, are responsible for the development of pancreatic fibrosis and inflammation (Wells and Crawford, 1998; Haber et al., 1999).

A relationship between alcohol and pancreatitis has been suggested for more than 50 years (Comfort et al., 1946; Apte et al., 1998b), and alcohol is now accepted as a major cause of both acute and chronic pancreatitis in industrialized nations worldwide (Apte et al., 1998b). It was reported that abundant vitamin A-storing cells were surrounded by collagen fibers in areas of fibrosis in the pancreas from human subjects with chronic pancreatitis, suggesting a role of PSCs in the alcohol-induced pancreatic fibrosis (Ikejiri, 1990). One mechanism relevant to alcohol-induced pancreatic fibrosis might be PSC activation by inflammatory mediators released during pancreatic injury. Recently, Apte et al. (2000) reported that both ethanol and acetaldehyde increased the synthesis of type I collagen in rat PSCs, suggesting a direct effect of alcohol on PSCs. To elucidate the underlying molecular mechanisms, we examined the effect of ethanol and acetaldehyde on the activation of transcription factors and mitogen-activated protein (MAP) kinases. Herein, we report that ethanol and acetaldehyde at clinically relevant concentrations activated activator protein-1 (AP-1), but not nuclear factor-kappa B (NF-kappa B), in PSCs. Ethanol and acetaldehyde induced the activation of three classes of MAP kinases. In addition, acetaldehyde-induced expression of alpha 1(I) procollagen gene was inhibited by the p38 MAP kinase inhibitor SB203580. Specific activation of these signal transduction pathways may play a direct role in the pathogenesis of alcohol-induced pancreatic injury.

    Experimental Procedures
Top
Abstract
Introduction
Experimental Procedures
Results
Discussion
References

Materials. Poly(dI.dC)-poly(dI.dC), [alpha -32P]dCTP, and [gamma -32P]ATP were purchased from Amersham Biosciences UK, Ltd. (Buckinghamshire, England). Recombinant human interleukin (IL)-1beta was from Roche Applied Science (Mannheim, Germany). Rabbit antibodies against phosphospecific MAP kinases, pan-MAP kinases, and Ikappa B-alpha were purchased from Cell Technologies, Inc. (Beverly, MA). PD98059 and SB203580 were from Calbiochem (La Jolla, CA). All other reagents were from Sigma-Aldrich (St. Louis, MO) unless specifically described.

Cell Culture. Rat PSCs were prepared from the pancreas tissues of male Wistar rats (Japan SLC, Inc., Hamamatsu, Japan), weighing 200 to 250 g, as previously described using the Nycodenz solution (Nycomed Pharma, Oslo, Norway) (Apte et al., 1998a). All animal procedures were performed in accordance with the National Institutes of Health Animal Care and Use Guidelines. Isolated stellate cells were cultured in Ham's F-12 medium containing 10% heat-inactivated fetal bovine serum, penicillin sodium, and streptomycin sulfate. On the day of experimentation, cells were refed with serum-free medium, incubated for 6 h, and treated with IL-1beta (10 ng/ml), ethanol (50 mM), or acetaldehyde (200 µM). In experiments involving N-acetyl-cysteine (NAC), PD98059, or SB203580, these reagents were added at 30 min before the addition of ethanol or acetaldehyde. All experiments were performed using cells between passages two and five.

Nuclear Extract Preparation and Electrophoretic Mobility Shift Assay. Nuclear extracts were prepared and electrophoretic mobility shift assay performed as previously described (Masamune et al., 1996). Double-stranded oligonucleotide probes for NF-kappa B (5'-AGTTGAGGGGACTTTCCCAGGC-3') or AP-1 (5'-CGCTTGATGAGTCAGCCGGAA-3') were end-labeled with [gamma -32P]ATP. Nuclear extracts (approximately 5 µg) were incubated with the labeled oligonucleotide probe for 20 min at 22°C and electrophoresed through a 4% polyacrylamide gel. Gels were dried and autoradiographed at -80°C overnight. A 100-fold excess of unlabeled oligonucleotide was incubated with nuclear extracts for 10 min before the addition of the radiolabeled probe in the competition experiments.

Luciferase Assay. Luciferase expression vectors containing two consensus AP-1 binding sites (TGACTCA) or two consensus NF-kappa B binding sites (GGGACTTTCC) were kindly provided by Dr. Naofumi Mukaida (Kanazawa University, Kanazawa, Japan). For the luciferase assay, approximately 1 × 106 PSCs were transfected with 2 µg of each luciferase expression vector, along with 40 ng of pRL-TK vector (Promega, Madison, WI) as an internal control, using the LipofectAMINE reagent (Invitrogen, Rockville, MD). After 24 h, the transfected cells were treated with ethanol or acetaldehyde for an additional 24 h. At the end of the incubation, cell lysates were prepared using a Pica Gene kit (Toyo Ink Co., Tokyo, Japan), and the light intensities were measured using a model Lumat LB9507 luminescence reader (EG&G Berthold, Bad Wildbad, Germany).

Western Blotting. The levels of activated, phosphorylated MAP kinases in the samples were determined by Western blotting using anti-phosphospecific MAP kinase antibodies [extracellular signal-regulated kinase (ERK)1/2, c-Jun N-terminal kinase/stress-activated protein kinase (JNK/SAPK), or p38 MAP kinase], as previously described (Masamune et al., 2002c). Briefly, cells were treated with ethanol or acetaldehyde and lysed in SDS. The samples were then sonicated, heated, and centrifuged to remove insoluble cell debris. Whole cell extracts (approximately 100 µg) were fractionated on a 10% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane (Bio-Rad, Hercules, CA). The membrane was incubated with anti-phosphospecific MAP kinase antibodies overnight. After incubation with the secondary antibody (goat anti-rabbit, horseradish peroxidase conjugated), proteins were visualized by using the ECL kit (Amersham Biosciences UK, Ltd.). Levels of pan-MAP kinases and Ikappa B-alpha were examined in a similar manner.

Northern Blotting. Total RNA was isolated using an RNeasy total RNA preparation kit (QIAGEN, Valencia, CA). Ten micrograms of total RNA were separated on a 1% agarose-2.2 M formaldehyde gel and transferred to a nylon membrane filter (Amersham Biosciences UK, Ltd.). Blots were hybridized for 16 h at 42°C to the 32P-labeled DNA probes of c-jun, c-fos, or alpha 1(I) procollagen generated by a polymerase chain reaction. Specific primer sets were as follows (listed 5'-3', sense and antisense, respectively): c-jun, CCCTAAGATTCTGAAGCAGAG and TCCTGAGACTCCATGTCGAT; c-fos, ACAGGACTTTTGCGCAGATC and AGGTCATTGGGGATCTTGCA; alpha 1(I) procollagen, CCTGCTGGACCCCGAGGAAAC and TCACACCAGTTCACCAGGT. Polymerase chain reactions were performed by 30 cycles at 94°C (for 1 min), at 55°C (for 1 min), and at 72°C (for 1 min). The identity of the products was confirmed by direct sequencing. After the hybridization, the filter was washed three times with 2× standard saline citrate (3 M NaCl, 0.3 M sodium citrate) and 0.1% SDS at 42°C for 10 min. The washed filter was subjected to autoradiography at -80°C for 3 days for c-jun and c-fos or for 12 h for alpha 1(I) procollagen.

Enzyme-Linked Immunosorbent Assay. After the incubation for 24 h, cell culture supernatants were harvested and stored at -80°C until the measurement. Monocyte chemoattractant protein-1 (MCP-1) levels in the culture supernatants were measured by enzyme-linked immunosorbent assay (Endogen, Woburn, MA), according to the manufacturer's instructions. Cell-surface expression of intercellular adhesion molecule-1 (ICAM-1) was determined by enzyme-linked immunosorbent assay, as previously reported (Masamune et al., 1999).

Statistical Analysis. Differences between experimental groups were evaluated by the two-tailed unpaired Student's t test. A p value less than 0.05 was considered statistically significant.

    Results
Top
Abstract
Introduction
Experimental Procedures
Results
Discussion
References

Ethanol and Acetaldehyde Increased AP-1, but not NF-kappa B, Binding Activity. It has been shown that PSCs are activated (express alpha -SMA) after approximately 48 h of culture on plastic (Apte et al., 1998a; Bachem et al., 1998). As mentioned earlier, all experiments used passaged stellate cells, which were considered activated. Indeed, the increased expression of alpha -SMA was confirmed by immunostaining (data not shown). We first examined the effects of ethanol and acetaldehyde on the activation of the transcription factors NF-kappa B and AP-1. These transcription factors are important regulators of gene expression in response to many stimuli, including proinflammatory cytokines and growth factors (Grilli et al., 1993; Karin et al., 1997). Culture-activated PSCs were incubated with ethanol or acetaldehyde at clinically relevant concentrations (50 mM and 200 µM, respectively) or IL-1beta for 1 h. Nuclear extracts were prepared, and the specific binding activities of NF-kappa B and AP-1 were examined by electrophoretic mobility shift assay. Both ethanol and acetaldehyde, as well as IL-1beta , increased the AP-1 binding activity (Fig. 1). The specificity of AP-1-specific DNA binding activity was demonstrated by the addition of a 100-fold molar excess of unlabeled AP-1 oligonucleotide, but not by unrelated NF-kappa B oligonucleotide, in competition assays (Fig. 1; data not shown). In these experiments, the treatment did not affect the morphology or cell viability as assessed by a trypan blue exclusion test (data not shown). In contrast, NF-kappa B binding activity was induced by IL-1beta but not by ethanol and acetaldehyde (Fig. 1). Octamer transcription factor-1 binding activity was not altered by the treatment (data not shown), suggesting that the effect of ethanol and acetaldehyde on AP-1 was specific.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 1.   Ethanol and acetaldehyde increased AP-1, but not NF-kappa B, binding activity. PSCs were treated with IL-1beta (10 ng/ml; lane 2), ethanol (50 mM; lane 4), or acetaldehyde (200 µM; lane 5) in serum-free medium for 1 h. Nuclear extracts were prepared and subjected to electrophoretic mobility shift assay using AP-1 (A) or NF-kappa B (B) oligonucleotide probes. Arrows denote specific inducible complexes competitive with cold double-stranded oligonucleotide probes (lane 3). Lane 1: control (medium only). star , nonspecific band.

Ethanol and Acetaldehyde Increased AP-1-Dependent, but not NF-kappa B-Dependent, Transcriptional Activity. To confirm that AP-1 activation observed by electrophoretic mobility shift assay was functional, the effects of ethanol and acetaldehyde on AP-1-dependent transcriptional activity was examined. PSCs were transiently transfected with AP-1- or NF-kappa B-luciferase gene reporter constructs and assayed for the luciferase activity. As shown in Fig. 2A, ethanol and acetaldehyde increased AP-1-dependent, but not NF-kappa B-dependent, luciferase activity. Phosphorylation and degradation of the inhibitory protein Ikappa B-alpha and subsequent dissociation of this protein from NF-kappa B are thought to be necessary for the activation (Grilli et al., 1993). We also examined the effect on the degradation of Ikappa B-alpha by Western blotting. IL-1beta , but not ethanol and acetaldehyde, induced transient degradation of Ikappa B-alpha , further supporting that ethanol and acetaldehyde did not activate NF-kappa B (Fig. 2B).


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2.   Ethanol and acetaldehyde increased the transcriptional activity dependent on AP-1 but not NF-kappa B. A, PSCs were transfected with the luciferase vectors (2× NF-kappa B or 2× AP-1) along with pRL-TK vector as an internal control. After 24 h, the transfected cells were treated with IL-1beta (IL-1; 10 ng/ml), ethanol (Et; 50 mM), or acetaldehyde (Ac; 200 µM). After another 24-h-incubation, intracellular luciferase activities were determined. The data represent mean values ± S.D., calculated from three independent experiments as -fold induction compared with the activity observed in control (medium only; Con). B, PSCs were treated with IL-1beta (10 ng/ml), ethanol (50 mM), or acetaldehyde (200 µM) for the indicated time. Total cell lysates were prepared, and the levels of Ikappa B-alpha were determined by Western blotting. star , p < 0.01 versus control; RLU, relative light units.

Ethanol and Acetaldehyde Activated MAP Kinases. Induction of the expression of AP-1 components c-Fos and c-Jun by a variety of stimuli such as growth factors and cytokines is mediated by the activation of three distinct MAP kinases: ERK1/2, JNK/SAPK, and p38 MAP kinase (Karin et al., 1997; Robinson and Cobb, 1997). These kinases function in protein cascades that play a critical role in the regulation of cellular responses to cytokines and stresses. Activation of these kinases occurs through phosphorylation (Karin et al., 1997; Robinson and Cobb, 1997). We determined the activation of these MAP kinases by Western blotting using anti-phosphospecific MAP kinase antibodies. These antibodies recognize only phosphorylated form of MAP kinases, thus allowing the assessment of activation of these kinases. Both ethanol and acetaldehyde at clinically relevant concentrations activated these three classes of MAP kinases in a time-dependent manner, with peaking around 5 to 15 min (Fig. 3). The levels of pan-MAP kinases were unaffected by the treatment, indicating that the lanes had been equally loaded.


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 3.   Ethanol and acetaldehyde induced activation of MAP kinases. PSCs were treated with ethanol (50 mM) or acetaldehyde (200 µM) for the indicated time. Total cell lysates were prepared, and the levels of activated, phosphorylated MAP kinases were determined by Western blotting using anti-phosphospecific MAP kinase antibodies. Levels of pan-MAP kinases were also determined to indicate that the lanes had been equally loaded. Both ethanol and acetaldehyde activated three classes of MAP kinases in a time-dependent manner with peaking around 5 to 15 min.

c-fos and c-jun Gene Expression Was Induced by Ethanol and Acetaldehyde. The c-jun gene contains two AP-1 binding sites in its promoter region (Karin et al., 1997). On the other hand, regulation of AP-1 occurs by induced transcription of c-jun and c-fos or by post-transcriptional modification of their products (Karin et al., 1997). The ability of ethanol and acetaldehyde to activate AP-1-dependent transcriptional activity predicted that they would activate transcription of c-jun and c-fos genes. Both ethanol and acetaldehyde induced c-fos and c-jun gene expression, as assessed by Northern blotting (Fig. 4).


View larger version (84K):
[in this window]
[in a new window]
 
Fig. 4.   Alcohol increased c-jun and c-fos mRNA expression. PSCs were treated with ethanol (Et; 50 mM) or acetaldehyde (Ac; 200 µM) in serum-free medium for 1 h. Total RNAs were extracted, and the levels of c-jun and c-fos mRNAs were determined by Northern blotting. Con, control (medium only).

Activation of AP-1 and MAP Kinases Was Inhibited by Antioxidant NAC. There is accumulating evidence of oxidant stress in the pancreas after both short-term and long-term ethanol exposure in experimental animals (Altomare et al., 1996; Norton et al., 1998). On the other hand, activation of MAP kinases and AP-1 may be dependent on the intracellular production of oxygen free radicals (Karin et al., 1997; Robinson and Cobb, 1997). We examined whether the activation of AP-1 and MAP kinases was mediated by reactive oxygen species. We pretreated PSCs with an antioxidant, NAC, and examined the effects on the activation of AP-1 and MAP kinases. NAC has been shown to enter cells readily and scavenge oxidants directly or indirectly by its conversion to L-cysteine and by increasing intracellular glutathione (Aruoma et al., 1989). NAC inhibited the inducible AP-1 binding activity and transcriptional activity (Fig. 5, A and B). In addition, NAC inhibited the activation of MAP kinases (Fig. 5C), suggesting a role of oxidative stress in the activation of these signal transduction pathways.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 5.   NAC inhibited the activation of MAP kinases and AP-1. A, PSCs were transfected with the luciferase vector (2× AP-1) along with pRL-TK vector as an internal control. After 24 h, the transfected cells were treated with ethanol (Et; 50 mM) or acetaldehyde (Ac; 200 µM) in the absence or presence of NAC (10 mM). After another 24-h-incubation, intracellular luciferase activities were determined. The data represent mean values ± S.D., calculated from three independent experiments as -fold induction compared with the activity observed in control (Con). B, PSCs were treated with NAC (10 mM) for 30 min before the addition of ethanol or acetaldehyde. After incubation for 10 min with ethanol (50 mM) or acetaldehyde (200 µM), total cell lysates were prepared, and the levels of activated, phosphorylated MAP kinases were determined by Western blotting. , p < 0.01 versus untreated control; star star , p < 0.01; star , p < 0.05 versus corresponding ethanol or acetaldehyde-treated controls; RLU, relative light units.

Acetaldehyde Induced Type I Collagen Gene Expression through p38 MAP Kinase. It has been shown that activated PSCs express alpha -SMA and produce type I collagen. Indeed, alpha -SMA expression has been accepted as a marker of PSC activation (Apte et al., 1998a), and in situ hybridization techniques showed that alpha -SMA-positive cells were the principal source of collagen in the fibrotic pancreas (Haber et al., 1999). In addition, activated PSCs acquire the proinflammatory phenotype; they may modulate the recruitment and activation of inflammatory cells through the expression of IL-8, MCP-1 (Andoh et al., 2000; Masamune et al., 2002a), and ICAM-1 (Masamune et al., 2002b). In agreement with the article of Apte et al. (2000), both ethanol and acetaldehyde increased the steady-state mRNA levels of alpha 1(I) procollagen (Fig. 6A). In contrast, ethanol and acetaldehyde did not increase ICAM-1 and MCP-1 expression (Fig. 6B). To clarify the role of MAP kinases for the acetaldehyde-induced expression of alpha 1(I) procollagen gene, we used specific inhibitors to block these pathways. The selective p38 MAP kinase inhibitor SB203580 (Cuenda et al., 1995) decreased the acetaldehyde-induced increase of alpha 1(I) procollagen mRNA (Fig. 6A). In contrast, PD98059 (Dudley et al., 1995), a specific inhibitor of MAP kinase activation and consequent ERK1/2 activation, did not affect the alpha 1(I) procollagen gene expression. These results suggested that acetaldehyde induced type I collagen expression at least in part through the activation of the p38 MAP kinase, but not ERK1/2, pathway.


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 6.   Acetaldehyde induced type I collagen gene expression through p38 MAP kinases. A, PSCs were treated with acetaldehyde (200 µM) in the absence (lane 3) or presence of PD98059 at 50 µM (lane 4) or SB203580 at 25 µM (lane 5). After 24 h, total RNAs were extracted, and the levels of alpha 1(I) procollagen mRNA were determined by Northern blotting. Effect of treatment with ethanol at 50 mM was also determined (lane 2). Lane 1: control (medium only). B, PSCs were treated with IL-1beta (IL; 10 ng/ml), ethanol (Et; 50 mM), or acetaldehyde (Ac; 200 µM). After 24 h, MCP-1 levels in the culture supernatant and cell-surface ICAM-1 expression were determined by enzyme-linked immunosorbent assay. MCP-1 levels are presented as nanograms per milliliter, and ICAM-1 levels are presented as optical density (O.D.). Con: control (medium only). Data shown are expressed as means ± S.D. (n = 6; star star , p < 0.01 versus control).

    Discussion
Top
Abstract
Introduction
Experimental Procedures
Results
Discussion
References

There is accumulating evidence that activated PSCs play a central role in the pathogenesis of pancreatic fibrosis and inflammation (Wells and Crawford, 1998; Haber et al., 1999). However, alcohol-induced signal transduction pathways in PSCs remain unknown. In this study, we have shown for the first time that ethanol and acetaldehyde at clinically relevant concentrations (50 mM and 200 µM, respectively) activated AP-1 but not NF-kappa B. This selective pattern of activation is distinct from that elicited by IL-1beta and tumor neurosis factor-alpha , which also activate NF-kappa B (Masamune et al., 2002b). In addition, ethanol and acetaldehyde activated three classes of MAP kinases (ERK1/2, JNK/SAPK, and p38 MAP kinase). Acetaldehyde-induced expression of alpha 1(I) procollagen gene was inhibited by SB203580, a p38 MAP kinase inhibitor, suggesting a role of p38 MAP kinase in the collagen gene expression. The concentrations of ethanol and acetaldehyde used in this study were higher than the mean blood levels reported in alcoholics after oral (Korsten et al., 1987) or intravenous (Peters and Ward, 1988) administration of ethanol but not dissimilar to those reported during experimental ethanol administration to rats (Eriksson and Sippel, 1977). It is also possible that tissue concentrations of acetaldehyde are significantly higher than circulating levels of the compound, as has been shown in the liver of alcohol-fed rats (Eriksson and Sippel, 1977).

Because antioxidant NAC inhibited the alcohol-induced activation of MAP kinases and AP-1 in this study, reactive oxygen species may mediate the activation of these signal transduction pathways. This is in agreement with the idea that activation of MAP kinases and AP-1 is dependent on the intracellular production of oxygen free radicals (Karin et al., 1997; Robinson and Cobb, 1997). Indeed, hydrogen peroxide activated MAP kinases and AP-1 in PSCs (K. Kikuta, unpublished observation). There is accumulating evidence of oxidant stress in the pancreas after both short-term and long-term ethanol exposure in experimental animals (Altomare et al., 1996; Norton et al., 1998). Such an oxidative stress has been observed in the absence of pancreatic necrosis or inflammation, suggesting that it is a primary, not secondary, event to ethanol-induced tissue injury. The development of oxidative stress within the pancreas during ethanol consumption may be related to increased free radical generation during ethanol metabolism and to compromised antioxidant defense mechanisms (Altomare et al., 1996). It is likely that PSCs are exposed to oxidative stress during ethanol consumption because PSCs, in addition to pancreatic acinar cells (Haber et al., 1998), have the capacity to metabolize ethanol to acetaldehyde via alcohol dehydrogenase-mediated oxidation of ethanol (Apte et al., 2000). Apte et al. (2000) showed that intracellular oxidant stress is an early occurrence in PSCs exposed to ethanol and acetaldehyde. They also showed that the alcohol-induced activation of PSCs and increased collagen synthesis were prevented by the antioxidant vitamin E, suggesting that these effects occurred by the oxidative stress that developed during ethanol consumption.

Activated PSCs acquire the proinflammatory phenotype; they may modulate the recruitment and activation of inflammatory cells. ICAM-1 and MCP-1 are important cell adhesion and chemokine mediators of leukocytes and PSC interactions. We and others have reported that activated PSCs express MCP-1 (Andoh et al., 2000; Masamune et al., 2002a) and ICAM-1 (Masamune et al., 2002b) in response to IL-1beta and tumor neurosis factor-alpha in vitro. Indeed, MCP-1 expression by activated PSCs is shown to be increased in fibrous tissue sections from patients with chronic pancreatitis (Saurer et al., 2000). In this study, alcohol failed to induce NF-kappa B activation and the consequent expression of ICAM-1 and MCP-1. The failure of alcohol to induce ICAM-1 and MCP-1 expression is not surprising because the activation of NF-kappa B has been shown to play a central role in ICAM-1 and MCP-1 expression in PSCs (Andoh et al., 2000; Masamune et al., 2002b). This is in contrast to human endothelial cells in which the AP-1 proteins c-Fos and c-Jun directly induce expression of ICAM-1 and MCP-1 independently of the NF-kappa B pathway (Wang et al., 1999). Recent articles (Li and Karin, 1999; Bowie and O'Neill, 2000) have emphasized that a redox-dependent activation of NF-kappa B is cell- and stimulus-specific as opposed to the idea that oxidative stress is a common mediator of diverse NF-kappa B activators. Li and Karin (1999) reported that when a redox-regulated effect on NF-kappa B is observed, it appears to occur downstream from the Ikappa B kinase, at the level of ubiquitination and/or degradation of Ikappa B. Lindros et al. (1999) reported that acetaldehyde protected against necrosis and inflammation in the liver of ethanol-fed rats through the decreased activation of NF-kappa B in the Kupffer cells. On the other hand, it has been shown that alcohol inhibits the expression of proinflammatory cytokines through the decreased activation of NF-kappa B in monocytes (Mandrekar et al., 1999), at least in part accounting for the immune dysfunction frequently observed in patients who abuse alcohol (Lieber, 1992).

Effects of alcohol on MAP kinases depend on the method (i.e., in vivo or in vitro) and duration of the exposure (i.e., acute or chronic) and on the cell type. For example, acute exposure to ethanol had no effect on either basal or serum-stimulated activity of MAP kinases in a normal mouse embryonic liver cell line (BNLCL2), whereas chronic exposure to ethanol potentiated the serum-stimulated activity (Reddy and Shukla, 1996). In vascular smooth muscle cells, acute ethanol treatment reduced serum-stimulated ERK1/2 activity in a dose-dependent manner (Hendrickson et al., 1998). Treatment of rat hepatocytes in vitro for 16 h prolonged the activation of ERK 1/2 and p38 MAP kinase induced by various agonists (Chen et al., 1998). Such a treatment also increased basal JNK/SAPK activity but did not potentiate or prolong agonist-induced JNK/SAPK activation. In contrast, chronic ethanol consumption in vivo inhibited the activation of ERK1/2, p38 MAP kinase, and JNK/SAPK either by partial hepatectomy or by various agonist (Chen et al., 1998). Although little is known about the MAP kinase cascades in PSCs, MAP kinase pathways in hepatic stellate cells have been previously examined. Reeves et al. (2000) reported that constitutive activity of p38 MAP kinase was higher in transformed versus quiescent cells and that its inhibitor reduced activation of hepatic stellate cells in culture as assessed by alpha -SMA expression, suggesting a role of p38 MAP kinase in the activation of hepatic stellate cells. Whether similar mechanisms are responsible for the activation of PSCs remains to be determined.

Pancreatic fibrosis is an important morphological feature of alcohol-induced pancreatic injury, and activated PSCs are the principal source of collagen, mainly type I, during the pancreatic fibrosis. In agreement with the previous study (Apte et al., 2000), alcohol increased the steady-state mRNA levels of alpha 1(I) procollagen in this study. This finding is particularly important in light of the generation of fibrosis in the pancreas during ethanol abuse. The up-regulation of alpha 1(I) procollagen mRNA was inhibited by SB203580 but not by PD98059, suggesting a role of p38 MAP kinase pathway in acetaldehyde-induced alpha 1(I) procollagen gene expression. The precise mechanism of type I collagen expression is unclear in PSCs. In hepatic stellate cells, there are several articles dealing with this topic. For example, serum stimulated alpha 1(I) collagen gene expression via ERK and JNK/SAPK pathways through different regions of the 5'-upstream promoter sequence of the gene (Chen and Davis, 1999). Although the ERK-stimulatory signal was mapped to the most proximal nuclear factor-1 and specificity protein-1 (Sp-1) binding domains, a distal guanine cytosine (GC) box located at -1484 to -1476 base pairs played a central role in receiving extracellular signals through the JNK pathway (Chen and Davis, 1999). JNK/SAPK and AP-1 activation were also required for the ultraviolet- and acetaldehyde-induced increase in alpha 1(I) collagen gene expression (Chen and Davis, 1999, 2000). The ultraviolet- and acetaldehyde-responsive elements were located in the distal GC box, and the GC box was bound by a DNA-binding protein termed basic transcription-binding protein. On the other hand, treatment of rat hepatic stellate cells with a 5-lipoxygenase-specific inhibitor reduced alpha 1(I) procollagen mRNA transcript abundance, which suggested that leukotriene production might be involved in maintaining the activated cell's high level of collagen production (Chen et al., 1996). Suppression of the gene transcription was localized to a nuclear factor-1 binding domain in the proximal promoter and an AP-2 binding domain adjacent to it. An increase in AP-2 binding adjacent to the nuclear factor-1 site was likely to be the transmodulator responsible for the suppression of the nuclear factor-1-dependent gene expression (Chen et al., 1996).

In summary, we have shown that ethanol and acetaldehyde induced the activation of MAP kinases and AP-1, but not NF-kappa B, in activated PSCs. This specific activation of signaling pathways may depend on the generation of reactive oxygen species and reflect gene activation pathways distinct from that used by proinflammatory cytokines. The signaling pathways in PSCs remain largely unknown and elucidation of the pathways would provide better understanding and rational approaches for the control of pancreatic inflammation and fibrosis targeting PSCs.

    Acknowledgments

We thank Dr. Naofumi Mukaida for the luciferase vectors.

    Footnotes

Accepted for publication March 11, 2002.

Received for publication December 26, 2001.

This work was supported in part by a grant-in-aid for the Encouragement of Young Scientists from Japan Society for the Promotion of Science (to A.M.) and by Pancreas Research Foundation of Japan (to A.M.).

Address correspondence to: Dr. Atsushi Masamune, Division of Gastroenterology, Tohoku University Graduate School of Medicine, 1-1 Seiryo-cho, Aoba-ku, Sendai 980-8574 Japan. E-mail: amasamune{at}int3.med.tohoku.ac.jp

    Abbreviations

PSCs, pancreatic stellate cells; alpha -SMA, alpha -smooth muscle actin; MAP, mitogen-activated protein; AP-1, activator protein-1; NF-kappa B, nuclear factor-kappa B; SB203580, 4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)imidazole; IL, interleukin; Ikappa B, inhibitor of NF-kappa B; PD98059, 2'-amino-3'-methoxyflavone; NAC, N-acetyl-cysteine; ERK, extracellular signal-regulated kinase; JNK/SAPK, c-Jun N-terminal kinase/stress-activated protein kinase; MCP-1, monocyte chemoattractant protein-1; ICAM-1, intercellular adhesion molecule-1; GC, guanine cytosine.

    References
Top
Abstract
Introduction
Experimental Procedures
Results
Discussion
References


0022-3565/02/3021-0036-0042$03.00
THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS
Copyright © 2002 by The American Society for Pharmacology and Experimental Therapeutics



This article has been cited by other articles:


Home page
Ther Adv Cardiovasc DisHome page
J. Ren and L. E. Wold
Mechanisms of alcoholic heart disease
Therapeutic Advances in Cardiovascular Disease, December 1, 2008; 2(6): 497 - 506.
[Abstract] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
A. Masamune, T. Watanabe, K. Kikuta, K. Satoh, and T. Shimosegawa
NADPH oxidase plays a crucial role in the activation of pancreatic stellate cells
Am J Physiol Gastrointest Liver Physiol, January 1, 2008; 294(1): G99 - G108.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
H. Asaumi, S. Watanabe, M. Taguchi, M. Tashiro, and M. Otsuki
Externally applied pressure activates pancreatic stellate cells through the generation of intracellular reactive oxygen species
Am J Physiol Gastrointest Liver Physiol, November 1, 2007; 293(5): G972 - G978.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
J A McCarroll, P A Phillips, N Santucci, R C Pirola, J S Wilson, and M V Apte
Vitamin A inhibits pancreatic stellate cell activation: implications for treatment of pancreatic fibrosis
Gut, January 1, 2006; 55(1): 79 - 89.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
G Perides, X Tao, N West, A Sharma, and M L Steer
A mouse model of ethanol dependent pancreatic fibrosis
Gut, October 1, 2005; 54(10): 1461 - 1467.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
S J Pandol
Are we studying the correct state of the stellate cell to elucidate mechanisms of chronic pancreatitis?
Gut, June 1, 2005; 54(6): 744 - 745.
[Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
A. Masamune, K. Kikuta, M. Satoh, N. Suzuki, and T. Shimosegawa
Protease-Activated Receptor-2-Mediated Proliferation and Collagen Production of Rat Pancreatic Stellate Cells
J. Pharmacol. Exp. Ther., February 1, 2005; 312(2): 651 - 658.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
A. Masamune, K. Kikuta, N. Suzuki, M. Satoh, K. Satoh, and T. Shimosegawa
A c-Jun NH2-Terminal Kinase Inhibitor SP600125 (Anthra[1,9-cd]pyrazole-6 (2H)-one) Blocks Activation of Pancreatic Stellate Cells
J. Pharmacol. Exp. Ther., August 1, 2004; 310(2): 520 - 527.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Yeh, N. M. Gharavi, J. Choi, X. Hsieh, E. Reed, K. P. Mouillesseaux, A. L. Cole, S. T. Reddy, and J. A. Berliner
Oxidized Phospholipids Increase Interleukin 8 (IL-8) Synthesis by Activation of the c-src/Signal Transducers and Activators of Transcription (STAT)3 Pathway
J. Biol. Chem., July 16, 2004; 279(29): 30175 - 30181.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S.-Y. Li, M. Gomelsky, J. Duan, Z. Zhang, L. Gomelsky, X. Zhang, P. N. Epstein, and J. Ren
Overexpression of Aldehyde Dehydrogenase-2 (ALDH2) Transgene Prevents Acetaldehyde-induced Cell Injury in Human Umbilical Vein Endothelial Cells: ROLE OF ERK AND p38 MITOGEN-ACTIVATED PROTEIN KINASE
J. Biol. Chem., March 19, 2004; 279(12): 11244 - 11252.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
H. Li and K. H. Kim
Effects of Ethanol on Embryonic and Neonatal Rat Testes in Organ Cultures
J Androl, September 1, 2003; 24(5): 653 - 660.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
J. A. Baron, B. F. Cole, L. Mott, R. Haile, M. Grau, T. R. Church, G. J. Beck, and E. R. Greenberg
Neoplastic and Antineoplastic Effects of {beta}-Carotene on Colorectal Adenoma Recurrence: Results of a Randomized Trial
J Natl Cancer Inst, May 21, 2003; 95(10): 717 - 722.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
A. Masamune, M. Satoh, K. Kikuta, Y. Sakai, A. Satoh, and T. Shimosegawa
Inhibition of p38 Mitogen-Activated Protein Kinase Blocks Activation of Rat Pancreatic Stellate Cells
J. Pharmacol. Exp. Ther., January 1, 2003; 304(1): 8 - 14.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Masamune, A.
Right arrow Articles by Shimosegawa, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masamune, A.
Right arrow Articles by Shimosegawa, T.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition