Introduction

Top Abstract Introduction Experimental Procedures Results Discussion References

P2Y receptors are G protein-coupled receptors that respond to the presence of extracellular nucleotides. Both purine and pyrimidine nucleotides can modulate a variety of physiological functions by interaction with P2Y receptors (Harden et al., 1995; Burnstock, 1997; Ralevic and Burnstock, 1998). Six mammalian P2Y receptors have been cloned so far, including P2Y₁, P2Y₂, P2Y₄, P2Y₆, P2Y₁₁, and more recently, P2Y₁₂ (Burnstock, 1997; Communi et al., 1997; Ralevic and Burnstock, 1998; Hollopeter et al., 2001; Zhang et al., 2001). P2Y₁, P2Y₂, and P2Y₆ couple to the activation of phospholipase C (PLC); P2Y₁₁ couples to the activation of both PLC and the adenylyl cyclase pathways, whereas human P2Y₄ couples to adenylyl cyclase pathways at the early stage and PLC at a later stage (Communi et al., 1996; Ralevic and Burnstock, 1998). P2Y₁ is selectively activated by ADP with ATP, being either a partial agonist or an antagonist; P2Y₂ is activated equipotently by ATP and UTP; human P2Y₁₁ is selectively activated by ATP; human P2Y₆ is selectively activated by UDP, whereas rat P2Y₆ is selectively activated by UTP; and human P2Y₄ is activated selectively by UTP, whereas rat and murine P2Y₄ are activated equipotently by ATP and UTP (Harden et al., 1995; Burnstock, 1997; Ralevic and Burnstock, 1998). In contrast, the P2Y₁₂ receptor recently described by us (Zhang et al., 2001) and Hollopeter et al. (2001) is potently activated by ADP and is coupled to the inhibition of adenylyl cyclase activity through the Gi class of G proteins.

Analysis of the expression profile of P2Y₁₂ receptor mRNA revealed that it is expressed at high levels in platelets, in addition to brain tissue. The data presented by Hollopeter et al. (2001) and the analysis of platelet function in P2Y₁₂ null mice by Foster et al. (2001) clearly indicate that P2Y₁₂ represents the long sought-after platelet ADP receptor. Furthermore, these studies reveal that P2Y₁₂ is the molecular target of the important antithrombotic drug clopidogrel (Boyer et al., 1993; Daniel et al., 1998; Foster et al., 2001; Hollopeter et al., 2001).

Surprisingly, the P2Y₁₂ receptor shares little homology with the other P2Y receptors, and the closest nonorphan relative is the UDP-glucose receptor, which is approximately 43% identical. However, P2Y₁₂ is closely related to several orphan GPCRs, one of which shares about 45% homology. This orphan G protein-coupled receptor (designated SP174) was cloned from a human neutrophil cDNA library. In the present study, we demonstrate that SP174, which is expressed in the brain and immunological cells, is also potently activated by ADP and is linked to Gi.

	Experimental Procedures

Top Abstract Introduction Experimental Procedures Results Discussion References

Reagents and Materials. All nucleotides were obtained from either Sigma-Aldrich (St. Louis, MO) or Sigma/RBI (Natick, MA). Fluo-3-AM and pluronic acid were from Molecular Probes (Eugene, OR). Cell culture media and reagents were from Invitrogen (Carlsbad, CA). All cloning work was performed according to standard procedures in Ausubel et al. (1987). Scintillation cocktail (ReadySafe) for aqueous sample was obtained from Beckman Coulter, Inc. (Fullerton, CA). Chimeric G proteins (Gq/z, Gq/s, Gq/12, Gq/i, Gq/i3, Gq/o, and Gq/16) were constructed by replacing the five C-terminal residues of human Gq with the five amino acid residues of the corresponding G protein (Conklin et al., 1993). All chimeric G proteins were cloned into the mammalian expression vector pCR3.1 (Invitrogen).

Treatment of ATP and 2-MeS-ATP. To avoid the degradation contamination of ATP, ATP solutions were treated by using an ATP-regenerating system (Hechler et al., 1998; Communi et al., 2001). Briefly, 1 mM ATP solutions were treated at room temperature with 20 units/ml creatine phosphokinase (type III from bovine heart; Sigma-Aldrich) and 10 mM creatine phosphate, and the entire mixture was added to the cells. The same procedure was used to purify 2-MeS-ATP from contaminating ADP derivatives.

RT-PCR in Human Blood Platelets. RT-PCR experiments were performed similarly to those described in Zhang et al. (2001). Briefly, total RNA was isolated from washed human platelets by using RNeasy mini kit (QIAGEN, Valencia, CA). First-strand cDNA was synthesized using a random hexamer primer with Superscript (Invitrogen). RT-PCR with gene-specific primers was performed using Hi-Fidelity Supermix (Invitrogen). CD2 and -integrin were used as controls. Primer sets were as follows: 5' primer of P2Y₁₂ is CTGGGCATTCATGTTCTTACTC and 3' primer of P2Y₁₂ is TGCCAGACTAGACCGAACTCT; 5' primer of CD2 is GCTGGCTGGACAACATTGACTGGG and 3' primer of CD2 is AGGGAGGGTGGGGGTGTGGGATT; 5'-primer of 2-integrin is TGGCGCACAAGCTGGCTGAAAACAA and 3' primer of 2-integrin is ACCGGCACTCACACTGGGGAAGAA; and 5' primer of SP174 is GCCAGAGTTCCATATACTCACAGTCAA and 3' primer of SP174 is GCCAAGCTTTCAGCCTAAGGTTATGTTGTC.

Cloning and Expression of SP174. A full-length cDNA of SP174 was first cloned by Human Genome Sciences, Inc. (Rockville, MD) from a human neutrophil cDNA library and was disclosed in Patent WO9630403. The open reading frame of SP174 was subcloned into the pCDNA3.1 expression vector with hygromycin selection (Invitrogen). SP174/pCDNA was then transfected into HEK293-EBNA cells using LipofectAMINE (Invitrogen). Stable cell lines were established by selection under 1 mg/ml hygromycin (Invitrogen) 24 h after transfection. The mouse homolog SP174 was cloned based on the sequence of GenBank AK008013 by PCR. The open reading frame was identified using DNASTAR software (DNASTAR, Inc., Madison, WI), two primers were designed with the first primer A started with the 5' ATG (primer A sequence is 5'-GGATGCTCGGGACAATCAACACCACTGGGATG-3') and the second primer B started with 3' stop codon (primer B sequence is 5'-GGTCAGGCTAGGGTGATGTTGTCTGTCTGAC-3'). Marathon-ready spleen cDNA from BD Biosciences Clontech (Palo Alto, CA) was used as template. The PCR product was cloned to pCR3.1 vector (Invitrogen) and sequence confirmed.

Messenger RNA Expression Analysis. To determine the distribution of SP174 in human tissues and mouse tissues, vector primers (T3/T7) were used to amplify a 1.0-kb insert from human SP174 and mouse plasmid DNA, respectively, which was then gel-purified. The purified amplicon was random-prime labeled (Prime-It II; Stratagene, La Jolla, CA) with [³²P]dCTP, and hybridized overnight at 65°C with either multiple tissue Northern blots or RNA Master blots (both from BD Biosciences Clontech). For the RNA Master blots, the hybridization buffer (Express-Hyb; BD Biosciences Clontech) contained 0.1 mg/ml sheared salmon sperm DNA (Invitrogen), 6 µg/ml human C_ot-1 DNA, and 2 × 10⁷ cpm of probe. Only the probe was added to the Express-Hyb for hybridization with the Northern blots. The following day the blots were washed with increasing stringency according to the manufacturer's protocol, wrapped in Saran wrap, and exposed to Kodak Biomax MS film for 24 to 72 h at 70°C. The films were analyzed for semiquantitative autoradiography using the M4/MCID image analysis package (Imaging Research, St. Catherines, ON, Canada).

Cell Transfection. For ligand screening assays, 5 µg of SP174/pCDNA3.1 or P2Y₁₂/pCDNA3.1 and a mixture of chimeric G proteins (0.5 µg for each chimera) were cotransfected in HEK293-EBNA, HEK293, CHO-DHFR, and NIH3T3 cells in a 75-cm² flask. As a negative control, the same amount of empty pCDNA3.1 plasmid and the chimeric G protein mixture were cotransfected into HEK293-EBNA, HEK293, CHO-DHFR, and NIH3T3 cells. For pharmacological studies, HEK293-EBNA cells stably transfected with SP174 were also used in addition to transiently transfected cells as indicated. HEK293-EBNA cells are the fast-growing 293-EBNA cells (catalog no. R620-07; Invitrogen) that are resistant to G-418, whereas HEK293 cells are slow growing HEK293 cells (ATCC CRL-1573) that are not resistant to G-418.

Fluorometric Imaging Plate Reader (FLIPR) Assay. The transiently transfected cells or stable cell lines were seeded into 96-well plates (black well, clear bottom) and incubated in a tissue culture incubator at 37°C overnight. The growth medium was then aspirated and replaced with 100 µl of loading medium (Dulbecco's modified Eagle's medium containing 1% fetal bovine serum, 1 mM Fluo-3-AM/10% pluronic acid, and 2.5 mM probenecid) and incubated for 1 h at 37°C. The cells were subsequently washed three times with Hanks' balanced salt solution containing 20 mM HEPES, 2.5 mM probenecid, and 0.1% bovine serum albumin using a cell washer (Denley Instruments, Needham Heights, MA). Wash buffer (100 µl) was left in each well. The washed cells were placed in an FLIPR and changes in cellular fluorescence were recorded immediately after the addition of 50 µl of testing compounds diluted in wash buffer. The fluorescence change usually flattens out after 60 s.

cAMP Assay. SP174 stably transfected HEK293-EBNA cells were used for cAMP assay. SP174 stable cell line and wild-type cells were first grown on 12-well plates to 70 to 80% confluence. The cells were then incubated for 2 h with 200 µl of medium plus 5 µCi of [³H]adenine/ml. Subsequently 50 µl of 250 mM HEPES, pH 7.5, containing 50 µM forskolin and 200 µM 3-isobutyl-1-methylxanthine with the compound to be tested was added to the cells and incubated for 10 min at 37°C. Incubations were terminated by addition of 0.8 ml of cold 5% trichloroacetic acid. [³H]cAMP was purified using Dowex and alumina chromatography and quantitated by scintillation counting as described previously (Harden et al., 1982).

	Results

Top Abstract Introduction Experimental Procedures Results Discussion References

Cloning and Sequence Analysis. A full-length human cDNA of SP174 was first cloned by Human Genome Sciences, Inc. (Fig. 1A), and the sequence was disclosed in Patent WO9630406. It contains a 1002-base open reading frame encoding 333 amino acid residues. SP174 is identical to GPR86 or GPR94 (Lee et al., 2001; Wittenberger et al., 2001). The hydrophilicity profile of the deduced peptide sequences revealed the presence of seven hydrophobic regions (underlined in Fig. 1A), consistent with a seven transmembrane structure typical of G protein-coupled receptors (Gilman, 1987; Strader et al., 1995). Using the human SP174 protein sequence to search GenBank, a mouse homolog (designated as mSP174) with 75% protein sequence identity was identified (GenBank accession no. AK008013). The sequence alignment for human SP174, mouse SP174, and human P2Y₁₂ is shown in Fig. 1A. Phylogenetic analysis shows that SP174 shares homology with a group of orphan G protein-coupled receptors (Fig. 1B). Its closest known receptors are P2Y₁₂ (45% identity) and UDP-glucose (43% identity) (Chao and Olson, 1993; Chambers et al., 2000; Foster et al., 2001; Hollopeter et al., 2001; Zhang et al., 2001). Similar to P2Y₁₂, SP174 shares relatively little homology with other known P2Y receptors (Chao and Olson, 1993; Ralevic and Burnstock, 1998; Foster et al., 2001; Hollopeter et al., 2001; Zhang et al., 2001).

View larger version (39K): [in this window] [in a new window]   Fig. 1.   A, protein sequence alignment of human SP174, mouse SP174, and human P2Y12. Numbers to the left refer to amino acids. Underlined amino acid sequences represent predicted seven transmembrane domains. B, phylogenetic analysis of SP174. SP174 is most closely related to P2Y12, KIAA0001 (UDP-glucose receptor), and H963 with sequence identity of 45, 43, and 32%, respectively. SP174 is more distantly related to other P2Y receptors.

Expression Profile of SP174 mRNA in Human and Murine Tissues. To determine the distribution of human SP174 expression in human tissues, a radiolabeled DNA probe from human SP174 was hybridized to multiple tissue mRNA dot blots (RNA Master blot; BD Biosciences Clontech) (Fig. 2A). The RNA Master blot contains a variety of human tissues, including different regions of brain, heart, spleen, and lung. As shown in Fig. 2A, hybridization of the human SP174 probe showed very strong signals in all brain regions as well as immune-related tissues such as spleen and bone marrow. The most intense signals were from adult spleen and fetal spleen. Because P2Y₁₂ is highly expressed in blood platelets, the expression of SP174 in these cells was investigated using RT-PCR on mRNA from human blood platelets. As shown in Fig. 2B, a specific 140-base pair product of P2Y₁₂ was amplified (lane 1), whereas no specific band was visible for SP174 (lane 4, expected size is 250 base pairs). To examine the distribution of SP174 in further detail, quantitative PCR was used to examine SP174 expression in a collection of cDNA libraries prepared from various lymphoid cells and tissues, as well as a collection of cDNA from various fetal tissues (Fig. 2C). SP174 was found to be expressed in peripheral blood monocytes, Th0 cells, monocytes, and dentritic cells. The fetal tissue distribution is similar to that of adult tissue distribution. The tissue distribution of mouse SP174 was also determined using dot blot (Fig. 2D). As shown in Fig. 2D, hybridization of mouse SP174 probe showed very strong signals in spleen, pancreas, total brain, and liver. The tissue distribution of mouse SP174 is similar to that of human SP174. Northern blot analysis further confirmed the mouse SP174 tissue distribution. A dominant 3.0-kb mRNA band was observed in mouse heart, brain, spleen, and liver. The mRNA expression profile of SP174 suggests that SP174 may play a role in immunological and neurological functions.

View larger version (302K): [in this window] [in a new window]   Fig. 2A.   Human mRNA dot blot of SP174. The human mRNA Master blot from BD Biosciences Clontech was hybridized to 32P-radiolabeled probe of SP174 (see Experimental Procedures). Top left, autoradiogram of the hybridized blot. The autoradiogram was quantitated as described under Experimental Procedures and the signal for each tissue was normalized relative to spleen signal (the 100% signal). Right, normalized data. Fig. 2B.   Expression of SP174 in human platelets. RT-PCR was performed as described under Experimental Procedures using specific primers for each gene of P2Y12, CD-2, 2-integrin, and SP174. Primer sets are as follows: lane 1, P2Y12; lane 2, CD-2; lane 3, 2-integrin; lane 4, SP174. +RT, cDNA was synthesized in the presence of reverse transcriptase; RT, cDNA was synthesized in the absence of reverse transcriptase, which was used as a control to exclude the contamination of genomic DNA. Fig. 2C.   Quantitative PCR analysis of the distribution of SP174 mRNA in specific tissues and lymphoid cells. cDNA libraries prepared from the indicated tissues and cell types were used as templates in PCR reactions with SP174-specific primers as described under Experimental Procedures. Results are displayed as the ratio of target product to internal control product, and values above 105 are considered significant. PMBC, peripheral blood monocyte; NK, natural killer cell; BM-DC, bone marrow-derived dendritic cell; MD-DC, monocyte-derived dendritic cell; DC, dendritic cell; RA, rheumatoid arthritis; LPS, lipopolysaccharide. Fig. 2D.   Mouse mRNA dot blot and Northern blot of SP174. The mouse mRNA Master blot from BD Biosciences Clontech was hybridized to 32P-radiolabeled probe of mouse SP174 (see Experimental Procedures). Top left, autoradiogram of the hybridized blot. Bottom, autoradiogram of Northern blot. Right, quantitation of dot blot. The quantitation and normalization is similar to the human blot.

Identification of Ligand for SP174. To understand the function of SP174, we set out to identify its endogenous ligand. SP174 was cotransfected with a mixture of chimeric G protein plasmids encoding Gq/12, Gq/16, Gq/i, Gq/z, Gq/i3, Gq/s, and Gq/o (Conklin et al., 1993; Saito et al., 1999) to HEK293-EBNA, HEK293, NIH3T3, and CHO-DHFR, whereas empty pCDNA-3.1 was cotransfected with chimeric G protein mixture as negative control. Chimeric G proteins were used to allow Gi-, Gs-, or Gz-coupled receptor to be assayed by calcium mobilization (Conklin et al., 1993; Saito et al., 1999). These transfected cells were used to screen our in-house ligand collection using a high-throughput calcium mobilization assay with a FLIPR instrument. The results of this assay revealed that ADP was able to activate SP174 in HEK293-EBNA cells. Subsequent experiments using chimeric G proteins transfected individually with SP174 indicated that the Gq/i3 chimera provided the most robust response (Fig. 4A). Using SP174- and Gq/i3-cotransfected HEK293-EBNA cells, the response to ADP was examined (Fig. 3A). At a low concentration (27 nM), ADP activated only SP174/Gq/i3-transfected cells but not pCDNA/Gq/i3-transfected cells. However, at higher concentration (166 nM), ADP stimulated calcium mobilization in both the vector and SP174-transfected cells. Because HEK293-EBNA cells have been shown to express the P2Y₁ receptor (F. Zhang, unpublished observations), a P2Y₁-specific antagonist, MRS-2179, was used to in an attempt to block activation of this site by ADP (Camaioni et al., 1998). Using SP174- and Gq/i3-cotransfected HEK293-EBNA cells, the effect of increasing doses of MRS-2179 was examined in the presence of 80 nM ADP (Fig. 3B). In the control cells, MRS-2179 was able to completely block ADP-induced calcium mobilization. However, in the SP174- and Gq/i3-transfected cells, MRS-2179 only exhibited a maximal inhibition of 25%. Thus, MRS-2179 could be used to block the endogenous P2Y1 receptor with little effect on SP174 activity.

View larger version (17K): [in this window] [in a new window]   Fig. 3.   ADP activation of SP174. A, SP174 or the vector pCDNA3.1 was cotransfected with chimeric Gq/i3 into HEK293-EBNA cells and Ca2+ mobilization in response to ADP was measured by FLIPR. Fluorescence units represent peak fluorescence measured at the indicated concentration of ADP. B, blockade of endogenous P2Y1 activity. SP174 or the vector pCDNA3.1 was cotransfected with chimeric Gq/i3 into HEK293-EBNA cells and Ca2+ mobilization in response to 80 nM ADP in the presence of increasing dose of the P2Y1 antagonist MRS-2179 was measured by FLIPR. C, ADP dose response at SP174 in the presence of MRS-2179. SP174 or the vector pCDNA3.1 was cotransfected with chimeric Gq/i3 into HEK293-EBNA cells and the response to increasing concentrations of ADP in the presence of 4 µM MRS-2179 was measured by FLIPR.

G Protein Coupling of SP174. To determine the G protein-coupling specificity of SP174, single chimeric G proteins were cotransfected with SP174 into HEK293-EBNA cells, and the response to 40 nM ADP was then measured by FLIPR. As shown in Fig. 4A, strong Ca²⁺ flux signals were observed for cells transfected with SP174 and Gq/i, or Gq/i3, whereas much weaker signals were observed for cells transfected with SP174 and all other chimeric G proteins. These results suggest that SP174 should normally couple to G proteins of the Gi class (Conklin et al., 1993; Saito et al., 1999).

View larger version (20K): [in this window] [in a new window]   Fig. 4.   G protein coupling of SP174. A, G protein selectivity of SP174. SP174 (5 µg) was transiently cotransfected to HEK293-EBNA cells with 0.5 µg each of chimeric G protein Gq/o, Gq/12, Gq/s, Gq/i, Gq/16, Gq/z, Gq/i3, and Gq. The response to 40 nM ADP was then measured by FLIPR. B, inhibition of cAMP by SP174. HEK293-EBNA cells stably transfected with SP174 were labeled with 5 µCi/ml [3H]adenine then incubated with 50 µM forskolin and the indicated amount of 2-MeS-ADP. The [3H]cAMP generated was quantitated as described under Experimental Procedures.

Pharmacology of SP174. The pharmacological profile of SP174 was further characterized by the FLIPR assay. Using SP174- or P2Y₁₂- and Gq/i3-cotransfected HEK293-EBNA cells, a variety of nucleotides were screened by FLIPR assay. Figure 5, A to D, and F, show the dose-response curves for ADPS, 2-MeS-ADP, IDP, AP3A, and 2-MeS-ATP at SP174 and P2Y₁₂ in this assay. 2-MeS-ATP was treated with creatine phosphokinase to avoid degradation contamination. The concentration-response relationship of treated and untreated 2-MeS-ATP is shown in Fig. 5E. The EC₅₀ for untreated 2-MeS-ATP is 32.4 nM, and the EC₅₀ for treated 2-MeS-ATP is 82.6 nM, indicating the degradation contamination is minor and treatment does not dramatically change the potency of 2-MeS-ATP. Similar results were also obtained for ATP (data not shown). Table 1 lists the EC₅₀ values for all the compounds tested at human SP174, mouse SP174, and P2Y₁₂. The rank order of potency at human SP174 was 2-MeS-ADP = ADPS = 2-MeS-ATP > ADP > AP3A > ATP > IDP. Several nucleotide compounds appear to exhibit slight selectivity. 2-MeS-ADP and 2-MeS-ATP are about 4-fold more potent for hP2Y₁₂ than for SP174. However, IDP is about five-fold more potent for SP174 than for hP2Y₁₂. IDP is especially more potent for murine SP174 than for hSP174 and hP2Y₁₂. The EC₅₀ values of IDP were 9.2, 552, and 3.2 mM for mouse SP174, human SP174, and human P2Y₁₂, respectively.

View larger version (21K): [in this window] [in a new window]   Fig. 5.   Concentration-response relationship of different nucleotides at SP174. A, ADPS concentration-response relationship in HEK293-EBNA cells in the presence of MRS-2179. SP174, P2Y12, or the vector pCDNA3.1 was cotransfected with chimeric Gq/i3 into HEK293-EBNA cells and the response to increasing concentrations of ADP was measured in the presence of 4 µM MRS-2179 as described. B, 2-MeS-ADP concentration-response relationship in HEK293-EBNA cells in the presence of MRS-2179. C, IDP concentration-response relationship in HEK293-EBNA cells in the presence of MRS-2179. D, AP3A concentration-response relationship in HEK293-EBNA cells in the presence of MRS-2179. E, effect of 2-MeS-ATP treatment by kinase. 2-MeS-ATP obtained from Sigma-Aldrich was treated with creatine phosphate and creatine phosphokinase according to the procedures described under Experimental Procedures. The concentration-response relationship of untreated and treated 2-MeS-ATP was obtained in HEK293-EBNA cells in the presence of MRS-2179. F, treated 2-MeS-ATP concentration-response relationship in HEK293-EBNA cells in the presence of MRS-2179. Methods of B to F are the same as in A except mouse SP174 was also used in C.

	Discussion

Top Abstract Introduction Experimental Procedures Results Discussion References

The results of the present study clearly indicate that SP174 is a high-affinity receptor for ADP that is coupled to the Gi class of G proteins. Several lines of evidence indicate that it is unlikely the results presented herein are due to the unsuspected expression of a known purinergic receptor. Notably, a unique pharmacological and second messenger profile is observed, and is only present in conjunction with surface expression of transfected SP174. For example, the previously cloned P2 receptors (with the exception of P2Y₁₂) are all capable of coupling through Gq to activation of phospholipase C and Ca²⁺ mobilization. However, we demonstrate that SP174 couples only to the Gi class of G proteins, and requires the addition of chimeric G proteins (Gq/i or Gq/i3) to elicit mobilization of Ca²⁺. Furthermore, in wild-type HEK293-EBNA cells, ADP can act through an endogenous P2Y₁ receptor to mobilize Ca²⁺, and this response can be completely blocked by the specific P2Y₁ antagonist MRS-2179. However, MRS-2179 is not able to block completely ADP mobilization of Ca²⁺ in cells cotransfected with SP174 and Gq/i. Pharmacologically, SP174 differs from the P2Y₂, P2Y₄, P2Y₆, and P2Y₁₁ receptors as well in that ADP is the most potent of the naturally occurring nucleotides examined, whereas the most potent nucleotides for P2Y₂, P2Y₄, P2Y₆, and P2Y₁₁ receptors are ATP, UTP, or UDP (Ralevic and Burnstock, 1998; Hollopeter et al., 2001; Zhang et al., 2001).

SP174 is however very similar to the recently described P2Y₁₂ receptor. These receptors share approximately 45% sequence identity at the amino acid level; both of them respond to ADP with high potency; and they both couple to Gi-type G proteins. Furthermore, their interaction with nucleotide analogs reveals a similar pharmacological profile. However, several compounds appear to exhibit slight selectivity. Thus, the 2-methylthio derivatives of ADP and ATP exhibit slightly higher affinity for the P2Y₁₂ receptor versus SP174, whereas IDP is approximately 5-fold more potent for SP174 than for P2Y₁₂. Interestingly, all the compounds tested exhibit significantly higher potency at the mouse receptor compared with the human version. Given the high degree of homology between the human and mouse sequences, the basis of this discrepancy is not obvious and will require further investigation. We have shown that kinase treatment does not have a big effect on the potency of 2-MeS-ATP and ATP, and both treated 2-MeS-ATP and ATP are very active on SP174 (Fig. 5E). Our results are different from the results described by Communi et al. (2001) where kinase-treated 2-MeS-ATP and ATP were shown to be inactive at SP174. The basis for this discrepancy is not obvious and will require further investigation.

Analysis of the distribution of SP174 mRNA reveals high-level expression in brain tissue and cells of the immune system. In contrast, although the P2Y₁₂ receptor is highly expressed in brain tissue, expression in peripheral tissues appears quite low, with the exception of platelets (Hollopeter et al., 2001; Zhang et al., 2001). In platelets, ADP plays a very important role in platelet aggregation through interaction with at least two purinergic GPCRs; P2Y₁ and the Gi-linked P2Y₁₂ (or P2Yac). The inability to detect the presence of SP174 mRNA in the platelets indicates that P2Y₁₂ is the sole Gi-linked ADP receptor in these cells (Fig. 2B). In other circulating cells, however, SP174 appears to be abundantly expressed in select cell types. For example, SP174 mRNA is found in unpolarized T cells (Th0), in monocytes, and in dendritic cells derived from either monocytes or bone marrow. Interestingly, the expression of SP174 appears to be lost in T cells committed to either the Th1 or Th2 lineage. These results indicate that the effects of ADP on the maturation of T cells deserve further study.

In summary, the orphan GPCR designated SP174 has been shown to be a high-affinity receptor for ADP, which is coupled to the Gi class of G proteins. Given its structural and pharmacological similarity to the recently described P2Y₁₂ receptor, we propose designating this novel receptor as P2Y₁₃.