Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

The serine proteinase, trypsin, that acts as a digestive enzyme can also regulate target tissues via the proteolytic activation of a G-protein coupled proteinase-activated receptor, PAR₂ (Nystedt et al., 1994: Dery et al., 1998). PAR₂ activation by trypsin, like the activation of PAR₁ by thrombin, involves the proteolytic unmasking of an amino terminal receptor sequence that acts as a tethered ligand (Vu et al., 1991). As was discovered for the related thrombin-activated receptor PAR₁ (Vu et al., 1991), for PAR₂ short synthetic peptides based on the proteolytically revealed tethered ligand sequence, beginning with serine in rat (SLIGRL-NH₂) and human (SLIGKV-NH₂) PAR₂, can on their own activate PAR₂, so as to mimic the action of trypsin in a variety of tissues and cultured cells (Nystedt et al., 1994; Al-Ani et al., 1995; Hollenberg et al., 1997; Saifeddine et al., 1998). In addition, the peptide, SFLLR-NH₂, based on the proteolytically revealed human PAR₁ tethered ligand that activates PAR₁, was also found to activate PAR₂, whereas the partial reverse PAR₁ and PAR₂-derived peptide sequences, FSLLRY-NH₂ (FSY-NH₂) and LSIGRL-NH₂ (LS-NH₂) failed to activate the PAR₂ receptor (Blackhart et al., 1996; Al-Ani et al., 1999b). In the past, a peptide, YFLLRNP, derived from the tethered ligand sequence of human PAR₁, was found to be a partial PAR₁ receptor agonist, able to antagonize the action of thrombin in human platelets (Rasmussen et al., 1993), but not in cultured human endothelial cells (Kruse et al., 1995). To date, there is no available PAR₂ antagonist. Given the cross-reactivity of PAR₁-derived peptides with PAR₂, we hypothesized that peptide analogs based on either the PAR₁ or PAR₂-derived tethered ligand might be able to act as antagonists for the PAR₂ receptor, in keeping with the ability of YFLLRNP to antagonize PAR₁ (Rasmussen et al., 1993). To test this hypothesis, we synthesized peptide sequences based on the tethered ligands of PAR₁ and PAR₂, as described above, with a reverse sequence of the first two amino acids (i.e., FSLLRY-NH₂ and LSIGRL-NH₂). These two peptides were evaluated for their ability to act as PAR₂ antagonists for either trypsin or SLIGRL-NH₂ with a calcium signaling assay method employing rat and human PAR₂-transfected cell lines (Saifeddine et al., 1998; Al-Ani et al., 1999a,b) and an endothelium-dependent rat aorta relaxation assay (Hollenberg et al., 1997).

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

PAR₂ Cloning and Expression Based on the previously determined rat PAR₂ sequence (Saifeddine et al., 1996) and in keeping with our previous work (Al-Ani et al., 1999a,b) rat kidney cDNA was prepared using the first-strand cDNA synthesis kit (Pharmacia LKB Biotechnology, Uppsala, Sweden) according to manufacturer's recommendations at 37°C for 60 min; 3 µl of this solution was used for polymerase chain reaction (PCR) amplification to prepare a full-length receptor cDNA with primer pairs flanking the entire coding region, designed on the basis of the published rat PAR₂ sequence (Saifeddine et al., 1996). The primer pairs were: forward primer, PAR₂ - F: (containing a HindIII site and Kozak sequence shown in bold), 5' TCAAGCTTCCACCATGCGAAGTCTCAGCCTGGC 3' and reverse primer, PAR₂ R: (containing SmaI site shown in bold) 5' CCCGGGCTCAGTAGGAGGTTTTAACAC3'. Routinely, amplification was done using 2.5 units of Taq DNA polymerase (Promega, Madison, WI) in a 10 mM Tris-HCl buffer, pH 9.0 (50 µl, final volume) containing 1.5 mM MgCl₂, 50 mM KCl, 0.1% (v/v) Triton X-100, and 0.2 mM concentration of each dNTPs. Amplification was allowed to proceed for 35 cycles beginning with a 1-min denaturing period at 94°C, followed by a 1-min reannealing time at 55°C, and a primer extension period of 2 min at 72°C. The PCR products were separated by 1.5% agarose gel electrophoresis and visualized with ethidium bromide. The PCR product was "gene-cleaned" (Magic PCR Preps DNA purification system; Promega) and ligated (Ready To Go T4 ligase; Amersham Biosciences AB, Uppsala, Sweden) into the PGEM-T vector (Promega). Two microliters of this ligation mixture was used to transform Escherichia coli strain DH5 to produce permanent clones for both manual and automated sequencing by the dideoxynucleotide chain termination method (Sanger et al., 1977), employing a T7 DNA sequencing kit (Amersham Biosciences, Piscataway, NJ) or via the DNA Services Facility at the University of Calgary Faculty of Medicine. Then, the rat PAR₂ cDNA was further subcloned into the pcDNA3 mammalian expression vector (Invitrogen, Carlsbad, CA). Rat PAR₂ was then transfected into Kirsten virus-transformed rat kidney (KNRK) cells (American Type Culture Collection, Manassas, VA). Cells were transfected using the LipofectAMINE method, according to the manufacturer's instructions (Invitrogen) with 5 µg of each construct used per KNRK cell monolayer (60-mm² flask, 50-70% confluent). Transfected cells (either vector alone or PAR₂-containing vector) were subcloned in geneticin-containing medium (0.6 mg/ml), and PAR₂-expressing cells were isolated by fluorescence-activated cell sorting with the use of the anti-receptor B5 antibody (Al-Ani et al., 1999b) for rat PAR₂, to yield permanent cell lines in which >95% of the populations were found to exhibit reactivity with the antibody. Cells were routinely propagated in genecitin (0.6 mg/ml)-containing Dulbecco's modified Eagle's medium supplemented with 5% (v/v) fetal calf serum, using 80 cm² plastic T-flasks. Cells were subcultured by resuspension in calcium-free isotonic saline/EDTA solution, without the use of trypsin. A human PAR₂ construct (Bohm et al., 1996), kindly provided by Dr. N. Bunnett (University of California, San Francisco, CA) was transfected into KNRK cells as described above for rat PAR₂.

Measurement of Calcium Signaling Using Fluorescence Emission Cells to be used for measurements of trypsin and peptide-stimulated fluorescence emission (reflecting an increase in intracellular calcium) were grown at 37°C in 80 cm² T-flasks under an atmosphere of 5% CO₂ in room air to about 85% confluency and were disaggregated with calcium-free isotonic phosphate-buffered saline containing 0.2 mM EDTA. Either KNRK cells (wild-type, vector-transfected, or PAR₂-transfected cell lines, as above) or human embryonic kidney (HEK) cells (endogenously expressing both PAR₁ and PAR₂) were used essentially according to previously described procedures (Kawabata et al., 1999). Disaggregated cells were pelleted by centrifugation and resuspended in 1 ml Dulbecco's modified Eagle's medium/10% fetal calf serum for loading with the intracellular calcium indicator, Fluo-3 (Molecular Probes Inc., Eugene, OR) at a final concentration of 22 µM (25 µg ml¹) of Fluo-3 acetoxymethyl ester. Indicator uptake was established in the presence of 0.25 mM sulfinpyrazone, over 20 to 25 min at room temperature, after which time cells were washed twice by centrifugation and resuspension with the buffer described below, to remove excess dye. Fluo-3 loaded cells were then resuspended to yield a stock solution (about 6 × 10⁶ cells ml¹) in a buffer (pH 7.4) of the following composition: 150 mM NaCl, 3 mM KCl, 1.5 mMCaCl₂, 20 mM HEPES, 10 mM glucose, and 0.25 mM sulfinpyrazone. Fluorescence measurements, reflecting elevations of intracellular calcium, were conducted at 24°C using a PerkinElmer fluorescence spectrometer (PerkinElmer Instruments, Norwalk, CT) with an excitation wavelength of 480 nm and an emission recorded at 530 nm. Cells (about 2 ml of approximately 3 × 10⁵ cells ml¹) were maintained in suspension in a stirred (magnetic flea bar) thermostated plastic cuvette (total volume, 4 ml) and peptide or trypsin stock solutions were added directly to the suspension to monitor agonist-induced changes in fluorescence. The fluorescence signals caused by the addition of test agonists (trypsin or PAR₂APs) were compared with the fluorescence peak height yielded by replicate cell suspensions treated with 2 µM ionophore A23187 (Sigma Chemical Co., St. Louis, MO). This concentration of A23187 was at the plateau of its concentration-response curve for a fluorescence response. In this assay, KNRK cells expressing either rat or human PAR₂ yield a robust calcium signal in response to 10 nM trypsin and 10 µM SLIGRL-NH₂, whereas vector-transfected cells lacking PAR₂ do not respond. Measurements were done using three or more replicate cell suspensions derived from two or more independently grown crops of cells. Values in the figure represent the average ± S.E.M. (bars).

Bioassay Procedure. The endothelium-intact rat aorta ring assay used to monitor PAR₂ activation was essentially the same as the one used previously to evaluate the actions of PAR₂-activating peptides (Al-Ani et al., 1995; Hollenberg et al., 1997). Male albino Sprague-Dawley rats (250 to 300 g), cared for in accordance with the guidelines of the Canadian Council on animal care, were sacrificed by cervical dislocation and were immediately anticoagulated by the injection of heparin (1000 units in 2 ml of isotonic saline) into the left ventricular circulation. Clot-free portions of aorta were dissected free of adhering tissue and endothelium-intact ring preparation (approximately 2 mm × 2 mm) were cut for use in the bioassay. Aorta ring tissue was equilibrated for 1 h at 37°C in a gassed (5% CO₂, 95% O₂) Krebs-Henseleit buffer, pH 7.4, of the following composition: 118 mM NaCl, 4.7 mM KCl, 2.5 mM CaCl₂, 1.2 mM MgCl₂, 25 mM NaHCO₃, 1.2 mM KH₂PO₄, and 10 mM glucose. As previously described (Al-Ani et al., 1995), the relaxant actions of the PAR₂-activating peptide (PAR₂AP) SLIGRL-NH₂, and trypsin (10 nM) at a concentration that does not activate PAR₁ (Vu et al., 1991) were measured in endothelial-intact rat aorta rings that were preconstricted with 1 µM phenylephrine. The presence of an intact endothelium was verified by monitoring relaxant response to 1 µM acetylcholine. Agonists and peptide antagonists were added directly to the organ bath (4-ml cuvette) and ring tension was monitored using either Grass or Statham force-displacement transducers.

Assay of Proteolytic Activity of Trypsin. The universal protease substrate, resorufin-labeled casein, was used to detect trypsin proteolytic activity, according to the manufacturer's instructions (Roche Molecular Biochemicals, Summerville, NJ). In brief, 10 nM trypsin was incubated at 37°C for 10 to 60 min with the substrate (200 µg in 200 µl) in the presence or absence of 200 µM test inhibitor peptides. The absorbance of the released resorufin, reflecting proteolytic activity, was measured using a Beckman DU 640B Spectrophotometer (Beckman Coulter, Inc., Fullerton, CA) at 574 nm.

Measurement of the Proteolytic Release by Trypsin of a PAR₂-Activating Peptide from an Inactive Synthetic Peptide Precursor. The peptide sequence: GPNSKGR/SLIGRLDTP-YGGC (P20) represents the trypsin cleavage (site denoted by /) -activation site (active tethered ligand shown in bold) of rat PAR₂. The sequence YGGC was added for radiolabeling and cysteine-linked protein conjugation. After trypsin cleavage, the sequence, SLIGRLDTP... . becomes a receptor activating ligand. P20 itself does not activate PAR₂. The ability of trypsin (2 nM) to release the receptor-activating sequence, SLIGRLDTP from P20 in the absence or presence of other peptides (FSLLRY-NH₂, LSIGRL-NH₂: each at 200 µM) was tested using the following protocol. First, trypsin (2 nM) in the absence or presence of 200 µM FSLLRY-NH₂ or LSIGRL-NH₂ was incubated with P20 (20 µM) for 3 min at room temperature, at which point the proteolytic reaction was quenched by supplementing the solution with added soya trypsin inhibitor (STI: l µg ml¹). One minute thereafter, the STI-quenched reaction mixture was added to an indicator suspension of rat PAR₂-expressing KNRK cells that had been loaded with fluo-3 for monitoring PAR₂-induced elevations of intracellular calcium, according to the method described above. The generation of a calcium signal (E₅₃₀) by trypsin treatment of P20, followed by the addition of STI, indicated the successful unmasking by trypsin cleavage of the receptor-activating sequence (SLIGRLDP... ) from P20. The calcium signal (E₅₃₀) response of the cells to the trypsin-cleaved P20 product was expressed as a percentage (% trypsin) of the calcium signal observed in response to 2 nM trypsin that had not been incubated either with peptides or STI. As a control, STI (l µg ml¹) was added to the peptide substrate solution prior to the addition of trypsin, in which case no subsequent calcium signal was generated, indicating a lack of P20 cleavage.

Peptides and Other Reagents. All peptides were synthesized by solid-phase methods at the peptide synthesis facility, University of Calgary, Faculty of Medicine (Calgary, AB, Canada; director, Dr. Denis McMaster). High-performance liquid chromatography analysis, mass spectral analysis, and quantitative amino acid analysis confirmed the composition and purity of all peptides. Stock solutions, prepared in 25 mM of HEPES buffer, pH 7.4, were standardized by quantitative amino acid analysis to verify peptide concentration and purity. Porcine trypsin (14,900 units mg¹) was obtained from Sigma Chemical Co. A maximum specific activity of 20,000 units mg¹ was used to calculate the approximate molar concentration of trypsin in the incubation medium (1U ml¹  2 nM). Human thrombin (3186 units/mg protein) was from Calbiochem (San Diego, CA); a concentration of 1 unit/ml was calculated to be approximately 10 nM.

Monitoring Trypsin Removal of the PAR₂ N-terminal Epitope in Intact Cells by Immunocytochemistry. The rat PAR₂ clone used for the receptor-expressing KNRK cell line possesses an N-terminal sequence that is proximal to the receptor's cleavage/activation sequence and that is therefore released from the cell upon trypsin activation of PAR₂. We generated a rabbit antiserum (SLAW) targeted to an antigenic epitope (SLAWLLGGPNSKGR-GGYGGC) (epitope represented by bold) in the proteinase-released sequence. The polyclonal antiserum (SLAW) was raised in rabbits as described elsewhere (Kong et al., 1997; Al-Ani et al., 1999b) for a B5 anti-PAR₂ polyclonal antibody used by us previously (Kong et al., 1997; Al-Ani et al., 1999b). The B5 antiserum recognizes the PAR₂ receptor cleavage/activation sequence (GPNSKGRSLIGRLDTP) and can recognize both the cleaved/activated receptors as well as the uncleaved receptor. Neither the B5 nor the SLAW antibodies react with KNRK cells transfected with vector alone and the reactivity of both antibodies with PAR₂-expressing KNRK cells was abolished by preabsorption with the immunizing peptide (e.g., see Al-Ani et al., 1999b for B5 antibody and Fig. 7).

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

FSLLRY-NH₂ and LSIGRL-NH₂ Block Trypsin, but Not SLIGRL-NH₂ Activation of PAR₂ in Receptor-Expressing KNRK Cells. We first tested the ability of FSLLRY-NH₂ (FSY-NH₂) and LSIGRL-NH₂ (LS-NH₂) to affect calcium signaling in KNRK cells expressing rat PAR₂ (Fig. 1). Comparable results were obtained with cells expressing human PAR₂ (data not shown and Fig. 2). Although preincubation of the PAR₂-KNRK cells with the complete reverse PAR₂AP, LRGILS-NH₂ (LRG-NH₂, 200 µM: tracing A, Fig. 1), had no effect on the magnitude of the calcium signal elicited by 2 nM trypsin, both FSY-NH₂ (200 µM: tracing B, Fig. 1) and LS-NH₂ (200 µM: tracing C, Fig. 1) inhibited the trypsin-triggered response by at least 70%. In contrast, neither FSY-NH₂ (tracing D, Fig. 1) nor LS-NH₂ and LRG-NH₂ (identical to tracing D, Fig. 1, not shown) at a concentration of 200 µM affected the calcium response caused by the PAR₂AP, SLIGRL-NH₂ (SL-NH₂, 3 µM). Also, at a higher concentration (400 µM), FSY-NH₂ and LS-NH₂ failed to cause significant inhibition of the calcium signal triggered by 3 µM SL-NH₂ (data not shown). The concentrations of trypsin and SL-NH₂ used were at the EC₅₀ concentrations of their respective concentration-effect curves, causing a calcium signal equivalent to that of the test ionophore, A23187 (2 µM, Fig. 1, right-hand tracings) (Vergnolle et al., 1998 and data not shown). In addition, calcium responses were not detected in response to trypsin (20 nM) or SL-NH₂ (50 µM) either in the "empty" vector-transfected KNRK cell line or in a nontransfected background KNRK cell line (Al-Ani et al., 1999b and data not shown).

View larger version (22K): [in this window] [in a new window]   Fig. 1.   Differential inhibition by FSLLRY-NH2 (FSY-NH2) and LSIGRL-NH2 (LS-NH2) of PAR2 activation by either trypsin or SLIGRL-NH2 (SL-NH2). Calcium signaling (E530, reflecting increases in intracellular calcium) in rat PAR2-KRK cells in response to either trypsin (, Trp, 2 nM) or the PAR2-activating peptide, SL-NH2 (, SL-NH2, 3 µM), either in the absence (middle tracings) or presence (left-hand tracings) of inhibitory peptides was measured as outlined under Materials and Methods. A, lack of inhibition of trypsin signaling by the reverse PAR2-activating peptide, LRGILS-NH2 (, LRG-NH2, 200 µm). B, inhibition by FSY-NH2 (, FSY-NH2, 200 µM) of trypsin (2 nM) signaling. C, inhibition of trypsin signaling by LS-NH2 (, LS-NH2, 200 µM). D, lack of inhibition of SL-NH2 (3 µM)-mediated signaling by FSY-NH2. The control cellular responses to trypsin () and SL-NH2 () are shown in the middle of each set of tracings (A to D) and can be compared with the cellular response to 2 µM calcium ionophore (, A23187, 2 µM). The antagonist peptides were added to the cell suspension approximately 6 min prior to the addition of either trypsin (, 2 nM) or SL-NH2 (, 3 µM). The scale for time and calcium signal is shown to the right of tracing A. The results are representative of 3 or more separately conducted experiments with independently grown crops of rat PAR2-KNRK cells.

View larger version (18K): [in this window] [in a new window]   Fig. 2.   Concentration-effect curves for the inhibition by FSY-NH2 and LS-NH2 of trypsin-mediated calcium signaling in PAR2-KNRK cells. Rat PAR2-KNRK (A) and human PAR2-KNRK (B) cells loaded with fluo-3 as outlined under Materials and Methods were or were not treated with increasing concentrations of either FSY-NH2 () or LS-NH2 (), and a response to added trypsin (2 nM for rat PAR2-KNRK; 10 nM for human PAR2-KNRK) was then measured. Data points represent the mean (± S.E.M., bars) for three or more independent experiments done with triplicate cell suspensions. The responses of peptide-treated cell suspensions were expressed as a percentage (% control) of the control response to trypsin in the absence of added antagonist peptide. No antagonism was observed for the reverse PAR2-activating peptide, LRGILS-NH2 (, LRG-NH2, upper curve).

View larger version (14K): [in this window] [in a new window]   Fig. 3.   Inhibition of trypsin but not thrombin mediated calcium signaling by FSY-NH2 in HEK 293 cells. Calcium signaling (E530), reflecting increases in intracellular calcium was measured in HEK 293 cells in response to thrombin (, Thr, 20 nM) and trypsin (, Trp, 5 nM), either in the absence (A) or presence (B) of FSY-NH2 (, FSY-NH2, 200 µM). Responses were compared relative to the E530 signal yielded in each cell sample by 2 µM ionophore, A232187 (). The scale for time and calcium signal is shown in the middle. The results are representative of three or more separately conducted experiments with independently grown crops of HEK 293 cells.

FSLLRY-NH₂ and LSIGRL-NH₂ Blocked the Relaxant Action of Trypsin but Not SLIGRL-NH₂ in the Aorta Ring Bioassay. In view of the ability of FSY-NH₂ and LS-NH₂ to block trypsin-mediated calcium signaling in human and rat PAR₂ expressing KNRK cells, we hypothesized that in the rat aorta bioassay, the peptides might also block the relaxant action of trypsin, which is mediated via endothelial PAR₂ (Al-Ani et al., 1995; Saifeddine et al., 1996). As shown in Fig. 4, the relaxant action of trypsin, at a concentration (1 nM), well below that which might activate PAR₁, was essentially eliminated in the presence of 200 µM FSY-NH₂, whereas the relaxant action of the PAR₂-activating peptide, SL-NH₂, was not affected (Fig. 4A). At a concentration of 400 µM, LS-NH₂ reduced the relaxant effect of trypsin by about 50% (Fig. 4B), but like FSY-NH₂, had no effect on relaxation caused by SL-NH₂ (data not shown). In addition, there was no inhibition of the relaxant action of thrombin (200 nM) by 200 µM of the peptide FSY-NH₂ (Fig. 4C). This concentration of FSY-NH₂ markedly suppressed the response to trypsin (left-hand tracing, Fig. 4C) in a preparation that had previously responded to thrombin. In the absence of FSY-NH₂, the relaxant response to trypsin in a preparation that had been previously activated by thrombin (right-hand tracing, Fig. 4C) was the same as in a preparation that had not been previously exposed to thrombin (middle tracing, Fig. 4C). Activation of PAR1 by lower concentrations of thrombin (50 or 100 nM) was similarly not affected by 200 µM FSY-NH₂ (data not shown). The histograms in Fig. 4D summarize the actions of FSY-NH₂ and LS-NH₂ on the function of the proteases, trypsin and thrombin. Since FSY-NH₂ failed to inhibit thrombin action, the action of LS-NH₂ was not tested.

View larger version (15K): [in this window] [in a new window]   Fig. 4.   Inhibition of trypsin but not SL-NH2 and thrombin mediated relaxation by FSY-NH2 in the rat aorta ring bioassay. A to C, bioassay tracings; D, histograms showing averaged data (± S.E.M., bars, n = 3). Endothelium-intact aorta ring preparations were preconstricted with phenylephrine (, PE, 1 µM), and the endothelium-dependent relaxant effects of trypsin (, Trp, 1 nM), SL-NH2 (, 1 µM) or thrombin (, Thr, 200 nM) were monitored either in the absence (left-hand tracings, A and B; middle tracing, C) or presence of added FSY-NH2 (, 200 µM: right tracing, A; left tracing, C) or LS-NH2 (, 400 µM; right tracing, B). The control responses to trypsin are shown (on the left, A and B, and in the middle of C). W (arrow) indicates tissue wash. The scale for time and tension in the tissue bioassay is shown to the right of the tracing B. The histograms at the bottom summarize the responses to trypsin (+) and thrombin (+) either in the absence () or presence (+) of added peptide (additions shown at bottom).

The Proteolytic Activity of Trypsin Is Not Affected by FSLLR-NH₂ and LSIGRL-NH₂. One key issue to consider was that the ability of FSY-NH2 and LS-NH₂ to affect the activation of PAR₂ by trypsin might be due simply to an inhibitory action on the proteolytic activity of trypsin (e.g., see Bhattacharya et al., 2001). This possibility was tested in three ways. First, the ability of FSY-NH₂ and LS-NH₂ to reduce the proteolytic activity of trypsin was tested in a nonspecific proteolysis assay, using resorufin-labeled casein as a substrate. Second, trypsin in the presence and absence of either FSY-NH₂ or LS-NH₂, was evaluated for its ability to hydrolyze a synthetic peptide substrate, GPNSKGR/SLIGRLTDPYGGC (P20) representing the cleavage/activation sequence of rat PAR₂. Third, in the presence and absence of either FSY-NH₂ or LS-NH₂, the ability of trypsin to cleave and release the N-terminal portion of PAR₂, that is proximal to the receptor cleavage/activation site, was evaluated in KNRK cells expressing rat PAR₂ with its N-terminal epitope detected with the SLAW antiserum. As shown in Fig. 5, the rate of proteolysis of resorufin-labeled casein by 10 nM trypsin was unaltered in the presence of either FSY-NH₂ or LS-NH₂ at the same concentrations (200 µM) that inhibited PAR₂ activation in the cell and tissue assays (Figs. 1-4). Also, FSY-NH₂ and LS-NH₂ did not affect trypsin-mediated casein hydrolysis by 2 nM trypsin over a 30-min time period (not shown). As shown in Fig. 6, brief (3 min) trypsin treatment at room temperature of the peptide (P20) representing the activation/cleavage sequence of rat PAR₂ (GPNSKGR/SLIGRLDP) followed by quenching of the reaction with soya trypsin inhibitor, yielded a proteolysis product (presumably, SLIGRL... ) capable of activating PAR₂ (Fig. 6, A and B). In keeping with the results of the casein proteolysis experiment, the ability of trypsin (2-10 nM) to cleave P20 to reveal its PAR₂-activating sequence was not affected in the presence of either FSY-NH₂ or LS-NH₂ at a concentration (200 µm) that inhibited trypsin activation of PAR₂ in the calcium-signaling assay. In contrast, the addition of soya trypsin inhibitor to the P20 substrate solution prior to the addition of trypsin completely abolished the release of a PAR₂ activating peptide (no calcium signal, Fig. 6A, third histogram from left; Fig. 6B, top tracing, middle response). Finally, we wanted to investigate whether FSY-NH₂ and LS-NH₂ interfered with the ability of trypsin to release the amino terminal SLAW epitope from PAR₂ by proteolytic activation. As shown in Fig. 7, either in the absence (Fig. 7A, Trp; Fig. 7D) or presence of either FSY-NH₂ (Fig. 7A, FSY-NH₂ + Trp; Fig. 7E) or LS-NH₂ (Fig. 7A, LS-NH₂ +Trp; Fig. 7F), trypsin proteolysis was essentially equally effective in removing the PAR₂ epitope, that is N-terminal to the receptor cleavage/activation site equivalent to P20. The untreated PAR₂ expressing cells (Fig. 7A, Control; Fig. 7B) had positive immunoreactivity (granular cell membrane staining) with the SLAW anti-receptor antibody. It was also found that adding a premixed solution of soya trypsin inhibitor and trypsin to the cells prior to the addition of the antibody had no effect on the immunostaining of these cells (data not shown). In addition, immunoreactivity was detected neither when the SLAW antibody was preabsorbed with the receptor-derived peptide immunogen (Fig. 7C) nor in the empty vector-transfected KNRK cell line (data not shown).

View larger version (20K): [in this window] [in a new window]   Fig. 5.   Lack of effect of FSY-NH2 or LS-NH2 on proteolysis of resorufin-labeled casein by trypsin. The time course of proteolysis of the casein substrate by trypsin (increased absorbance at 570 nm: A570) in the absence () or presence of FSY-NH2 (, 200 µM), LS-NH2 (, 200 µM) or soya trypsin inhibitor (, 1 µg/ml) determined over a 1-h time period at 37°C was monitored as outlined under Materials and Methods. Data points represent the averages (± S. E. M, bars) at each time period for triplicate samples.

View larger version (13K): [in this window] [in a new window]   Fig. 6.   Proteolytic cleavage by trypsin of a peptide PNSKGR/SLIGRLDTPYGGC (P20) representing the cleavage/activation domain of rat PAR2 to yield PAR2-activating peptide: lack of effect of FSY-NH2 and LS-NH2 and inhibition by soya trypsin inhibitor. As outlined under Materials and Methods, P20 (20 µM) was incubated with 2 nM trypsin at room temperature for 3 min. in the absence or presence of FSY-NH2 (200 µM), LS-NH2 (200 µM), or soya trypsin inhibitor (STI 1 µg/ml), at which point the reaction was quenched by the addition of added STI (1 µg/ml). One minute thereafter, the reaction mixture was added to an indicator cell suspension of fluo-3-loaded rat PAR2 KNRK cells, and the calcium signal generated was monitored. The calcium signal caused by the release of PAR2 activating peptide from P20 was compared with the "control" signal generated by trypsin alone. A, histograms show the average calcium signals (± S.E.M., bars: % control trypsin response; open histogram) caused by the release of a PAR2-activating peptide from P20. On its own, P20 did not elicit a calcium response (second histogram from left). Although the addition of STI prior to the addition of trypsin abolished the ability of trypsin to release a PAR2-activating peptide from P20 (third histogram from left), the addition of STI after trypsin was combined with P20 did not affect the subsequent calcium signal (fourth histogram from left). Neither FSY-NH2 nor LS-NH2 affected the trypsin-mediated release of PAR2-activating peptide from P20 to cause a calcium signal (last two histograms on right). B, representative tracings of calcium signals. Each tracing shows the calcium signal generated in fluo-3-loaded rat PAR2-KNRK cells by the P20 proteolytic product released by trypsin in the absence or presence of 200 µM added peptide (FSY-NH2, tracing (b); LS-NH2, tracing (c)) or STI (1 µg/ml: tracing (a)). The order of addition of P20 peptide, STI, LS-NH2, FSY-NH2, and trypsin are shown at the bottom of each tracing. The control responses to trypsin are shown on the right.

View larger version (72K): [in this window] [in a new window]   Fig. 7.   Cleavage of PAR2 N-terminal SLAW epitope by trypsin in the presence of FSY-NH2 and LS-NH2. As outlined under Materials and Methods, permanently transfected PAR2 expressing KNRK cells were treated with trypsin alone (A, Trp and D), or trypsin in the presence of FSY-NH2 (A, FSY-NH2 + Trp and E) or LS-NH2 (A, LS-NH2 + Trp and F) and subjected to cytospin followed by immunocytochemistry with the SLAW antiserum. Positive control: cells were treated with the vehicle (A, Control and B). Negative control: cells were treated with the vehicle and the SLAW antibody preabsorbed by the immunizing peptide (C). The arrows (in B-F) indicate presence (B) or absence (C-F) of granular cell membrane immunoreactivity of the SLAW antibody. The bar in B represents 25 µm. In A, the histograms represent the percentage of average positive cells for 10 fields (approximately 700 examined cells) per slide. Error bars represent ± S.E.M.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

The main finding for our study was that the PAR₁/PAR₂-related peptides, FSLLRY-NH₂ and LSIGRL-NH₂, while unable on their own to activate PAR₂, were able to block the ability of trypsin to do so, either in a PAR₂ calcium signaling assay using PAR₂-expressing KNRK cells (Saifeddine et al., 1998; Al-Ani et al., 1999b) or in intact aorta tissue (Fig. 4) wherein proteolytic activation of PAR₂ causes an endothelium-dependent nitric oxide-mediated vasorelaxation (Al-Ani et al., 1995; Saifeddine et al., 1996). Notwithstanding, neither of these two peptides that antagonize trypsin-mediated PAR₂ activation affected receptor triggering by 100 to 400-fold lower concentrations of the PAR₂-activating peptide, SLIGRL-NH₂ (Fig. 1, tracing D and Fig. 4). One possible hypothesis that we considered for the ability of FSY-NH₂ and LS-NH₂ to block trypsin-mediated activation of PAR₂ without affecting activation caused by SL-NH₂ was that the peptides were simply inhibiting directly the proteolytic activity of trypsin, as did STI, to prevent the cleavage/unmasking of the cell-attached tethered ligand (e.g., see Bhattacharya et al., 2001). However, the results of three independent approaches to test this hypothesis indicated that the peptides, at concentrations that blocked trypsin (2-10 nM)-mediated PAR₂ activation, did not affect trypsin's proteolytic activity in the presence of the peptides at 200 µM: 1) the rate of hydrolysis of resorufin-labeled casein was unaffected, 2) cleavage of P20 to yield its PAR₂-activating sequence was unaffected, and 3) the ability of trypsin acting on receptor-expressing cells to strip the PAR₂ epitope, N-terminal to the receptor cleavage/activation site, was not impeded.

We therefore conclude that a mechanism other than a direct inhibition of trypsin proleolytic activity was responsible for the inhibitory effects of the peptides. This conclusion is supported further by the inability of FSY-NH₂ to inhibit activation of PAR₁ by the serine proteinase thrombin. A working hypothesis we suggest is that although the peptides FSY-NH₂ and LS-NH₂ do not block the ability of trypsin to unmask the tethered receptor-activating ligand sequence, SLIGRL... , that they are, nonetheless, able to impede access of the proteolytically revealed tethered ligand to the receptor-activating site, whereas the same peptides do not block access of the soluble receptor-activating peptides to distinct but possibly overlapping receptor activation sites in the extracellular receptor loops. The sites on PAR₂ at which FSY-NH₂ interacts would appear to be receptor-specific, in that the same peptide did not affect the ability of the PAR₁ tethered ligand revealed by thrombin to activate PAR₁. This possible difference between the docking sites of the soluble and tethered ligand in PAR₂ would be in keeping with data obtained for human PAR₁ (Blackhart et al., 2000), demonstrating differences between soluble receptor-activating ligands and the protease-revealed tethered ligand for activating selected PAR₁ receptor mutants. Furthermore, our own work with a mutated PAR₂ receptor having arginines substituted for glutamic acid in extracellular loop 2 showed that the trypsin revealed tethered ligand (SLIGRL... ) was more effective in activating the receptor than was the comparable soluble receptor-activating ligand, SLIGRL-NH₂ (Al-Ani et al., 1999a). Taken together, the data obtained by us for PAR₂ (Al-Ani et al., 1999a) and for PAR₁ by Blackhart et al., (2000) point to different receptor activation sites for the tethered and soluble ligands. Such differences, we believe, could conceivably account for the differential ability of FSY-NH₂ and LS-NH₂ to block trypsin but not SL-NH₂-mediated activation of PAR₂. Although further work will be required to establish the molecular basis for the suggested differences between the interactions of the tethered and soluble ligands with the receptor, our data obtained with FSY-NH₂ and LS-NH₂ suggest that any future research for putative PAR₂ receptor antagonists should take both potential mechanisms into account, so as to assess receptor activation both by proteolysis with trypsin and by a receptor-activating peptide such as SL-NH₂.