![]() |
|
|
Vol. 300, Issue 2, 526-534, February 2002
Waggoner Center for Alcohol and Addiction Research, Section of Neurobiology, University of Texas at Austin, Austin, Texas
| |
Abstract |
|---|
|
|
|---|
Glycine receptors (GlyRs) are pentameric ligand-gated ion channels that
inhibit neurotransmission in the adult brainstem and spinal cord. GlyR
function is potentiated by ethanol in vitro, and a mutant GlyR subunit
1(S267Q) is insensitive to the potentiating effects of
ethanol. To test the importance of GlyR for the actions of ethanol in
vivo, we constructed transgenic mice with this mutation. Under the
control of synapsin I regulatory sequences, transgenic expression of
S267Q mutant GlyR
1 subunits in the nervous system was
demonstrated using [3H]strychnine binding and
immunoblotting. These mice showed decreased sensitivity to ethanol in
three behavioral tests: ethanol inhibition of strychnine seizures,
motor incoordination (rotarod), and loss of righting reflex. There was
no change in ethanol sensitivity in tests of acute functional tolerance
or body temperature, and there was no change in ethanol metabolism.
Transgene effects were pharmacologically specific for ethanol, compared
with pentobarbital, flurazepam, and ketamine. These results support the
idea that glycine receptors contribute to some behavioral actions of
ethanol and that ethanol sensitivity can be changed in vivo by
transgenic expression of a single receptor subunit.
| |
Introduction |
|---|
|
|
|---|
Most
psychoactive drugs have multiple molecular targets in brain, and one of
the leading challenges in neuropharmacology is to link actions on
specific proteins with discrete behavioral effects of these drugs. A
notable success in this area is demonstrated by recent work defining
behavioral consequences of benzodiazepine action on specific subtypes
of GABAA receptors. Discovery of a mutation in
the
subunit of GABA receptors that prevents actions of
benzodiazepines without changing the GABA sensitivity of the receptor
allowed construction of mice ("knock-in") with
benzodiazepine-insensitive
subunits. This revealed that
benzodiazepine modulation of the
1,
2, and
3 subunits is
linked to distinct behavioral actions of these drugs (Low et al.,
2000
; McKernan et al., 2000
; Crestani et al., 2001
). This paradigm
provides a powerful approach to dissecting molecular determinants of
behavioral effects of drugs with complex mechanisms of action. Ethanol
is such a drug with effects on several neuronal ion channels, which may
be important for its behavioral and physiological effects (Harris,
1999
). The strategy used for benzodiazepines requires a mutation in a
protein that abolishes drug action without changing the normal function
of that protein. In this study we apply this approach to ethanol
actions on brain glycine receptors.
The glycine receptor (GlyR) is a member of the ligand-gated ion channel
superfamily that includes GABAA, nicotinic
acetylcholine, and serotonin3 receptors. The
strychnine-sensitive GlyR is an inhibitory pentameric receptor that
conducts the chloride ion and inhibits neurotransmission in the spinal
cord and brainstem. The GlyR is composed of three
subunits and two
subunits (Betz, 1992
), and gephryn localizes GlyR at postsynaptic
densities facing glycine-releasing nerve terminals (Triller et al.,
1985
; Todd, 1990
) by simultaneously binding microtubules (Meyer et al.,
1995
) and the
subunit (Kirsch and Betz, 1995
). GlyR function is
potentiated in vitro by ethanol, longer chain alcohols, and volatile
anesthetics (Celentano et al., 1988
; Engblom and Akerman, 1991
; Aguayo
and Pancetti, 1994
; Mascia et al., 1996a
,b
; Yamakura and Harris, 2000
). Several electrophysiological experiments have shown ethanol's ability
to potentiate GlyR function (Eggers et al., 2000
; Ye et al., 2001
).
Additional behavioral tests also suggest involvement of the GlyR with
the acute effects of ethanol. Glycine and the glycine precursor,
serine, can enhance the depressant effects of ethanol in mice, as
observed using the loss of righting reflex (LORR) test, and this effect
can be blocked by strychnine (Williams et al., 1995
). Ethanol also
inhibits strychnine seizures in mice (McSwigan et al., 1984
). However,
it is still unclear whether specific behavioral effects of ethanol can
be linked to potentiation of GlyR function. To address this question,
we have created lines of transgenic mice that express a mutant (S267Q)
1 subunit of the GlyR. This mutation was
selected because it retains normal sensitivity to glycine but abolishes
the enhancing effects of ethanol, and high concentrations of ethanol
inhibit the function of this mutant receptor. Expression of this
transgene in addition to endogenous expression of wild-type
1 subunits should reduce alcohol action of
GlyR; thus, any effects of ethanol that are mediated by GlyR should be
reduced or eliminated in transgenic mice. We tested a variety of acute
actions of ethanol, with an emphasis on those that might be related to
spinal cord or motor control. To ensure that behavioral phenotypes were
not due to the integration site, which will vary among transgenic lines
(Whitelaw et al., 2001
), we constructed and compared multiple
independent lines of transgenic mice.
| |
Materials and Methods |
|---|
|
|
|---|
Oocyte Electrophysiology.
Two-electrode voltage-clamp
electrophysiological recordings were performed as previously described
with Xenopus oocytes (Mascia et al., 2000
; Findlay et al.,
2001
) by using wild-type
1 and mutant
1 S267Q GlyR. We tested the capacity of
ethanol to enhance the effect of a glycine concentration that produced
5% of the maximal effect (EC5) of glycine.
Ethanol was perfused onto oocytes for 1 min and then coapplied with
glycine for 30 s, or glycine was applied alone for 30 s.
Maximal (peak) currents and EC5 values were
determined for each oocyte individually.
Construction of Mice.
The transgenic GlyR
1 S267Q mouse was created using the rat
synapsin I (Syn) promoter and inbred (FVB/NJ) mice by the following method. The Syn promoter was obtained (Hoesche et al., 1993
). The rat
4.3-kb Syn promoter was cut from the pBL4.3 Syn-Cat construct with SalI
and XhoI; both sites were then blunt-ended. The 4.3-kb Syn
promoter was cloned into the EcoRV site of pBluescript SK- and subsequently cut out with SmaI and XhoI and
both sites were blunt-ended. The blunted Syn promoter was cloned into
the pCI vector (Promega, Madison, WI) from which the
cytomegalovirus promoter was removed. Orientation of the Syn
promoter was confirmed by restriction digestion and sequencing. GlyR
1 S267Q was cloned (cut out of the pCis2
vector with SalI and blunt-ended) into the SmaI site in the
multiple cloning site of the pCIS-Syn vector. This construct (pCIS-Syn
GlyR
1 S267Q) was successfully expressed in
Xenopus oocytes before the transgenic mice were made. Using two-electrode voltage-clamp recordings, the ethanol-insensitive pharmacology of the GlyR
1 S267Q cDNA was
observed. In preparation for creation of transgenic mice, the Syn
promoter and the transgene sequences were cut away from the vector
backbone of the pCIS-Syn vector with ClaI digestion.
The resulting 6.4-kb band was injected into oocytes of inbred (FVB/NJ)
mice at the University of Colorado Health Sciences Center, Denver, CO.
1 coding region (sequence:
GCTTTAACTTCTGCCCTATGG) and a downstream primer from the
SV40 polyadenylation region (sequence: GTTGTTGTTAACTTGTTTATTG) present on the pCis-Syn vector were used. Using
this method, four transgenic founder mice were identified. Transgenic
mice were bred with wild-type (FVB/NJ) mice and the progeny were
subsequently genotyped for presence or absence of the transgene. All
testing performed on transgenic mice used wild-type littermates as
control mice.
To verify expression of the transgene, we crossed mice with a mutant
GlyR
1 subunit with our line 3 transgenic
mice. For this experiment, heterozygous
C57BL/6J-Glra1spd-ot mice (Jackson
Laboratories, Bar Harbor, ME), or spdot
mice,
were bred with transgenic mice to produce F2 mice who lack the
endogenous GlyR
1 subunit and possess the
transgene. spdot
mice are null mutants for the
GlyR
1 subunit. For these experiments, wild-type littermates were used as control mice.
Drugs. The following drugs were obtained from Sigma Chemical (St. Louis, MO): ethanol, strychnine, pentylenetetrazol, ketamine, and Tween 80. Flurazepam was obtained from Hoffman-LaRoche (Nutley, NJ), and pentobarbital was obtained from Sigma/RBI (Natick, MA). Ethanol was injected i.p. at 20% v/v in saline. Drugs were dissolved in 0.9% saline, except flurazepam, which was first dissolved in 3 to 4 drops of Tween 80 before saline was added. Strychnine and pentylenetetrazol were injected s.c.; all other drugs were injected i.p.
[3H]Strychnine Binding. Brain regions (cortex, midbrain, cerebellum, and combined brainstem and spinal cord) were dissected and placed into 2 ml of ice-cold assay buffer (145 M NaCl, 5 mM KCl, 1 mM MgCl2, 10 mM glucose, 1 mM CaCl2, 10 mM HEPES, pH 7.5). After homogenization by using a PowerGen 700 (Fisher Scientific, Pittsburgh, PA), samples were centrifuged at 30,000g for 25 min at 4°C and resuspended in assay buffer. Samples were again centrifuged at 30,000g at 4°C for 25 min and then resuspended in assay buffer. To measure specific binding of [3H]strychnine (250 µCi; Sigma/RBI, Boston, MA) to tissue membranes, aliquots of crude synaptic membranes (approximately 200 µg of protein) were incubated in a final volume of 0.5 ml of assay buffer in Eppendorf tubes at 0-4°C in a final concentration of [3H]strychnine (1-20 nM) with or without glycine (3 mM final concentration). Glycine was used to measure nonspecific binding. Incubations were terminated by rapid filtration and washing over a vacuum by using borosilicate microfiber filters (MFS, Dublin, CA). Filters were incubated overnight in Bio-Safe II scintillation liquid (4 ml; Research Products International, Mount Prospect, IL) before being analyzed with a scintillation counter (Beckman LS 6500; Beckman Coulter, Inc., Fullerton, CA). Specific [3H]strychnine binding was obtained by subtracting the nonspecific (in the presence of cold 3 mM glycine) binding from the total bound radioactivity. Values for KD and Bmax were determined by nonlinear regression analyses using the PRISM program (GraphPad Software, San Diego, CA).
Loss of Righting Reflex. Mice were given an injection of ethanol (3.6-4.3 g/kg), pentobarbital (45 mg/kg), flurazepam (225 mg/kg), or ketamine (150 mg/kg) and the length of drug-induced loss of righting reflex (sleep time) was measured. Upon loss of the righting reflex, mice were placed in a sleep trough (~90° angle) and the time to regain the righting reflex was measured. LORR is defined as the inability of a mouse to right itself within 30 s. Return of the righting reflex was defined as the ability of a mouse to right itself twice within 1 min. Duration of LORR is defined as the difference between loss and regaining of the righting reflex.
Ethanol-Induced Hypothermia. Basal body temperature was recorded then mice received an injection of ethanol (3.0-3.8 g/kg). Body temperature was measured rectally every 10 min for 180 min by using a RET-3 probe and thermolyte TH-5 monitor (Physitemp Instruments, Clifton, NJ). Data were statistically analyzed by comparing the area under the curves (change from baseline temperature × time) and maximal temperature alteration.
Acute Functional Tolerance.
Mice were tested for acute
functional tolerance as previously described (Erwin and Deitrich,
1996
). Mice were trained to remain on a rotarod (Economex; Columbus
Instruments, Columbus, OH; speed of rod, 5 rpm) for 1 min then given a
dose of ethanol (1.75 g/kg) and tested for recovery of balance every 5 min. When animals could remain on the rotarod again for 1 min, a
25-µl blood sample (BEC1) was taken from the retro-orbital sinus and
the animals were immediately injected with a dose of 2 g/kg ethanol.
When the animals again regained rotarod ability for 1 min, a final
25-µl blood sample (BEC2) was taken. BEC values, expressed as
milligrams of ethanol per milliliter of blood was determined
spectrophotometrically using an enzymatic assay (Lundquist, 1959
).
Ethanol Pharmacokinetics.
Mice received a 4.0-g/kg injection
of ethanol. Blood samples (25 µl) were taken from the retro-orbital
sinus by using capillary tubes (Drummond, Broomall, PA) at 15-, 60-, 120-, 180-, and 240-min time points. Ethanol content of blood samples
was determined spectrophotometrically using an enzymatic assay
(Lundquist, 1959
).
Initial Sensitivity to Motor Incoordination. Mice were trained on a fixed speed rotarod (Economex; Columbus Instruments; speed of rod, 2.5 rpm), and training was complete when mice were able to remain on the rotarod for 120 s. Ethanol or saline was injected, and the mouse was placed back on the rotarod 2 min later and the ability of the mouse to remain on the rotarod for 60 s was determined. The 95% confidence limits were determined using the "up and down" method (see below) with an ethanol log dose interval of 0.0138, which corresponds to approximately a 0.1-g/kg ethanol dose difference at doses tested.
This procedure was repeated using injections of pentobarbital or saline and waiting 15 min before testing for rotarod incoordination, by using a pentobarbital log dose interval of 0.0222, which corresponds to approximately a 1-mg/kg pentobarbital dose difference at doses tested.Initial Sensitivity to Loss of Righting Reflex. Mice were given saline or ethanol and 3 min later they were tested for an LORR (see above) greater than 1 min. The 95% confidence limits were determined using the "up and down" method (see below) with an ethanol log dose interval of 0.0138, which corresponds to approximately a 0.1-g/kg ethanol dose difference at doses tested.
Analysis of Data by Up and Down Method.
The up and
down method was used as described by Dixon and Massey (1969)
.
Mice were injected with an initial dose and tested, and the results
from each animal determined the dose that the next animal would
receive. If the mouse was unable to successfully perform the task then
the dose of drug administered would be decreased (by a log interval of
the dose). If the mouse was able to successfully perform the task then
the dose of drug administered would be increased (by a log interval of
the dose). The ED50 values were determined by the
following equation: 95% CI = dosing increment × 
level (Dixon and
Massey, 1969
). For each trial with a given drug, six subsequent mice
(n = 6) were used.
Spontaneous Motor Activity. Locomotor activity was measured in standard mouse cages with Opto-microvarimex (Columbus Instruments). Each cage had bedding, food, and water and was covered by a heavy plastic lid with holes for ventilation. Activity levels were monitored every hour for 24 h.
Elevated Plus-Maze.
The elevated plus-maze was a
modification of that validated by Lister (1987)
and comprised two open
(30 × 5 × 0.25 cm) and two enclosed (30 × 5 × 5 cm) arms, which extended from a common central platform (5 × 5 cm). The apparatus was constructed from black Plexiglas and was
elevated to a height of 60 cm above floor level. All testing was
conducted under room light. In accordance with established procedure
(Rodgers and Johnson, 1995
), mice were individually placed on the
central platform of the maze facing an open arm. A normal 5-min test
duration was used, with the maze thoroughly cleaned between subjects.
All test sessions were recorded by a vertically mounted camera linked
to a monitor and VCR in an adjacent laboratory. Parameters scored from
videotape were the conventional spatiotemporal measures and a range of
specific behaviors related to the defensive repertoire of the mouse
(Rodgers and Johnson, 1995
).
Immunoblotting.
Dissected cortex, midbrain, cerebellum,
brainstem, and spinal cord from transgenic and wild-type mice were
homogenized using a PowerGen 700 tissue tearor (Fisher Scientific) in a
buffer containing 320 mM sucrose, 5 mM HEPES, 1 mg/ml leupeptin, 1 mg/ml aprotinin, and 1 mg/ml pepstatin. Homogenates were centrifuged at
5,000g for 5 min (4°C), and the supernatant fraction was
subsequently centrifuged at 30,000g for 30 min (4°C). The
resulting pellet was resuspended in homogenization buffer and analyzed
for protein concentrations by using the Bradford method (1976)
.
Loading dye (200 mM Tris, 400 mM dithiothreitol, 8% glycerol, 0.4%
bromophenol blue) was added to samples, which were subjected to
SDS-polyacrylamide gel electrophoresis (10%). Proteins were
electrophoretically transferred to a polyvinylidene difluoride
membrane, and nonspecific sites were blocked in 7.5% nonfat dry milk
in Tris-buffered saline (135 mM NaCl, 2.5 mM KCl, 50 mM Tris, and 0.1%
Tween 20, pH 7.4). Membranes were then incubated in the presence of a
polyclonal antibody to the N terminus of GlyR (rabbit anti-glycine
receptor antibody; Chemicon International, Temecula, CA; Wick et al.,
1999
) in Tris-buffered saline containing 2.5% nonfat milk. We used a
horseradish peroxidase-tagged goat antibody to rabbit IgG (ICN
Pharmaceuticals, Costa Mesa, CA) and visualized using chemiluminescence
(Pierce Chemical, Rockford, IL). Densitometric analysis was performed
on spinal cord and brainstem samples and calibrated to coblotted
dilutional standards of control spinal cord and brainstem. Blots were
then stripped for 20 min at 80°C (8 M urea, 100 mM 2-mercaptoethanol,
and 62.5 mM Tris, pH 6.8) and reprobed with an antibody to
-tubulin
(Sigma Chemical).
Chemically Induced Seizures. Mice were given an injection of saline or ethanol (0-2 g/kg) and then a subcutaneous injection of either strychnine (0.9 mg/kg) or pentylenetetrazol (50 mg/kg). The mice were observed continuously for 20 min for the appearance of tonic-clonic seizures. Data were compared using logistic regression, and ED50 values were determined using standard maximum likelihood methods.
Statistics. Statistical differences between groups were determined using a two-tailed Student's t test, one-way analysis of variance, or two-way analysis of variance where indicated using the PRISM program (GraphPad Software). Logistic regression was performed using SPSS for Windows (version 10; SPSS, Chicago, IL).
| |
Results |
|---|
|
|
|---|
Our strategy required a transgene whose glycine sensitivity would
be indistinguishable from wild-type GlyR but whose function would be
unaffected or inhibited (rather than potentiated) by ethanol.
Site-directed mutagenesis and oocyte expression were used to
investigate point mutations in the GlyR that could change ethanol
action without altering the glycine dose-response relationship. Xenopus oocytes were injected with the cDNA for wild-type or
mutant GlyR
1 subunits, and glycine-activated
currents were measured in the presence and absence of ethanol. After
examination of a number of mutants, S267Q was chosen for the transgene.
This was based on statistically indistinguishable
concentration-response relationships to glycine for GlyR
1 and
1(S267Q)
receptors (Fig. 1A). Hill values were
2.1 ± 0.2 and 1.7 ± 0.1 and EC50
values were 235 ± 24 and 214 ± 10 µM for GlyR
1 and
1(S267Q)
receptors, respectively. Unlike the potentiation of receptor function
that ethanol produced in the presence of glycine in the wild-type
1 GlyR (Mascia et al., 1996a
,b
; Yamakura and
Harris, 2000
), ethanol inhibited EC5 glycine
responses in the mutant GlyR
1(S267Q) (Fig. 1B). Syn transgene expression of this mutant GlyR was used, and four
lines of transgenic mice (tg1-tg4) were produced using a Syn GlyR
1(S267Q) construct (Fig.
2). Unless otherwise stated, all
experiments were performed on tg3 mice. All families of transgenic mice
were normal in appearance (e.g., weight, coat quality, whiskers).
|
|
[3H]Strychnine binding and immunoblot analysis
were used to verify expression of the transgene. Transgene expression
was observed in cortex, midbrain, and cerebellum of tg3 mice by using
immunoblot analysis with a polyclonal anti-glycine receptor
1 antibody (Fig. 3, inset). Other immunoblot experiments
did not show a significant change in GlyR levels in the spinal cord and
brainstem (data not shown); however, transgene expression was observed
in (spdot
/spdot
) mice
that possessed the transgene (Fig.
4). It is possible to observe the
transgene protein on this genetic background because these mice lack
GlyR
1. Due to this genetic defect the
(spdot
/spdot
) mice die
at about 3 weeks of age. Unfortunately, the transgene was not able to
"rescue" the mice and homozygous null spdot
mice with the transgene died about 3 weeks after birth.
|
|
Transgene expression was also demonstrated in tg3 mice by using [3H]strychnine binding. For mouse cortical, and combined spinal cord and brainstem tissue from transgenic and wild-type mice, the maximal binding (Bmax) values were increased in the cortex of transgenic mice, confirming transgene expression (Fig. 3). Bmax values were 37 ± 10, 249 ± 26, 599 ± 28, and 536 ± 22 fmol/mg protein for wild-type cortex, transgenic cortex, transgenic spinal cord + brainstem, and wild-type spinal cord + brainstem, respectively (n = 6 animals/group). Using [3H]strychnine binding, approximately equal levels of transgene expression were observed in the cortex of all transgenic families (tg1-tg4) (data not shown). The dissociation constant (KD) values were indistinguishable between transgenic and wild-type GlyR subunits (Fig. 3). KD values were 3.3 ± 1, 3.5 ± 0.6, and 3.5 ± 0.5 nM [3H]strychnine for transgenic cortex, transgenic spinal cord + brainstem, and wild-type spinal cord + brainstem, respectively (n = 6 animals/group).
Because strychnine antagonizes and ethanol potentiates GlyR function,
ethanol inhibition of strychnine seizures was determined for wild-type
and transgenic mice (Fig. 5A). Ethanol
(0.5-2.0 g/kg) inhibited strychnine seizures in wild-type mice and
this protection was decreased by presence of the transgene. No gender or dose × gender interactions were observed. The odds for
transgenic mice to experience seizures at any given dose of ethanol
were 3.15 times greater compared with the wild-type mice
(P = 0.016, logistic regression, n = 16-19/point). Using standard maximum likelihood methods,
ED50 values for ethanol inhibition of
strychnine-induced tonic-clonic seizures were estimated to be 0.53 and
0.64 g/kg for wild-type and transgenic mice. Strychnine (0.9 mg/kg)
produced tonic-clonic seizures in 100% and caused death in 38% of all
mice (n = 21). Ethanol (0.75 g/kg) eliminated both
morbidity (n = 32) and (1.0 g/kg) seizures
(n = 32).
|
To determine whether the transgenic attenuation of the antistrychnine effect of ethanol was nonspecific and shared by other convulsants, ethanol inhibition of tonic-clonic seizures produced by pentylenetetrazol was also evaluated. Pentylenetetrazol (50 mg/kg) caused seizures in 100% of mice (n = 18). Although ethanol inhibited pentylenetetrazol-induced seizures (ED50 = 1.05 g/kg i.p. ethanol for all mice), there were no differences between transgenic and wild-type mice. A dose of 1.25 g/kg ethanol eliminated seizures in 96% of all mice (n = 26) (Fig. 5B).
The ethanol-induced LORR was examined for several doses of ethanol in
male and female mice. Ethanol metabolism did not differ between
transgenic and wild-type mice (Fig. 6),
and male mice showed decreased LORR duration at higher doses of
ethanol, which was confirmed using the different families of transgenic
mice (Fig. 7). Female wild-type and
transgenic mice did not differ in duration of ethanol-induced LORR
(data not shown). To determine whether the reduction in ethanol-induced
LORR by the transgene was nonspecific, we also measured LORR responses
to pentobarbital, ketamine, and flurazepam. The duration of LORR
produced by these drugs was not altered in the transgenic mice (Table
1).
|
|
|
The ethanol ED50 for a LORR greater than 1 min
was used as a measure of acute sensitivity to ethanol. The ethanol
ED50 for this behavior was higher in male
transgenic mice than in wild-type male mice (Fig.
8).
|
We also determined the ethanol ED50 for inability
to remain on a rotarod. For both sexes, transgenic mice required
approximately 0.2 g/kg more alcohol than wild-type mice to produce
incoordination on the rotarod (Fig. 9).
The ED50 of pentobarbital required to produce
ataxia on the rotarod did not differ between transgenic and wild-type
mice (Fig. 9).
|
Ethanol-induced hypothermia was tested with several ethanol doses
(3.0-3.8 g/kg, n = 8/group/point). Transgenic and
wild-type mice did not differ in the hypothermic response (Fig.
10). Acute functional tolerance to
ethanol was also tested for the mice. No differences were observed in
the development of acute functional tolerance between the mice (Table
1).
|
Other basal behaviors were unchanged by presence of the transgene.
Wild-type and transgenic mice did not differ in spontaneous locomotion:
both groups of mice adapted to the novel test chamber environment at
equal rates, and subsequent locomotor activity did not differ (Fig.
11). Transgenic and wild-type mice also
did not differ in responses to the elevated plus-maze anxiety test (Fig. 12).
|
|
| |
Discussion |
|---|
|
|
|---|
Many in vitro studies have shown that GlyR function is positively
modulated by anesthetics and alcohols (Celentano et al., 1988
; Engblom
and Akerman, 1991
; Aguayo and Pancetti, 1994
; Mascia et al., 1996a
,b
;
Eggers et al., 2000
; Yamakura and Harris, 2000
; Ye et al., 2001
). These
observations have led to molecular studies of ethanol actions on GlyR.
For example, mutation of a single amino acid, Ser-267, in transmembrane
domain 2 of the GlyR
1 subunit to isoleucine
eliminated all enhancing effects of ethanol on the receptor (Mihic et
al., 1997
), and the size of the amino acid at position 267 altered the
efficacy of n-alcohols (Wick et al., 1998
; Ye et al., 1998
).
Furthermore, mutation of Ser-267 to cysteine allowed propanethiol, an
unconventional anesthetic, to irreversibly increase function of the
receptor by binding at this site and preventing subsequent potentiation
of the receptor by octanol (Mascia et al., 2000
). These data provide
strong support for the hypothesis that alcohols potentiate GlyR
function by binding in a cavity involving Ser-267.
Several behavioral tests have also implicated GlyR as an important
target for ethanol action. Glycine and the glycine precursor serine are
able to enhance the depressant effects of ethanol as measured by the
duration of LORR, and this action was blocked by strychnine (Williams
et al., 1995
). Ethanol also inhibits strychnine seizures in mice
(McSwigan et al., 1984
). To combine the molecular and behavioral
approaches and to provide a more direct test of the role of GlyR in
alcohol action, we used transgenic expression of a mutant subunit.
The GlyR
1(S267Q) mutant subunit was chosen as
the transgene because this mutation eliminates the potentiation of
receptor function at low concentrations of ethanol and inhibits
receptor function at higher concentrations of ethanol without altering the glycine dose-response relationship. The FVB/NJ inbred mouse line
was chosen because it allows a homogenous genetic background between
wild-type and transgenic mice and thus avoids problems noted previously
for mixed backgrounds (Gerlai, 1996
; Crawley, 2000
). The Syn promoter
was chosen because it should provide expression in all neurons and
reaches a maximal expression level on about postnatal day 20, which
should prevent complications that can occur with transgene expression
during embryogenesis and development (Hoesche et al., 1993
). Thus, to
address the hypothesis that GlyR potentiation is responsible for some
of the acutely intoxicating effects of ethanol we produced a novel
transgenic mouse by using the GlyR
1(S267Q)
subunit, which was expressed using the Syn promoter on an inbred
(FVB/NJ) mouse background.
Using [3H]strychnine binding, we documented
transgene expression. Because GlyR
subunit levels are normally very
low in the cortex, which results in little or no detectable binding,
increases in binding in the cortex represent transgene expression.
Immunoblots confirmed increases in GlyR in the transgenic mice in the
cortex, midbrain, and cerebellum. Although no clear increase in spinal cord and brainstem GlyR levels was seen, it is not unreasonable to
propose that down-regulation of the endogenous gene occurred to
compensate for transgene expression. This is supported by our analysis
of transgene expression on a genetic background lacking functional GlyR
1 subunits. In these mice, we have clear
evidence for expression of the transgene in the spinal cord.
No obvious physical differences were observed between the mice, and no
differences were observed between wild-type and transgenic mice by
using the spontaneous motor activity and the elevated plus-maze anxiety
tests. Thus, the impact of overexpression of the transgene in cortex
and other regions appears to be minimal. This is likely due to the lack
of glycinergic innervation in these areas rendering the transgene
receptors functionally silent (Betz et al., 1999
).
Because strychnine antagonizes the GlyR, ethanol should inhibit strychnine seizures if it significantly potentiates GlyR function. In agreement with this hypothesis, ethanol eliminated seizures and all morbidity associated with an injection of a CD100 dose of strychnine. Although ethanol could be inhibiting strychnine seizures through a target (or targets) separate from GlyR, the simplest explanation for the data is that ethanol potentiation of GlyR function is (largely) responsible for eliminating seizures caused by strychnine inhibition of GlyR function. We hypothesized that if our mutant GlyR subunit was being expressed and effectively incorporated into GlyR then ethanol's ability to eliminate strychnine seizures would be reduced. Consistent with this hypothesis, in transgenic mice a clear right-shift of the dose-response relationship for ethanol inhibition of strychnine seizures was observed. Specificity for the GlyR is suggested by the finding that pentylenetetrazol, a GABA receptor antagonist, induced seizures were inhibited by ethanol equally well in transgenic and wild-type mice.
Because the GlyR is important for motor and spinal function (Betz et
al., 1999
), we focused on testing behaviors related to the acute
effects of ethanol on coordination and motor function. Male transgenic
mice slept for a shorter period of time compared with wild-type mice
and this effect was observed in three of four families of mice. It is
unclear why one transgenic family (tg2) did not display a reduced LORR
duration, but the lack of a transgene effect could have been caused by
the transgene insertion site. It is also unclear why the transgene
effect was not observed in female mice. However, sex differences in
ethanol actions on transgenic (Meliska et al., 1995
; Rikke et al.,
2001
) and knockout (Hall et al., 2001
) mice were previously observed,
and it is possible that the influence of GlyR on this behavior is
greater in male mice. Transgenic alteration of LORR duration was
limited to ethanol and was not observed for the GABA receptor
modulators pentobarbital or flurazepam, or the
N-methyl-D-aspartate receptor
inhibitor ketamine; thus, the transgene was not merely responsible for
a pharmacologically nonspecific change in LORR sensitivity. Because changes in hypothermia may change LORR (Alkana et al., 1988
), we tested
ethanol-induced hypothermia. No transgenic effect was observed for
hypothermia. Male transgenic mice also required a higher dose of
ethanol to produce a LORR of greater than 1 min, supporting the idea
that GlyRs are responsible for some of the acute anesthetic effects of ethanol.
Additionally, because all transgenic mice required a higher dose of ethanol to produce incoordination on the rotarod (an effect that was not observed for pentobarbital), this supports the idea that ethanol potentiation of GlyR function is also responsible for some of the incoordinating effects of ethanol. No differences were observed in acute functional tolerance by using the rotarod test, suggesting that GlyR may be more important for initial sensitivity than for tolerance development.
It is generally accepted that ethanol sensitivity is a polygenic trait;
concerning ethanol-induced LORR, for example, seven loci have been
identified (Markel et al., 1997
). Assuming equal participation by these
loci for an LORR duration of 100 min, one would predict a 14-min change
in LORR due to alteration of one loci. We observed a LORR decrease
greater than this in the male mice of three of four transgenic
families. However, it should be noted that our transgene model may
underestimate the importance of GlyR in ethanol actions because of the
residual presence of the endogenous alcohol-sensitive GlyR. To
investigate this possibility will require new types of mutant mice. For
example, construction of knock-in mice with the mutant GlyR subunit
would result in complete replacement of the
1 subunit.
Collectively, our results show a decreased sensitivity to specific acute effects of ethanol in the transgenic mice. This study supports the hypothesis that strychnine-sensitive glycine receptors are an important target for motor incoordinating and anesthetic properties of ethanol action, and provides the first animal model using a receptor point mutation to alter ethanol action.
| |
Acknowledgments |
|---|
We thank Manfred Killiman for the rat synapsin I promoter. We also thank Virginia Bleck and Rose Chang for skillful assistance in genotyping and raising mice.
| |
Footnotes |
|---|
Accepted for publication October 29, 2001.
Received for publication September 6, 2001.
1 Current address: Department of Medicine, Division of Renal Diseases and Hypertension, University of Colorado Health Sciences Center, Denver, CO 80282.
2 Current address: Consiglio Nazionale delle Ricerche, Dip. Di Biologia Sperimentale (Sezione di Neuroscienze), Cittadella Universitaria, SS 554 (Km 4.500), 09042 Monserrato, Cagliari, Italy.
This study was supported by funds from National Institutes of Health (AA06399 and GM47818) and Texas Commission on Alcohol and Drug Addiction.
Address correspondence to: Geoffrey Findlay, Waggoner Center for Alcohol and Addiction Research (A4800), University of Texas at Austin, Austin, TX 78712. E-mail: gfind{at}mail.utexas.edu
| |
Abbreviations |
|---|
GABA,
-aminobutyric acid;
GlyR, glycine
receptor;
LORR, loss of righting reflex;
Syn, rat synapsin I;
BEC, blood ethanol concentration;
spdot
mice, heterozygous
C57BL/6J-Glra1spd-ot mice.
| |
References |
|---|
|
|
|---|
current in cultured mouse neurons.
J Pharmacol Exp Ther
270:
61-69
fluxes in rat brain synaptoneurosomes.
J Neurochem
57:
384-390[CrossRef][Medline].
) cells.
J Neurosci Methods
87:
97-103[CrossRef][Medline].This article has been cited by other articles:
![]() |
B. T. Welsh, B. E. Goldstein, and S. J. Mihic Single-Channel Analysis of Ethanol Enhancement of Glycine Receptor Function J. Pharmacol. Exp. Ther., July 1, 2009; 330(1): 198 - 205. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Roberts, R. Phelan, B. S. Erlichman, R. N. Pillai, L. Ma, G. F. Lopreato, and S. J. Mihic Occupancy of a Single Anesthetic Binding Pocket Is Sufficient to Enhance Glycine Receptor Function J. Biol. Chem., February 10, 2006; 281(6): 3305 - 3311. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Shafer, P. J. Bushnell, V. A. Benignus, and J. J. Woodward Perturbation of Voltage-Sensitive Ca2+ Channel Function by Volatile Organic Solvents J. Pharmacol. Exp. Ther., December 1, 2005; 315(3): 1109 - 1118. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Ron and R. Jurd The "Ups and Downs" of Signaling Cascades in Addiction Sci. Signal., November 8, 2005; 2005(309): re14 - re14. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Newton, C. J. Orr, M. J. Wallace, C. Kim, H.-S. Shin, and R. O. Messing Deletion of N-Type Calcium Channels Alters Ethanol Reward and Reduces Ethanol Consumption in Mice J. Neurosci., November 3, 2004; 24(44): 9862 - 9869. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Lynch Molecular Structure and Function of the Glycine Receptor Chloride Channel Physiol Rev, October 1, 2004; 84(4): 1051 - 1095. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. A. Lobo, M. P. Mascia, J. R. Trudell, and R. A. Harris Channel Gating of the Glycine Receptor Changes Accessibility to Residues Implicated in Receptor Potentiation by Alcohols and Anesthetics J. Biol. Chem., August 6, 2004; 279(32): 33919 - 33927. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Findlay, R. Phelan, M. T. Roberts, G. E. Homanics, S. E. Bergeson, G. F. Lopreato, S. J. Mihic, Y. A. Blednov, and R. A. Harris Glycine Receptor Knock-In Mice and Hyperekplexia-Like Phenotypes: Comparisons with the Null Mutant J. Neurosci., September 3, 2003; 23(22): 8051 - 8059. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||