JPET Assistant Professor of Medicine (Clinician-Educator)

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wenzel-Seifert, K.
Right arrow Articles by Seifert, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wenzel-Seifert, K.
Right arrow Articles by Seifert, R.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CIMETIDINE
*TRITIUM

Vol. 299, Issue 3, 1013-1020, December 2001


Similar Apparent Constitutive Activity of Human Histamine H2-Receptor Fused to Long and Short Splice Variants of Gsalpha

Katharina Wenzel-Seifert, Melissa T. Kelley1 , Armin Buschauer and Roland Seifert

Department of Pharmacology and Toxicology, the University of Kansas, Lawrence, Kansas (K.W.-S., M.T.K., R.S.); and Department of Pharmacy, University of Regensburg, Regensburg, Germany (A.B.)

    Abstract
Top
Abstract
Introduction
Experimental Procedures
Results
Discussion
References

Fusion proteins allow for the analysis of receptor/G protein coupling under defined conditions. The beta 2-adrenoceptor (beta 2AR) fused to the long splice variant of Gsalpha (Gsalpha L) exhibits a higher apparent constitutive activity than the beta 2-adrenoceptor fused to the short splice variant of Gsalpha (Gsalpha S). Experimentally, this results in higher efficacy and potency of partial agonists and in higher efficacy of inverse agonists at the beta 2AR fused to Gsalpha L relative to the beta 2AR fused to Gsalpha S, indicating that the agonist-free beta 2AR and the beta 2AR occupied by partial agonists promote GDP dissociation from Gsalpha L more efficiently than from Gsalpha S. In fact, the GDP affinity of Gsalpha S fused to the beta 2AR is higher than the GDP affinity of Gsalpha L fused to the beta 2AR. We asked the question whether the histamine H2-receptor (H2R) exhibits similar coupling to Gsalpha splice variants as the beta 2AR. To address this question, we studied H2R-Gsalpha fusion proteins expressed in Sf9 cells. In contrast to beta 2AR-Gsalpha fusion proteins, the potencies and efficacies of partial agonists and the efficacies of inverse agonists were similar at the H2R fused to Gsalpha L and Gsalpha S as assessed by guanosine-5'-O-(3-thio)triphosphate binding and/or steady-state GTPase activity. However, the time course analysis of guanosine-5'-O-(3-thio)triphosphate binding indicated that Gsalpha S fused to the H2R possesses a higher GDP-affinity than Gsalpha L fused to the H2R. Our data show that the H2R fused to Gsalpha L and Gsalpha S possesses similar constitutive activity and is insensitive to differences in GDP affinity of Gsalpha splice variants. Thus, GDP affinity of G proteins does not generally determine constitutive activity of receptors.

    Introduction
Top
Abstract
Introduction
Experimental Procedures
Results
Discussion
References

Many intercellular signal molecules exert their biological effects via GPCRs. GPCRs interact with heterotrimeric G proteins that, in turn, regulate the activity of effector systems (Gilman, 1987; Birnbaumer et al., 1990). Upon binding of agonist, GPCRs undergo a conformational change, enabling them to promote the dissociation of GDP from Galpha . Subsequently, the agonist-occupied GPCR forms a ternary complex with the nucleotide-free G protein that exhibits high agonist affinity. The GPCR then catalyzes GTP binding to Galpha , followed by the disruption of the ternary complex and dissociation of the G protein into the beta gamma -complex and Galpha -GTP. Both Galpha -GTP and the beta gamma -complex regulate the activity of effector systems. The GTPase of Galpha deactivates the G protein. The extended ternary complex model assumes that GPCRs isomerize from an inactive (R) state to an active (R*) state and that agonists stabilize the R* state (Lefkowitz et al., 1993; Gether and Kobilka, 1998). R to R* isomerization can also occur independently of agonist and is referred to as constitutive activity. Inverse agonists stabilize the R state and decrease basal G protein activity. In GPCR/Galpha fusion proteins, the C terminus of GPCR is tethered to the N terminus of Galpha . Fusion proteins ensure a defined 1:1 stoichiometry and efficient coupling of the signaling partners and allow for the analysis of GPCR/G protein coupling under exactly defined experimental conditions (Seifert et al., 1999a; Milligan, 2000).

The beta 2AR is a prototypical Gs-coupled GPCR (Gilman, 1987; Birnbaumer et al., 1990). Gsalpha exists as two splice variants, Gsalpha L and Gsalpha S (Graziano et al., 1989; Seifert et al., 1998b). The beta 2AR fused to Gsalpha L exhibits higher apparent constitutive activity than the beta 2AR fused to Gsalpha S (Seifert et al., 1998b; Wenzel-Seifert and Seifert, 2000; Seifert, 2001). Specifically, the efficacies and potencies of partial agonists and the efficacies of inverse agonists are higher at the beta 2AR-Gsalpha L fusion protein than at the beta 2AR-Gsalpha S fusion protein. We explained those differences in apparent constitutive activity by a model in which the agonist-free beta 2AR and the beta 2AR occupied by partial agonists promote GDP dissociation from Gsalpha L more efficiently than from Gsalpha S because Gsalpha L possesses a lower GDP affinity than Gsalpha S (Graziano et al., 1989; Seifert et al., 1998b; Seifert, 2001). However, it is unknown whether this model also applies to Gs-coupled GPCRs other than the beta 2AR.

To answer this question, we studied H2R-Gsalpha fusion proteins. We chose the H2R for several reasons. First, like the beta 2AR, the H2R is a very well studied Gs-coupled GPCR (Hill et al., 1997). Second, the H2R exhibits constitutive activity and inverse agonists for the H2R have been identified (Smit et al., 1996; Alewijnse et al., 1998). Third, several partial agonists for the human H2R have been described, namely, the HIS-related BET (4) (Burde et al., 1989), and several arpromidine-derived guanidines (6, 7, 10, and 11) (Burde et al., 1990) (Fig. 1). Fourth, the overall mobility and arrangement of the coupling partners in H2R-Gsalpha - and beta 2AR-Gsalpha fusion proteins should be similar because the C termini of both GPCRs, serving as a tether between GPCR core and Galpha have a similar length (Gantz et al., 1991; Wenzel-Seifert et al., 1998).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1.   Structures of H2R agonists. Compounds 1 to 4 represent HIS and HIS-related compounds. Compounds 5 to 13 represent guanidines.

In our present study we analyzed the effects of HIS (1), three HIS-related agonists (2-4), and nine guanidines (5-13) (Fig. 1) as well as of the antagonists/inverse agonists CIM (14), RAN (14), ZOL (15), TIO (16) and FAM (17) on H2R-Gsalpha L- and H2R-Gsalpha S fusion proteins expressed in Sf9 insect cells. Here we report that in contrast to beta 2AR-Gsalpha L and beta 2AR-Gsalpha S, H2R-Gsalpha L, and H2R-Gsalpha S exhibit similar apparent constitutive activity.

    Experimental Procedures
Top
Abstract
Introduction
Experimental Procedures
Results
Discussion
References

Materials. The cDNA for the human H2R was kindly provided by Dr. I. Gantz (University of Michigan Medical School and Ann Arbor Veterans Affairs Medical Center, Ann Arbor, MI) (Gantz et al., 1991). IMP was prepared as described (Durant et al., 1978). Guanidines 6-11 were synthesized as described (Buschauer, 1989). Guanidines 12 and 13 were prepared by analogy to the procedures described for guanidines 6-11 (Buschauer, 1989). The anti-FLAG Ig (M1 monoclonal antibody) was from Sigma (St. Louis, MO). The anti-Gsalpha Ig (C-terminal) was from Calbiochem (La Jolla, CA). [gamma -32P]GTP (6000 Ci/mmol), [35S]GTPgamma S (1100 Ci/mmol), and [3H]TIO (90 Ci/mmol) were from PerkinElmer Life Sciences (Boston, MA). All unlabeled nucleotides were from Roche Molecular Biochemicals (Indianapolis, IN). HIS, BET, CIM, RAN, and FAM were from Sigma. Amthamine, TIO, and ZOL were from Tocris Cookson (Ballwin, MO). Dimaprit was from Sigma/RBI (Natick, MA). All restriction enzymes and T4 DNA ligase were from New England Biolabs (Beverly, MA). Cloned Pfu DNA polymerase was from Stratagene (La Jolla, CA).

Construction of FLAG Epitope- and Hexahistidine-Tagged cDNA for H2R-Gsalpha S and H2R-Gsalpha L. A DNA sequence encoding the cleavable signal peptide from influenza hemagglutinin (S) followed by the FLAG epitope (F), which is recognized by the M1 antibody, was placed 5' of the start codon of the H2R to enhance GPCR expression and allow immunological detection. We also added a hexahistidine tag to the C terminus of H2R to allow future purification and to provide additional protection against proteolysis (Seifert et al., 1998a). The GPCR modifications were generated by sequential overlap-extension PCRs. In PCR 1A, the DNA sequence of the N-terminal portion of the H2R was amplified using CMVneo-H2R as template. The sense primer annealed with the first 18 base pairs of the 5' end of the H2R and included the last 18 base pairs of the SF in its 5' extension. The antisense primer encoded the sequence GAGCTGTTGATATCCGGTGCGGAAGTCTCTG to generate a silent mutation yielding a new EcoRV site. In PCR 1B, the DNA sequence of the C-terminal portion of the H2R was amplified using CMVneo-H2R as template. The sense primer encoded the sequence TTCCGCACCGGATATCAACAGCTCTTCTGCTGC to generate the new EcoRV site. The antisense primer encoded the five C-terminal amino acids of the H2R, a hexahistidine tag, the stop codon and an XbaI site. In PCR 2, the products of PCRs 1A and 1B annealed in the region encoding the newly created EcoRV site, and the sense primer of PCR 1A and the antisense primer of PCR 1B were used. In this way, a fragment encoding the signal sequence, the FLAG epitope, H2R cDNA with a new EcoRV site, and a hexahistidine tag followed by an XbaI site was obtained. This fragment was digested with NcoI and XbaI and cloned into pGEM-3Z-SF-human formyl peptide receptor-6His digested with NcoI and XbaI. In PCR 3A, the C-terminal portion of the H2R was amplified using pGEM-3Z-SF-hH2R as template, a sense primer annealing 5' of the newly created EcoRV site and an antisense primer annealing with the hexahistidine tag. In PCRs 3B1 and 3B2, the sequences of Gsalpha L and Gsalpha S were amplified, using pGEM-3Z-SF-beta 2AR-Gsalpha L and pGEM-3Z-SF-beta 2AR-Gsalpha s, respectively, as template, a sense primer annealing with the hexahistidine tag, and an antisense primer annealing with the five C-terminal amino acids of Gsalpha , the stop codon, and an XbaI site. In PCRs 4A and 4B, the products of PCRs 3A and 3B1 and PCRs 3A and 3B2, respectively, annealed in the hexahistidine region, and the sense primer of PCR 3A and the antisense primer of PCR 3B were used. In this way, fragments encoding the C-terminal portion of the H2R, a hexahistidine tag, Gsalpha L and Gsalpha S, respectively, a stop codon, and an XbaI site were created. These fragments were digested with EcoRV and XbaI and cloned into pGEM-3Z-SF-H2R digested with EcoRV and XbaI. In this way, the full-length cDNAs for H2R-Gsalpha L and H2R-Gsalpha S were created. pGEM-3Z-SF-H2R-Gsalpha L and pGEM-3Z-SF-H2R-Gsalpha S were digested with NcoI and XbaI to recover the fusion protein cDNAs and cloned into the baculovirus transfer vector pVL 1392-SF-beta 2AR-Gialpha 2 digested with NcoI and XbaI. PCR-generated DNA sequences were confirmed by restriction enzyme analysis and enzymatic sequencing.

Generation of Recombinant Baculoviruses, Cell Culture, and Membrane Preparation. Recombinant baculoviruses encoding H2R-Gsalpha fusion proteins were generated in Sf9 cells by using the BaculoGOLD transfection kit (Pharmingen, San Diego, CA) according to the manufacturer's instructions. After initial transfection, high-titer virus stocks were generated by two sequential virus amplifications. Sf9 cells were cultured in 250-ml disposable Erlenmeyer flasks at 28°C under rotation at 125 rpm in SF 900 II medium (Invitrogen, Carlsbad, CA) supplemented with 5% (v/v) fetal calf serum (BioWhittaker, Walkersville, MD) and 0.1 mg/ml gentamicin (BioWhittaker). Cells were maintained at a density of 1.0 to 6.0 × 106 cells/ml. For infection, cells were sedimented by centrifugation and suspended in fresh medium. Cells were seeded at 3.0 × 106 cells/ml and infected with 1:100 dilutions of high-titer baculovirus stocks encoding H2R-Gsalpha fusion proteins. Cells were cultured for 48 h before membrane preparation. Sf9 membranes were prepared as described (Seifert et al., 1998a), by using 1 mM EDTA, 0.2 mM phenylmethylsulfonyl fluoride, 10 µg/ml benzamidine, and 10 µg/ml leupeptin as protease inhibitors. Membranes were suspended in binding buffer (12.5 mM MgCl2, 1 mM EDTA, and 75 mM Tris/HCl, pH 7.4) and stored at -80°C until use.

[3H]TIO Binding Assay. Membranes were thawed and sedimented by a 15-min centrifugation at 4°C and 15,000g to remove residual endogenous guanine nucleotides as much as possible. Membranes were resuspended in binding buffer. Each tube (total volume 250 µl) contained 200 to 250 µg of protein. Tubes contained 1 to 20 nM [3H]TIO plus unlabeled TIO to obtain final ligand concentrations of up to 300 nM. Nonspecific binding was determined in the presence of [3H]TIO at various concentrations plus 100 µM unlabeled TIO. Incubations were conducted for 90 min at 25°C and shaking at 250 rpm. Bound [3H]TIO was separated from free [3H]TIO by filtration through GF/C filters, followed by three washes with 2 ml of binding buffer (4°C). Filter-bound radioactivity was determined by liquid scintillation counting. The experimental conditions chosen ensured that not more than 5% of the total amount of [3H]TIO added to binding tubes was bound to filters.

[35S]GTPgamma S Binding Assay. Membranes were thawed, sedimented, and suspended in binding buffer. For time course studies, Sf9 membranes expressing H2R-Gsalpha fusion proteins were suspended in 1500 µl of binding buffer supplemented with 1 nM [35S]GTPgamma S plus 9 nM unlabeled GTPgamma S, 1 µM GDP, and distilled water (basal), HIS (100 µM), or RAN (10 µM). Aliquots of 200 µl containing 15 to 25 µg of protein were withdrawn at different time points. For saturation binding experiments, reaction mixtures (total volume 500 µl) contained Sf9 membranes expressing H2R-Gsalpha fusion proteins (15 µg of protein/tube) in binding buffer supplemented with 0.05% (w/v) bovine serum albumin, 1 µM GDP, and 0.1 to 2 nM [35S]GTPgamma S plus unlabeled GTPgamma S to reach the final ligand concentrations indicated on the abscissa of Fig. 5. Reaction mixtures additionally contained distilled water (basal), HIS (100 µM), or RAN (10 µM). Incubations were conducted for 90 min at 25°C and shaking at 250 rpm. Bound [35S]GTPgamma S was separated from free [35S]GTPgamma S by filtration through GF/C filters, followed by three washes with 2 ml of binding buffer (4°C). Filter-bound radioactivity was determined by liquid scintillation counting. The experimental conditions chosen ensured that no more than 10% of the total amount of [35S]GTPgamma S added was bound to filters.

Steady-State GPase Activity Assay. Membranes were thawed, sedimented, and resuspended in 10 mM Tris/HCl, pH 7.4. Assay tubes contained Sf9 membranes expressing H2R-Gsalpha fusion proteins (10 µg of protein/tube), 1.0 mM MgCl2, 0.1 mM EDTA, 0.1 mM ATP, 100 nM GTP, 1 mM adenylyl imidodiphosphate, 5 mM creatine phosphate, 40 µg of creatine kinase, and 0.2% (w/v) bovine serum albumin in 50 mM Tris/HCl, pH 7.4, and H2R ligands at various concentrations. Reaction mixtures (80 µl) were incubated for 3 min at 25°C before the addition of 20 µl of [gamma -32P]GTP (0.2-0.5 µCi/tube). All stock and work dilutions of [gamma -32P]GTP were prepared in 20 mM Tris/HCl, pH 7.4. Reactions were conducted for 20 min at 25°C. Reactions were terminated by the addition of 900 µl of a suspension consisting of 5% (w/v) activated charcoal and 50 mM NaH2PO4, pH 2.0. Charcoal-quenched reaction mixtures were centrifuged for 15 min at room temperature at 15,000g. The supernatant fluid (700 µl) of reaction mixtures was removed, and 32Pi was determined by liquid scintillation counting. Enzyme activities were corrected for spontaneous degradation of [gamma -32P]GTP. Spontaneous [gamma -32P]GTP degradation was determined in tubes containing all of the above-described components plus a very high concentration of unlabeled GTP (1 mM) that, by competition with [gamma -32P]GTP, prevents [gamma -32P]GTP hydrolysis by enzymatic activities present in Sf9 membranes. Spontaneous [gamma -32P]GTP degradation was <1% of the total amount of radioactivity added. The experimental conditions chosen ensured that not more than 10% of the total amount of [gamma -32P]GTP added was converted to 32Pi.

SDS-PAGE and Immunoblot Analysis. Membrane proteins were separated on SDS polyacrylamide gels containing 10% (w/v) acrylamide. Proteins were then transferred onto Immobilon P transfer membranes (Millipore Corporation, Bedford, MA). Membranes were reacted with M1 antibody or anti-Gsalpha Ig (1:1000 each). Immunoreactive bands were visualized by sheep anti-mouse IgG (M1 antibody) and donkey anti-rabbit IgG (anti-Gsalpha Ig), respectively, coupled to peroxidase, using o-dianisidine and H2O2 as substrates.

Miscellaneous. Protein concentrations were determined using the Bio-Rad DC protein assay kit (Bio-Rad, Hercules, CA). All analyses of experimental data were performed with the Prism III program (GraphPad Software, San Diego, CA).

    Results
Top
Abstract
Introduction
Experimental Procedures
Results
Discussion
References

Immunological Detection of H2R-Gsalpha L and H2R-Gsalpha S in Sf9 Cell Membranes. Nonfused H2R expressed in Sf9 cells migrates as ~33-kDa band in SDS-PAGE (Fukushima et al., 1997). The molecular masses of Gsalpha L and Gsalpha S are ~45 and 52 kDa, respectively (Graziano et al., 1989). Thus, the molecular masses of H2R-Gsalpha S and H2R-Gsalpha L were expected to be ~78 and 85 kDa, respectively. In fact, the anti-FLAG Ig and anti Gsalpha Ig detected proteins of the expected masses in immunoblots (Fig. 2). The double bands represent differently glycosylated forms of the fusion proteins (Liu et al., 2001). It should be noted that neither with anti-FLAG Ig nor with anti-Gsalpha Ig, immunoreactive bands below the fusion proteins were detected, indicating that H2R-Gsalpha L and H2R-Gsalpha S were not proteolytically degraded.


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 2.   Analysis of the expression of H2R-Gsalpha fusion proteins in Sf9 cell membranes. Sf9 membranes (50 µg of protein/lane) expressing H2R-Gsalpha L at 4.9 pmol/mg and H2R-Gsalpha S at 2.5 pmol/mg as assessed by ligand-regulated GTPgamma S binding were separated by SDS-PAGE with a gel that contained 10% (w/v) acrylamide. Fusion proteins were probed with the anti-FLAG Ig (M1 antibody) (A) or anti-Gsalpha Ig (B). Numbers on the left of the immunoblot indicate molecular masses of marker proteins. Shown are the horseradish peroxidase-reacted Immobilon P membranes of representative gels. Similar results were obtained with three other membrane preparations of H2R-Gsalpha L and H2R-Gsalpha S.

[3H]TIO Saturation Binding to H2R-Gsalpha L and H2R-Gsalpha S Expressed in Sf9 Cell Membranes. Native H2R binds [3H]TIO with a Kd of ~17 nM (Gajtkowski et al., 1983). However, the use of [3H]TIO in native organs is severely limited by the fact that nonspecific binding with saturating [3H]TIO concentrations amounts to ~85 to 90% of total [3H]TIO binding. In Sf9 membranes, only ~55 to 65% nonspecific [3H]TIO binding occurred with saturating radioligand concentrations. Therefore, a more precise determination of the kinetics of specific [3H]TIO binding was possible (Fig. 3). H2R-Gsalpha expressed in Sf9 membranes bound [3H]TIO according to monophasic saturation curves: H2R-Gsalpha L with a Kd of 31.8 ± 4.4 nM and a Bmax of 0.52 ± 0.04 pmol/mg (membrane preparation 171; data not shown); H2R-Gsalpha S with a Kd of 32.0 ± 4.6 nM and a Bmax of 0.43 ± 0.02 pmol/mg (membrane preparation 166; Fig. 3). For GTPgamma S binding and GTPase experiments, we used membranes expressing H2R-Gsalpha fusion proteins with Bmax values of [3H]TIO binding between 0.31 and 0.64 pmol/mg.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 3.   [3H]TIO saturation binding in Sf9 membranes expressing H2R-Gsalpha S. Sf9 membranes expressing H2R-Gsalpha S were incubated in the presence of [3H]TIO at the concentrations indicated on the abscissa as described under Experimental Procedures. Nonspecific binding is the [3H]TIO binding not competed for by 100 µM unlabeled TIO. Specific binding is the difference between total [3H]TIO binding and nonspecific [3H]TIO binding for a given [3H]TIO concentration. A, data were analyzed by nonlinear regression and are the means ± S.D. of three experiments performed in duplicate. The Kd value of specific [3H]TIO binding was 32.0 ± 4.6 nM, and the Bmax value was 0.43 ± 0.02 nM. B, specific [3H]TIO binding data were plotted according to Scatchard. The Kd value in the analysis according to Scatchard was 32.7 nM, and the Bmax value was 0.43 ± 0.02 pmol/mg. Similar results were obtained with five different membrane preparations expressing H2R-Gsalpha S or H2R-Gsalpha L.

[35S]GTPgamma S Binding Studies. Unlike GTP, GTPgamma S is not hydrolyzed by G proteins (Gilman, 1987), and G proteins bind GTPgamma S with ~100-fold higher affinity than GTP (Seifert et al., 1999b; Wenzel-Seifert et al., 1999; Wenzel-Seifert and Seifert, 2000). Thus, the kinetics of GPCR-mediated GDP/GTP exchange can be readily studied in the [35S]GTPgamma S binding assay. Figure 4 shows the time course of GTPgamma S binding in membranes expressing H2R-Gsalpha L and H2R-Gsalpha S. In membranes expressing H2R-Gsalpha L, the t1/2 values of GTPgamma S binding under basal conditions and in the presence of HIS and RAN were 16.5 ± 2.1, 6.7 ± 0.5, and 17.1 ± 1.6 min, respectively. The corresponding values for H2R-Gsalpha S were 34.5 ± 6.4, 12.7 ± 1.5, and 36.9 ± 6.8 min, respectively. These data show that at both fusion proteins, HIS decreases t1/2 of GTPgamma S binding, indicative for accelerated GDP/GTPgamma S exchange. RAN, which has been reported to be an inverse agonist at the H2R (Smit et al., 1996; Alewijnse et al., 1998), had only small inhibitory effects on basal GTPgamma S binding, both in membranes expressing H2R-Gsalpha S and H2R-Gsalpha L. Under all conditions studied, the t1/2 values were ~2-fold lower for H2R-Gsalpha L than for H2R-Gsalpha S. These data are consistent with the fact that the intrinsic GDP dissociation rate of Gsalpha L is higher than the GDP dissociation rate of Gsalpha S (Graziano et al., 1989).


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 4.   Time course of [35S]GTPgamma S binding in Sf9 membranes expressing H2R-Gsalpha L and H2R-Gsalpha S. [35S]GTPgamma S binding in Sf9 membranes was determined as described under Experimental Procedures. Reaction mixtures contained membranes expressing H2R-Gsalpha L (A) or H2R-Gsalpha S (B) and distilled water (basal), HIS (100 µM), or RAN (10 µM). Binding reactions were conducted for the periods indicated on the abscissa. Data were best fitted to monophasic saturation curves (F test). Data shown are the means ± S.D. of three experiments performed in triplicate.

The results of GTPgamma S saturation binding studies are shown in Fig. 5. In membranes expressing H2R-Gsalpha L (membrane preparation 171), HIS stimulated GTPgamma S binding with a Kd value of 0.55 ± 0.06 nM and a Bmax value of 4.01 ± 0.12 pmol/mg. The Kd value of RAN-inhibited GTPgamma S binding for H2R-Gsalpha L was 0.31 ± 0.16 nM, and the Bmax was -0.79 ± 0.10 pmol/mg. Thus, the Bmax of ligand-regulated GTPgamma S binding, i.e., the difference between maximum HIS-stimulated GTPgamma S binding and minimal RAN-inhibited GTPgamma S binding, was 4.80 pmol/mg. The contribution of the RAN-inhibited GTPgamma S binding at the ligand-regulated GTPgamma S binding in membranes expressing H2R-Gsalpha L amounted to 16.5%. In membranes expressing H2R-Gsalpha S (membrane preparation 166), HIS stimulated GTPgamma S binding with a Kd value of 0.64 ± 0.08 nM and a Bmax value of 4.79 ± 0.17 pmol/mg. The Kd value of RAN-inhibited GTPgamma S binding for H2R-Gsalpha S was 0.89 ± 0.26 nM, and the Bmax was -0.78 ± 0.07 pmol/mg. Thus, the Bmax of ligand-regulated GTPgamma S binding for H2R-Gsalpha S was 5.57 pmol/mg. The contribution of the RAN-inhibited GTPgamma S binding at the ligand-regulated GTPgamma S binding in membranes expressing H2R-Gsalpha L amounted to 14.2%.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 5.   [35S]GTPgamma S saturation binding in Sf9 membranes expressing H2R-Gsalpha L and H2R-Gsalpha S. [35S]GTPgamma S binding in Sf9 membranes was performed as described under Experimental Procedures. Reaction mixtures contained membranes expressing H2R-Gsalpha L (A) or H2R-Gsalpha S (B) and distilled water (basal), HIS (100 µM), or RAN (10 µM). For each GTPgamma S concentration, the basal GTPgamma S binding was subtracted from GTPgamma S binding observed in the presence of HIS to obtain the HIS-stimulated GTPgamma S binding. In addition, GTPgamma S binding observed in the presence of RAN was subtracted from basal GTPgamma S binding to obtain RAN-inhibited GTPgamma S binding. The dashed lines are extrapolations of basal GTPgamma S binding. Data were best fitted to monophasic saturation curves (F test). Data shown are the means ± S.D. of three experiments performed in triplicate.

Surprisingly, the Bmax values of ligand-regulated GTPgamma S binding in membranes expressing H2R-Gsalpha were ~10-fold higher than the Bmax values of [3H]TIO saturation binding (see above). Under ideal conditions, the ratio of the Bmax of receptor antagonist radioligand binding and ligand-regulated GTPgamma S binding should be close to 1 because one fusion protein molecule can maximally bind one molecule of receptor ligand and one molecule of GTPgamma S. Apparently, most ligand-free H2R-Gsalpha molecules exist in a conformation that does not bind [3H]TIO. Future studies with another antagonist radioligand for the H2R, [125I]aminopotentidine (Hill et al., 1997), will have to determine whether incomplete labeling of H2R molecules with antagonist radioligands is a general property of H2R antagonists or a specific property of [3H]TIO.

Analysis of Effects of H2R Ligands in Steady-State GTPase Assay. We determined the potencies and efficacies of 13 H2R agonists and the efficacies of five potential inverse agonists at H2R-Gsalpha L and H2R-Gsalpha S in the steady-state GTPase assay (Table 1). Using this assay, we previously showed that partial agonists and inverse agonists possess higher efficacies at beta 2AR-Gsalpha L than at beta 2AR-Gsalpha S (Seifert et al., 1998b). Additionally, partial agonists possess higher potencies at beta 2AR-Gsalpha L than at beta 2AR-Gsalpha S. Ligand potencies and efficacies in the GTPase assay are independent of the fusion protein expression level, allowing for the comparison of various membrane preparations with different expression levels (Seifert et al., 1998a, 1999a). Similar observations were made for H2R-Gsalpha fusion proteins (data not shown). The most likely explanation for the expression level independence of agonist efficacies at fusion proteins is the defined receptor/Galpha stoichiometry and the apparent independence of fusion protein function of other factors such as beta gamma -complexes (Seifert et al., 1999a). At beta 2AR-Gsalpha fusion proteins, the efficacies of agonists were referred to the efficacy of the full agonist (-)-isoproterenol (Seifert et al., 1998b). At H2R-Gsalpha fusion proteins, the efficacies of agonists were referred to the efficacy of the full agonist HIS. This approach ensured comparison of beta 2AR-Gsalpha - and H2R-Gsalpha fusion proteins with each other as exactly as possible.


                              
View this table:
[in this window]
[in a new window]
 
TABLE 1
Ligand potencies and efficacies at H2R-Gsalpha L and H2R-Gsalpha S expressed in Sf9 cell membranes

Potencies and efficacies of ligands at H2R-Gsalpha S and H2R-Gsalpha L were determined in the GTPase assay as described under Experimental Procedures. Reaction mixtures contained Sf9 membranes expressing fusion proteins and agonists at concentrations from 1 nM-100 µM as appropriate to generate saturated concentration-response curves. Curves were analyzed by nonlinear regression. To calculate agonist efficacies, the maximum stimulatory effect of HIS was set 1.00, and the stimulatory effects of other agonists were referred to this value. To determine the inverse agonist efficacies, the effects of ligands at a fixed concentration (10 µM each) on basal GTPase activity were assessed and referred to the maximum stimulatory effect of HIS (= 1.00). Basal and maximum HIS-stimulated GTPase activities ranged between ~1 and 2 and ~4 to 8 pmol/mg/min, respectively. Data shown are the means ± S.D. of four to eight experiments performed in duplicate. Efficacies and potencies, respectively, of ligands at H2R-Gsalpha L were compared to the corresponding parameters at H2R-Gsalpha S by using the t test.

The potencies of six of the 13 H2R agonists studied (1-3, 5, 6, and 13) were significantly higher for H2R-Gsalpha L than for H2R-Gsalpha S. For six agonists (4 and 7-11) the potencies were higher at H2R-Gsalpha S than at H2R-Gsalpha L, but the differences did not reach significance. At H2R-Gsalpha L, the efficacies of six agonists (2-7) were significantly higher than at H2R-Gsalpha S. The efficacies of guanidines 8 to 12 were also higher at H2R-Gsalpha L than at H2R-Gsalpha S, but significance was not reached. The efficacy of guanidine D281 (13), which is the weakest partial agonist at the human H2R identified so far, was identical at H2R-Gsalpha L and H2R-Gsalpha S. Compounds 14 to 18 all had inverse agonistic activity at H2R-Gsalpha L and H2R-Gsalpha S, with RAN (15) and FAM (18) being the most efficient compounds. Only for the latter two compounds we observed significantly higher efficacies at H2R-Gsalpha L than at H2R-Gsalpha S.

We correlated the potencies of the 13 agonists studied at H2R-Gsalpha S versus H2R-Gsalpha L and obtained a highly significant linear correlation that closely followed the theoretical function that would have been obtained if the potencies of agonists at both fusion proteins had been identical (Fig. 6A). With respect to agonist efficacies, we obtained a highly significant linear correlation that was only slightly shifted toward H2R-Gsalpha L relative to the theoretical function that would have been obtained if the efficacies of agonists had been identical at both fusion proteins (Fig. 6B).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 6.   Relations between agonist potencies and agonist efficacies at H2R-Gsalpha L and H2R-Gsalpha S. pD2 values were derived from the EC50 values shown in Table 1, and agonist efficacies were directly taken from Table 1. Solid lines represent the actual correlations obtained. Dotted lines represent the 95% confidence intervals of the correlations. The straight dashed lines represent the theoretical functions that would have been obtained if pD2 values and efficacies, respectively, had been identical at the two fusion proteins. The theoretical functions have a slope of 1.00. A, correlation of pD2 values at H2R-Gsalpha S versus H2R-Gsalpha L. Slope, 0.86 ± 0.08 (95% confidence interval, 0.68-1.05); r2 = 0.91; slope significantly different from zero with p = < 0.0001. B, correlation of efficacies at H2R-Gsalpha S versus H2R-Gsalpha L. Slope, 1.18 ± 0.04 (95% confidence interval, 1.09-1.27); r2 = 0.98; slope significantly different from zero with p = < 0.0001.

    Discussion
Top
Abstract
Introduction
Experimental Procedures
Results
Discussion
References

The aim of the present study was to answer the question whether the H2R, like the beta 2AR, exhibits higher apparent constitutive activity when fused to Gsalpha L than when fused to Gsalpha S. The differences in apparent constitutive activity of the beta 2AR fused to Gsalpha L and Gsalpha S are explained by the lower GDP affinity of Gsalpha L relative Gsalpha S, i.e., the agonist-free beta 2AR and the beta 2AR occupied by partial agonists promote GDP dissociation from Gsalpha L more efficiently than from Gsalpha S (Seifert et al., 1998b; Wenzel-Seifert and Seifert, 2000; Seifert, 2001). Experimentally, this results in increased potency and efficacy of partial agonists and increased efficacy of inverse agonists at beta 2AR-Gsalpha L compared with beta 2AR-Gsalpha S. Consistent with the known differences in GDP affinity of Gsalpha L and Gsalpha S (Graziano et al., 1989; Seifert et al., 1998b), basal and HIS-stimulated GDP/GTPgamma S exchange proceeded faster at H2R-Gsalpha L than at H2R-Gsalpha S (Fig. 4).

Although the fusion protein approach certainly has advantages for the question addressed in this study, namely, the defined 1:1 stoichiometry of the coupling partners and the high sensitivity both in the GTPgamma S binding and GTPase assay, one has also to keep in mind certain limitations when extrapolating the results obtained with fusion proteins to nonfused systems. Most importantly, fusion proteins are artificial proteins. Although the fusion does not alter the properties of GPCRs and Galpha fundamentally (Seifert et al., 1999a), it cannot be excluded that there are subtle differences in GPCR/Galpha interaction between fused and nonfused systems that could well have an impact on the coupling of GPCRs to very closely related Galpha subunits. This notion is supported by the fact that differences in the interaction of the beta 2AR with Gsalpha splice variants are readily detected in fusion proteins (Seifert et al., 1998b; Wenzel-Seifert and Seifert, 2000; Seifert, 2001), but not in nonfused systems (Graziano et al., 1989; Jones et al., 1990; O'Donnell et al., 1991). Even more caution than for the comparison of the coupling of a given GPCR to various fused Galpha subunits has to be exerted when comparing the coupling of various GPCRs to a given Galpha . Specifically, the intracellular Gs-coupling domains of the beta 2AR and H2R are quite different from each other (Dohlman et al., 1991; Kobilka, 1992; Wang et al., 2000), and in a constrained system such as fusion proteins, such differences may accentuate differences in GPCR/Galpha coupling compared with nonfused systems. Therefore, it will be necessary to repeat the experiments reported in this study with nonfused proteins. However, studies with nonfused proteins have drawbacks as well. Specifically, it is very difficult to obtain exactly defined GPCR/G-protein stoichiometries in nonfused systems (Jones et al., 1990; Brys et al., 2000; Seifert and Wenzel-Seifert, 2001). Ultimately, it will be necessary to compare the crystal structures of GPCR-Galpha fusion proteins versus GPCR coexpressed with Galpha to assess the validity of the fusion protein approach.

With the above-discussed limitations in mind, we compared beta 2AR-Gsalpha fusion proteins with H2R-Gsalpha fusion proteins. Based on the data obtained with beta 2AR-Gsalpha fusion proteins (Seifert et al., 1998b; Wenzel-Seifert and Seifert, 2000; Seifert, 2001) and the time course of GTPgamma S binding to H2R-Gsalpha fusion proteins (Fig. 4) we expected H2R-Gsalpha L to exhibit a higher constitutive activity than H2R-Gsalpha S. Surprisingly, however, when examining inverse agonists and partial agonists, we failed to uncover consistent differences in apparent constitutive activity between H2R-Gsalpha L and H2R-Gsalpha S. Particularly, in the GTPgamma S binding assay, we did not find higher inverse agonistic efficacies of RAN at H2R-Gsalpha L than at H2R-Gsalpha S, regardless of whether extended time course studies (Fig. 4) or GTPgamma S saturation binding studies (Fig. 5) were conducted. In contrast, inverse agonists show very large inhibitory effects on basal GTPgamma S binding to beta 2AR-Gsalpha L, particularly at late time points of the binding reaction (Wenzel-Seifert and Seifert, 2000). In addition, inverse agonists at the beta 2AR decrease the apparent GTPgamma S affinity of Gsalpha L (Wenzel-Seifert and Seifert, 2000), but no such observation was made for H2R-Gsalpha L (Fig. 5A). For beta 2AR-Gsalpha L and beta 2AR-Gsalpha S, we observed differences in efficacy of inverse agonists both in the GTPgamma S binding assay and the GTPase assay (Seifert et al., 1998b; Wenzel-Seifert and Seifert, 2000), but for H2R-Gsalpha fusion proteins, we observed differences between H2R-Gsalpha L and H2R-Gsalpha S only for RAN and FAM in the GTPase assay (Figs. 4 and 5; Table 1). An explanation for the differences in the effects of RAN in the GTPgamma S binding and GTPase assay could be that not only GDP dissociation but also other steps of the G protein cycle such as the actual GTP hydrolytic step are GPCR ligand-regulated. Specifically, the RAN-occupied H2R may be similarly efficient at inhibiting GDP dissociation from fused Gsalpha S and Gsalpha L, but more efficient at reducing GTP hydrolysis at H2R-Gsalpha L than at H2R-Gsalpha S. Evidence that GPCRs regulate multiple steps of the G protein cycle, including nucleotide hydrolysis was already presented in previous studies (Brandt and Ross, 1986; Hilf et al., 1992; Seifert et al., 1999b, 2001).

When analyzing the effects of agonists in the GTPase assay, we found increased potencies of agonists at H2R-Gsalpha L relative to H2R-Gsalpha S for less than 50% of the compounds studied (Table 1). In contrast, with respect to beta 2AR-Gsalpha fusion proteins, the potencies of all agonists studied were higher at beta 2AR-Gsalpha L than at beta 2AR-Gsalpha S (Seifert et al., 1998b). Moreover, when only considering the agonists for which significant differences between H2R-Gsalpha L and H2R-Gsalpha S were observed, we noticed that for an agonist of a given efficacy, the differences in potency were larger for beta 2AR-Gsalpha fusion proteins than for H2R-Gsalpha fusion proteins. Specifically, the full agonist (-)-isoproterenol is ~2.5-fold more potent at beta 2AR-Gsalpha L than at beta 2AR-Gsalpha S (Seifert et al., 1998b), whereas the full agonist HIS is only ~1.5-fold more potent at H2R-Gsalpha L than at H2R-Gsalpha S (Table 1). Similarly, the strong partial agonist salbutamol is ~2.6-fold more potent at beta 2AR-Gsalpha L than at beta 2AR-Gsalpha S, whereas the strong partial agonist IMP is only ~1.5-fold more potent at H2R-Gsalpha L than at H2R-Gsalpha S (Table 1). The correlation of the potencies of all agonists studied at H2R-Gsalpha S versus H2R-Gsalpha L revealed a linear correlation that was very close to the theoretical function that would have been obtained if the potencies of agonists at the two fusion proteins had been identical (Fig. 6A).

Similar observations as for agonist potencies at H2R-Gsalpha and beta 2AR-Gsalpha were made for agonist efficacies. Specifically, the efficacies of all partial agonists studied in the GTPase assay were significantly higher at beta 2AR-Gsalpha L than at beta 2AR-Gsalpha S, regardless of whether strong or weak partial agonists were considered (Seifert et al., 1998b). The increases in efficacy were particularly large for partial agonists with moderate efficacy, e.g., (-)-ephedrine that has an efficacy of 0.31 at beta 2AR-Gsalpha S and an efficacy of 0.63 at beta 2AR-Gsalpha L. As a result, there is a strong hyperbolic relation between the efficacies of agonists at beta 2AR-Gsalpha S versus beta 2AR-Gsalpha L (Seifert et al., 1998b). In marked contrast, for H2R-Gsalpha fusion proteins, we observed significant increases in efficacy of ligands at H2R-Gsalpha L versus H2R-Gsalpha S for less than 50% of the agonists studied, and even those differences were small (Table 1). The most important finding with respect to efficacies was that guanidine D281 (13), which is in a similar efficacy range as (-)-ephedrine at the beta 2AR, exhibited identical efficacy at H2R-Gsalpha L and H2R-Gsalpha S. As the result of the small and inconsistent increases in efficacies of agonists at H2R-Gsalpha L relative to H2R-Gsalpha S, we obtained a highly significant linear correlation of the efficacies of agonists at the two fusion proteins that was only slightly shifted toward higher efficacies at H2R-Gsalpha L (Fig. 6B). This linear correlation is in marked contrast to the hyperbolic relation of agonist efficacies observed for beta 2AR-Gsalpha fusion proteins (Seifert et al., 1998b). Taken together, all these data show that the H2R fused to Gsalpha L and Gsalpha S has similar apparent constitutive activity.

Our present study shows that caution must be exerted when considering the beta 2AR as a prototypical GPCR with respect to the mechanisms regulating constitutive activity. Based on the data obtained with the beta 2AR, one would have expected that a related biogenic amine GPCR, the H2R, shows similar coupling to Gs proteins as the beta 2AR. However, the apparent constitutive activity of the beta 2AR is sensitive to differences in GDP affinity of Gsalpha splice variants, whereas the apparent constitutive activity of the H2R is insensitive to differences in GDP affinity. Thus, the GDP affinity of G proteins does not generally determine the apparent constitutive activity of GPCRs. Accordingly, intrinsic GPCR properties dominate the apparent constitutive activity of the H2R but not the apparent constitutive activity of the beta 2AR. Insensitivity of apparent constitutive activity of GPCRs to the GDP-affinity of Galpha is not without precedence. Particularly, the various Gialpha isoforms differ from each other in GDP-affinity as well, but the apparent constitutive activity of the formyl peptide receptor coupled to the various Gialpha isoforms is very similar (Wenzel-Seifert et al., 1999). If the differential impact of the GDP affinity of Gsalpha splice variants on the apparent constitutive activity of various GPCRs observed in fusion proteins can also be observed in coexpression systems, such data would point to GPCR-specific roles of Gsalpha splice variants in signal transduction in vivo.

The molecular basis for the GPCR-specific interaction with Gsalpha L splice variants is presumably due to differences in the second and third intracellular loops of the H2R and beta 2AR. These loops are crucial for Gs protein coupling (Dohlman et al., 1991; Kobilka, 1992) and are different in the H2R and beta 2AR (Wang et al., 2000). Further support for this hypothesis comes from the fact that chimeras of the beta 2AR in which the second and intracellular loops were replaced by the corresponding loops of the H2R differ considerably from the wild-type beta 2AR in their efficacies at activating adenylyl cyclase (Wang et al., 2000). Overall, coupling of different GPCRs to Gsalpha splice variants appears to be much more complex than was previously appreciated.

    Acknowledgments

We thank Dr. I. Gantz (University of Michigan Medical School and Ann Arbor Veterans Affairs Medical Center, Ann Arbor, MI) for providing the cDNA of the human H2R, Dr. H.-Y. Liu for help with the immunoblots, and Dr. F. Schalkhausser (Department of Pharmacy, University of Regensburg, Germany) for the synthesis of guanidine 13. We also acknowledge the helpful critique of the reviewers of this article.

    Footnotes

Accepted for publication September 11, 2001.

Received for publication May 30, 2001.

1 Current address: Quintiles Inc., Kansas City, MO 64134.

This work was supported by a New Faculty Award of The University of Kansas (R.S.), the National Institutes of Health COBRE award 1 P20 RR15563-01, and matching support from The State of Kansas and The University of Kansas (R.S.), grants of the Fonds der Chemischen Industrie (A.B.), and the Deutscher Akademischer Austauschdienst within the international network "Medicinal Chemistry" (214/IQN-röd) (A.B.).

Address correspondence to: Dr. Roland Seifert, Department of Pharmacology and Toxicology, The University of Kansas, 5064 Malott Hall, Lawrence, KS 66045. E-mail: rseifert{at}ukans.edu

    Abbreviations

GPCR, G protein-coupled receptor; Galpha , nonspecified G-protein alpha -subunit; Gs proteins, family of G proteins that mediates adenylyl cyclase activation; beta 2AR, beta 2-adrenoceptor; Gsalpha , nonspecified Gsalpha protein; Gsalpha L, long splice variant of Gsalpha ; Gsalpha S, short splice variant of Gsalpha ; beta 2AR-Gsalpha L, fusion protein containing the beta 2AR and the long splice variant of Gsalpha ; beta 2AR-Gsalpha S, fusion protein containing the beta 2AR and the short splice variant of Gsalpha ; H2R, histamine H2-receptor; HIS, histamine; BET, betahistine; CIM, cimetidine; RAN, ranitidine; ZOL, zolantidine; TIO, tiotidine; FAM, famotidine; H2R-Gsalpha S, fusion protein containing the H2R and the short splice variant of Gsalpha ; H2R-Gsalpha L, fusion protein containing the H2R and the long splice variant of Gsalpha ; IMP, impromidine; GTPgamma S, guanosine-5'-O-(3-thio)triphosphate; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis.

    References
Top
Abstract
Introduction
Experimental Procedures
Results
Discussion
References


0022-3565/01/2993-1013-1020$03.00
THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS
Copyright © 2001 by The American Society for Pharmacology and Experimental Therapeutics



This article has been cited by other articles:


Home page
J. Pharmacol. Exp. Ther.Home page
A. I. Kaya, O. Ugur, S. S. Oner, M. Bastepe, and H. O. Onaran
Coupling of {beta}2-Adrenoceptors to XL{alpha}s and G{alpha}s: A New Insight into Ligand-Induced G Protein Activation
J. Pharmacol. Exp. Ther., April 1, 2009; 329(1): 350 - 359.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
N. Weitl and R. Seifert
Distinct Interactions of Human {beta}1- and {beta}2-Adrenoceptors with Isoproterenol, Epinephrine, Norepinephrine, and Dopamine
J. Pharmacol. Exp. Ther., December 1, 2008; 327(3): 760 - 769.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
S.-X. Xie, A. Kraus, P. Ghorai, Q.-Z. Ye, S. Elz, A. Buschauer, and R. Seifert
N1-(3-Cyclohexylbutanoyl)-N2-[3-(1H-imidazol-4-yl)propyl]guanidine (UR-AK57), a Potent Partial Agonist for the Human Histamine H1- and H2-Receptors
J. Pharmacol. Exp. Ther., June 1, 2006; 317(3): 1262 - 1268.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
S.-X. Xie, P. Ghorai, Q.-Z. Ye, A. Buschauer, and R. Seifert
Probing Ligand-Specific Histamine H1- and H2-Receptor Conformations with NG-Acylated Imidazolylpropylguanidines
J. Pharmacol. Exp. Ther., April 1, 2006; 317(1): 139 - 146.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wenzel-Seifert, K.
Right arrow Articles by Seifert, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wenzel-Seifert, K.
Right arrow Articles by Seifert, R.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CIMETIDINE
*TRITIUM


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition