![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 298, Issue 3, 934-940, September 2001
The Prostate Centre at Vancouver General Hospital, Vancouver, British Columbia, Canada (T.Z., H.M., K.C., M.E.G.); and ISIS Pharmaceuticals, Carlsbad, California (S.C., B.S.C., B.P.M.)
 |
Abstract |
|---|
 Top
 Abstract
 Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Phosphorothioate (P=S) antisense oligonucleotides (ASO) targeting the cell survival gene clusterin synergistically enhance castration- and chemotherapy-induced apoptosis in prostate cancer xenografts. This study compares efficacy, tissue half-lives, and toxicity of P=S clusterin ASO to third-generation backbone 2'-O-(2-methoxy)ethyl (2'MOE) ribose-modified clusterin ASO. Northern analysis quantified changes in clusterin mRNA levels in human PC-3 cells and tumors. The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay measured effects of combined clusterin ASO plus paclitaxel on PC-3 cell growth. Athymic mice bearing PC-3 tumors were treated with paclitaxel plus either P=S clusterin ASO, 2'-MOE clusterin ASO, or mismatch control oligonucleotides for 28 days. Weekly body weights and serum parameters were measured to assess toxicity. Tissue half-life of P=S and 2'-MOE ASO in PC-3 tumors was assessed using capillary gel electrophoresis (CGE). Both 2'-MOE and P=S ASO decreased clusterin mRNA levels in a dose-dependent and sequence-specific manner. 2'-MOE ASO more potently suppressed clusterin mRNA (80 versus 40% at 500 nM) compared with P=S ASO. IC50 of paclitaxel was equally reduced (50-75%) by both compounds. In vivo tissue half-life was significantly longer for 2'-MOE-modified ASO than for P=S ASO (5 versus 0.5 days). Using CGE, >90% of detected 2'-MOE ASO in tumor tissue was full length. Weekly administration of 2'-MOE clusterin ASO was equivalent to daily P=S clusterin ASO in enhancing paclitaxel efficacy in vivo. 2'-MOE-modified ASO potently suppressed clusterin expression and prolonged tissue half-lives with no additional side effects. These results support the use of 2'-MOE-modified ASO over conventional P=S ASO by potentially increasing potency and allowing longer dosing intervals in clinical trials.
| |
Introduction |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Clusterin,
also known as testosterone-repressed prostate message-2 or
sulfated glycoprotein-2 (TRPM-2), was first isolated from ram rete
testes fluid (Montpetit et al., 1986
) and has been implicated in a wide
variety of physiological and pathological processes, including tissue
remodeling, reproduction, lipid transport, membrane protection,
complement defense, and apoptotic cell death (Sensibar et al., 1995).
Since clusterin expression is increased in various benign and malignant
tissues undergoing apoptosis, it has been associated with cell death
(May et al., 1990; Connor et al., 1991; Kyprianou et al., 1991). Recent
observations suggest that clusterin acts in a chaperone-like manner
similar to that of small heat shock proteins, potently inhibiting
stress-induced protein precipitation in vitro and appears to improve
cell survival in vivo (Humphreys et al., 1999). In prostate cancer,
experimental and clinical studies suggest that clusterin increases
after therapeutic cell death signals, such as androgen ablation or
chemotherapy, and functions to protect cells against apoptotic cell
death (Miyake et al., 2000c, 2001). When overexpressed, clusterin
confers a hormone- and chemoresistant phenotype, marking it as a target for therapy (Miyake et al., 2000c, 2001).
More than 20 years ago, Zamecnik and Stephenson (1978) first
proposed using synthetic antisense oligonucleotide (ASO) analogs as a
new class of rationally designed therapeutics capable of specifically
inhibiting the synthesis of a chosen target protein. Since then,
intense efforts have been mounted to improve ASO activity. Two
important factors influencing efficacy of an ASO are the affinity for
targeted mRNA to bind with a high degree of specificity and its ability
to resist degradation by intracellular nucleases. First-generation phosphodiester (P=O) ASO is highly unstable to nucleases, largely precluding their use to efficiently inhibit the
expression of a targeted mRNA. In a first step to increase nuclease
resistance, an equatorial oxygen atom in the phosphate backbone of P=O
ASO was replaced by a sulfur atom. This phosphorothioate (P=S)
modification provided considerable stability to both exo- and
endonucleases (Wagner, 1994). However, each incorporation of a P=S
generates a chiral center and reduces binding affinity for target mRNA.
Furthermore, although P=S ASOs are less sensitive to nucleases, they
will degrade in cells over time (McKay et al., 1996). To overcome these
drawbacks, ongoing research has focused on backbone modifications that
provide a more attractive pharmacological profile than P=S ASO. Among a
number of different modifications at the 2'-sugar position, the
2'-O-(2-methoxy)ethyl (2'-MOE) incorporation was identified
as enhancing both binding affinity and further resisting degradation by
intracellular nucleases (Altmann et al., 1996). The 2'-MOE modification
resulted in decreased binding affinity to RNase H, the principal
nuclease that cleaves ASO-bound mRNA. This problem was overcome by the
use of "gapped" ASO such that the 5' and 3' ends of the molecule
contained 2'-MOE-modified sugar residues and the central portion of the
ASO contained 2'-deoxy sugar residues that support RNase H activity
(Monia et al., 1993; Baker et al., 1997). This chemical design is
usually accompanied with a uniformly modified P=S backbone. The
incorporation of 2'-MOE modifications into 20-mer P=S ASO showed a
dramatic effect on the ability of the sequence to hybridize to a target
mRNA as a result of the conformation of the sugar and the backbone.
Furthermore, 2'-MOE incorporation into P=S ASO exhibited substantially
increased resistance to intracellular nucleases, compared with
conventional P=S ASO. Both increased hybridizing affinity toward the
targeted mRNA and enhanced resistance toward both serum and
intracellular nucleases resulted in a 20-fold increase in activity of
2'-MOE-modified ASO (McKay et al., 1999). The enhanced potency of this
new class of ASO did not lead to any decrease in specificity.
We recently reported that inhibition of clusterin mRNA expression using
conventional P=S ASO enhances chemotherapy-mediated apoptosis in
prostate cancer (Miyake et al., 2000a). In this study, we compared the
in vitro and in vivo efficacy, tissue half-lives, and toxicity of a
conventional P=S and a 2'-MOE-modified ASO targeted against clusterin
mRNA. All in vitro and in vivo experiments were conducted using the
human prostate cancer cell line PC-3.
| |
Materials and Methods |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Tumor Cell Line. PC-3, derived from hormone-refractory human prostate cancer, was purchased from the American Type Culture Collection (Rockville, MD). Cells were maintained in Dulbecco's modified Eagle's medium (Life Technologies, Gaithersburg, MD), supplemented with 5% heat-inactivated fetal calf serum and routinely passaged when 90% confluent.
Antisense Clusterin Oligonucleotides (Clusterin ASO).
P=S and 2'-MOE-modified ASO used in this study were synthesized as
described previously (Monia et al., 1993; Dean et al., 1994). The
sequence of the clusterin ASO used corresponded to the human clusterin
translation initiation site (5'-CAGCAGCAGAGTCTTCATCAT-3'). A two-base
clusterin mismatch oligonucleotide
(5'-CAGCAGCAGAGTATTTATCAT-3') was used as a
control. Conventional P=S clusterin ASO was previously demonstrated to
significantly inhibit clusterin mRNA expression in a dose-dependent and
sequence- specific manner (Miyake et al., 2000a). The sequence of the
P=S and 2'-MOE antisense analogs, and their controls, were identical.
The design of the 2'-MOE analogs was
CAGCAGCAGAGTCTTCATCAT in which the underline
bases represent 2'-MOE residues.
Treatment of Cells with ASO. Lipofectin, a cationic lipid (Life Technologies) was used to increase the ASO uptake of cells. PC-3 cells were treated with various concentrations of ASO after they have been preincubated for 20 min with 10 µg/ml lipofectin in serum free OPTI-MEM (Life Technologies). Four hours after the beginning of the incubation, the medium containing ASO and lipofectin was replaced with standard culture medium described above.
Northern Blot Analysis.
Total RNA was isolated from cultured
PC-3 cells and PC-3 tumor tissues using the acid-guanidinium
thiocyanate-phenol-chloroform method. Electrophoresis, hybridization,
and washing conditions were carried out as previously reported (Miyake
et al., 1998). Human clusterin and GAPDH cDNA probes were generated by
reverse transcription-polymerase chain reaction from total RNA of human kidney using primers 5'-AAGGAAATTCAAAATGCTGTCAA-3' (sense) and 5'-ACAGACAAGATCTCCCGGCACTT-3' (antisense) for clusterin, and
5'-TGCTTT-TAACTCTGGTAAAGT-3' (sense) and 5'-ATATTTGGCAGGTTTTTCTGA-3'
(antisense) for GAPDH. Density of bands for clusterin was normalized
against that of GAPDH by densitometric analysis.
Capillary Gel Electrophoresis (CGE).
CGE (PACE 5000 System;
Beckman, Fullerton, CA) was used to determine the fraction of
full-length ASO in PC-3 tumors and confirmed by 20% denaturing
polyacrylamide gel electrophoresis and laser scanning densitometry
(Molecular Dynamics, Sunnyvale, CA). For CGE, a 100-µl solution of
ASO, at a concentration of ~0.1 AU260, was used
for electrokinetic injection at 
5 kV into a 45-cm polyacrylamide filled capillary column using a 100 mM Tris-borate (pH 8.0) running buffer. Separation was performed at 10 kV over 30 min with peak detection measured via UV absorption at 260 nM.
MTT Assay.
The in vitro growth inhibitory effects of
conventional P=S plus paclitaxel or docetaxel versus 2'-MOE-modified
clusterin ASO plus paclitaxel or docetaxel on PC-3 cells were compared
using the MTT assay as previously described (Miyake et al., 1998).
Briefly, 1 × 104 cells were seeded in each
well of 96-well microtiter plates and allowed to attach overnight.
Cells were then treated once daily with 500 nM either clusterin ASO or
mismatch control oligonucleotides for 2 days. Following ASO treatment,
cells were treated with various concentrations of paclitaxel or
docetaxel. After 48 h of incubation, 20 µl of 5 mg/ml MTT (Sigma
Chemical Co., St. Louis, MO) in phosphate-buffered saline was added to
each well, followed by incubation for 4 h at 37°C. The formazan
crystals were dissolved in dimethyl sulfoxide. The optical density was
determined with a microculture plate reader (Becton Dickinson Labware,
Lincoln Park, NJ) at 540 nm. Absorbance values were normalized to the
values obtained for the vehicle-treated cells to determine the
percentage of survival. Each assay was performed in triplicate.
In Vivo Treatments. Approximately 1 × 106 human PC-3 cells were inoculated s.c. with 0.1 ml of Matrigel (Becton Dickinson Labware, Bedford, MA) on the flank of 6- to 8-week-old male athymic mice under halothane anesthesia (5% induction and 1.5% maintenance concentration). When PC-3 tumors grew to 10 mm in diameter, usually 4 to 6 weeks after injection, treatment of animals was started.
In a first experiment, mice were randomized to one of three arms for treatment with conventional P=S clusterin ASO plus paclitaxel, 2'-MOE-modified clusterin ASO plus paclitaxel, or P=S mismatch control oligonucleotides plus paclitaxel. Each experimental group consisted of 10 mice. After randomization, 12.5 mg/kg of either type of clusterin ASO or mismatch control oligonucleotides was injected i.p. once daily into each mouse for 28 days. From days 10 to 14, and from days 24 to 28, 0.5 mg of polymeric micellar paclitaxel (Leung et al., 2000) was
administered once daily by i.v. injection. Tumor volume was measured
once weekly and calculated by the formula length × width × depth × 0.5236. Data points were reported as mean tumor
volumes ± S.D. In each of the three treatment arms, three mice
were designated immediately after randomization to be harvested 1 week
after the last oligonucleotide/paclitaxel treatment (day 35) to
determine multiple serum parameters for comparison of in vivo ASO toxicity.
In a second set of experiments, mice were randomized to one of
four arms for treatment with P=S clusterin ASO once daily, P=S
clusterin ASO once weekly, 2'-MOE-modified clusterin ASO once weekly,
or P=S mismatch control oligonucleotides once weekly. Each experimental
group consisted of eight mice. After randomization, 12.5 mg/kg
clusterin ASO or mismatch control oligonucleotides was injected i.p.
once daily or once weekly into each mouse over 4 weeks. Animals in all
four treatment arms additionally received polymeric micellar paclitaxel
as described above. Tumor volume was measured and data points were
reported as described above.
In a third in vivo experiment, mice were randomized to one of two arms
for treatment with either P=S clusterin ASO or 2'-MOE-modified clusterin ASO. Each experimental group consisted of 12 mice. Clusterin ASO (12.5 mg/kg) was injected i.p. once daily into each mouse for 5 days. PC-3 tumors were harvested 1, 3, 5, and 7 days after the last
ASO-injection for Northern blot and CGE analysis of clusterin. All
animal procedures were performed according to the guidelines of the
Canadian Council on Animal Care and with appropriate institutional certification.
| |
Results |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Enhanced Inhibition of Clusterin mRNA Using 2'-MOE-Modified
ASO in PC-3 Cells.
Northern blot analysis was used to compare the
effects of treatment with conventional P=S and 2'-MOE-modified ASO on
clusterin mRNA expression in PC-3 cells. As shown in Fig.
1, both P=S and 2'-MOE-modified ASO
decreased clusterin mRNA levels in a dose-dependent and
sequence-specific manner. Using an ASO concentration of 500 nM,
2'-MOE-modified ASO was more potent than conventional P=S ASO,
decreasing clusterin mRNA levels in PC-3 cells by 80 versus 40%.
|
Conventional P=S and 2'-MOE-Modified Clusterin ASO Equally Enhance
Chemosensitivity of PC-3 Cells in Vitro.
To compare the efficacy
of conventional P=S and 2'-MOE-modified clusterin ASO to enhance
cytotoxicity in vitro, PC-3 cells were treated with either type of
clusterin ASO once daily for 2 days and then incubated with medium
containing various concentrations of either paclitaxel or docetaxel.
After 48 h of incubation, cell viability was determined by the MTT
assay. As shown in Fig. 2, A and B, both
types of clusterin ASO equally enhanced chemosensitivity of paclitaxel
and docetaxel by more than 70 and 50%, respectively.
|
Enhanced Tissue Half-Life of ASO by 2'-MOE Modification.
CGE was used to analyze time-dependent ASO metabolism in PC-3 tumors.
As shown in Fig. 3A, in vivo tissue
half-life of ASO was increased by more than 5-fold with the 2'-MOE
modification, compared with conventional P=S ASO (>5 versus <1 day).
Ninety percent of 2'-MOE-modified ASO was detectable as full-length
material at 1 week, whereas only 10% of P=S ASO was found as
full-length material at 1 day (Fig. 3B) following cessation of dosing.
Five and 7 days following the last ASO treatment, no full-length P=S ASO was detectable in tumor tissue. Furthermore, in vivo clusterin mRNA
expression was more efficiently inhibited over this time period using
2'-MOE-modified ASO compared with P=S Clusterin ASO (Fig. 3C).
|
2'-MOE-Modified Clusterin ASO Enhances the Potency of
Paclitaxel in Vivo.
To compare the efficacy of conventional P=S
versus 2'-MOE-modified clusterin ASO to enhance the cytotoxicity of
paclitaxel in vivo, athymic mice bearing PC-3 tumors were treated with
either type of clusterin ASO or mismatch control oligonucleotide over 28 days. From days 10 to 14, and from days 24 to 28, 0.5 mg of polymeric micellar paclitaxel was administered once daily by i.v. injection. As shown in Fig. 4, both types
of clusterin ASO enhanced paclitaxel chemosensitivity in PC-3 tumors by
7 weeks following initiation of treatment. Treatment with
2'-MOE-modified clusterin ASO was significantly more potent in reducing
mean tumor volume (over 80%) than conventional P=S clusterin ASO
(40%), compared with treatment with mismatch control oligonucleotides.
No side effects were observed for either compound.
|
Weekly Administration of 2'-MOE-Modified Clusterin ASO Is
Equivalent to Daily Administration of Conventional P=S Clusterin ASO in
Vivo.
To assess whether increased stability and longer tissue
half-life of 2'-MOE-modified ASO would permit longer dosing intervals without loss of efficiency, athymic mice bearing PC-3 tumors were treated with either type of clusterin ASO or mismatch control oligonucleotides once weekly compared with conventional P=S clusterin ASO once daily. From days 10 to 14, and from days 24 to 28, 0.5 mg of
polymeric micellar paclitaxel (Leung et al., 2000) was administered once daily by i.v. injection. In combination with paclitaxel, weekly
administration of 2'-MOE-modified clusterin ASO was equivalent to daily
administration of conventional P=S clusterin ASO, reducing mean tumor
volumes by 31% compared with weekly administration of mismatch control
oligonucleotides and by 21% compared with weekly administration of
conventional P=S clusterin ASO, following 6 weeks after initiation of
treatment (Fig. 5).
|
| |
Discussion |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Hormonal and chemoresistance in advanced prostate cancer
develops, in part, from alterations in the apoptotic machinery, due to
increased activity of antiapoptotic pathways or expression of
antiapoptotic genes. Research during the past decade has identified several proteins that may promote progression and resistance by inhibiting apoptosis. Of special relevance to development of
androgen-independent progression and hormone refractory prostate cancer
are those survival proteins that are up-regulated after apoptotic
triggers, like androgen ablation, that function to inhibit cell death.
Proteins fulfilling these criteria include antiapoptotic members of the Bcl-2 protein family and clusterin. We (Paterson et al., 1999) and
others (McDonnell et al., 1992; Colombel et al., 1993; Raffo et al.,
1995) have reported that Bcl-2 levels increase after androgen withdrawal and during androgen-independent progression, and that Bcl-2
ASOs enhance cancer cell death after treatment with androgen withdrawal
or chemotherapy (Gleave et al., 1999; Miyake et al., 1999; Miyake et
al., 2000d). Similarly, clusterin levels increase in prostate cancer
cells after androgen ablation or chemotherapy, where it functions
like a heat shock protein to chaperone and stabilize protein
conformation at times of cell stress (Humphreys et al., 1999; Wilson
and Easterbrook-Smith, 2000; Miyake et al., 2000b,c). Forced
overexpression of clusterin in human prostate LNCaP cells results in an
androgen-independent and chemoresistant phenotype, while P=S clusterin
ASOs enhanced cancer cell death after treatment with androgen
withdrawal or chemotherapy (Miyake et al., 2000a,b,c).
In clinical trials, continuous intravenous infusions are required to
administer conventional P=S ASOs because of their short tissue lives,
which remains a major technical limitation. Therefore, over the past 10 years considerable effort has been made by numerous groups to improve
the stability and efficacy of ASO by modifications of the
phosphodiester linkage, the heterocycle, or the sugar. 2'-MOE ASOs form
duplexes with RNA with a significantly higher affinity relative to
phosphorothioate oligodeoxynucleotides. This increased affinity has
been shown to result in improved antisense potency both in cell culture
systems as well as in animals (Dean et al., 2001). In addition, 2'-MOE
ASOs display significantly improved resistance against
nuclease-mediated metabolism relative to phosphorothioate ASOs. This
property results in significantly improved tissue half-life in vivo,
which produces a longer duration of action and allows for more relaxed
dosing regimens. Finally, 2'-MOE ASOs have been reported to display a
more attractive safety profile relative to P=S ASOs (Henry et al.,
2000).
In the present study, 2'-MOE-modified ASO targeted against clusterin more potently inhibited clusterin mRNA expression in human PC-3 cells compared with conventional P=S ASO. Furthermore, the efficacy of clusterin ASO to enhance the cytotoxic effect of paclitaxel and docetaxel in PC-3 cells was not affected by the 2'-MOE modification compared with conventional P=S, as demonstrated using the MTT assay.
In vivo, 2'-MOE-modified clusterin ASO more effectively reduced mean PC-3 tumor volumes after combined treatment with paclitaxel compared with conventional P=S clusterin ASO. Analysis of body weights and multiple serum parameters after treatment with either compound did not reveal any sign of in vivo toxicity compared with untreated animals. Tissue half-lives in PC-3 tumors increased >5-fold using 2'-MOE-modified clusterin ASO, resulting in a more efficient inhibition of clusterin mRNA expression over 7 days after treatment. Ninety percent of 2'-MOE-modified ASO was detectable as full-length material at 1 week following dosing, whereas only 10% of P=S ASO was found as full-length sequence at 1 day following dosing. These CGE results were consistent with the findings demonstrating equivalently increased in vivo chemosensitivity toward paclitaxel by both daily administration of conventional P=S clusterin ASO and weekly administration of 2'-MOE-modified clusterin ASO.
Collectively, in vitro and in vivo results from this study in the human PC-3 tumor model confirm an improved efficacy for 2'-MOE-modified ASO over conventional P=S ASO to suppress clusterin and to enhance the chemosensitivity of paclitaxel. Furthermore, significantly increased ASO stability by incorporation of 2'-MOE chemistry will permit more convenient dosing regimens in clinical trials.
| |
Footnotes |
|---|
Accepted for publication May 11, 2001.
Received for publication February 19, 2001.
This work was supported in part by a grant from the Prostate Cancer Research Foundation of Canada, and the Hudson Fund at Vancouver Hospital. T.Z. was supported by the Swiss National Science Foundation, Krebsliga Basel, Lichtenstein-Stiftung, and Freiwillige Akademische Gesellschaft of the University of Basel, Switzerland.
Address correspondence to: Dr. Martin Gleave, Division of Urology, University of British Columbia, D-9, 2733 Heather St., Vancouver, British Columbia V5Z 3J5, Canada. E-mail: gleave{at}interchange.ubc.ca
| |
Abbreviations |
|---|
ASO, antisense oligonucleotide; P=O, phosphodiester; P=S, phosphorothioate; 2'-MOE, 2'-O-(2-methoxy)ethyl; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; CGE, capillary gel electrophoresis; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide.
| |
References |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
expression.
J Biol Chem
274:
1715-1722 in LNCaP cells by overexpression of sulfated glycoprotein-2 (clusterin).
Cancer Res
55:
2431-2437This article has been cited by other articles:
|
|
 |
|
  S. Chia, S. Dent, S. Ellard, P. M. Ellis, T. Vandenberg, K. Gelmon, J. Powers, W. Walsh, L. Seymour, and E. A. Eisenhauer Phase II Trial of OGX-011 in Combination with Docetaxel in Metastatic Breast Cancer Clin. Cancer Res., January 15, 2009; 15(2): 708 - 713. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Zoubeidi, J. Rocha, F. Z. Zouanat, L. Hamel, E. Scarlata, A. G. Aprikian, and S. Chevalier The Fer Tyrosine Kinase Cooperates with Interleukin-6 to Activate Signal Transducer and Activator of Transcription 3 and Promote Human Prostate Cancer Cell Growth Mol. Cancer Res., January 1, 2009; 7(1): 142 - 155. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. N. Chi, L. L. Siu, H. Hirte, S. J. Hotte, J. Knox, C. Kollmansberger, M. Gleave, E. Guns, J. Powers, W. Walsh, et al. A Phase I Study of OGX-011, a 2'-Methoxyethyl Phosphorothioate Antisense to Clusterin, in Combination with Docetaxel in Patients with Advanced Cancer Clin. Cancer Res., February 1, 2008; 14(3): 833 - 839. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Davis, B. Lollo, S. Freier, and C. Esau Improved targeting of miRNA with antisense oligonucleotides. Nucleic Acids Res., January 1, 2006; 34(8): 2294 - 2304. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Rocchi, E. Beraldi, S. Ettinger, L. Fazli, R. L. Vessella, C. Nelson, and M. Gleave Increased Hsp27 after Androgen Ablation Facilitates Androgen-Independent Progression in Prostate Cancer via Signal Transducers and Activators of Transcription 3-Mediated Suppression of Apoptosis Cancer Res., December 1, 2005; 65(23): 11083 - 11093. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. So, S. Sinnemann, D. Huntsman, L. Fazli, and M. Gleave Knockdown of the cytoprotective chaperone, clusterin, chemosensitizes human breast cancer cells both in vitro and in vivo Mol. Cancer Ther., December 1, 2005; 4(12): 1837 - 1849. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. N. Chi, E. Eisenhauer, L. Fazli, E. C. Jones, S. L. Goldenberg, J. Powers, D. Tu, and M. E. Gleave A Phase I Pharmacokinetic and Pharmacodynamic Study of OGX-011, a 2'-Methoxyethyl Antisense Oligonucleotide to Clusterin, in Patients With Localized Prostate Cancer J Natl Cancer Inst, September 7, 2005; 97(17): 1287 - 1296. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. A. Adjei and M. Hidalgo Intracellular Signal Transduction Pathway Proteins As Targets for Cancer Therapy J. Clin. Oncol., August 10, 2005; 23(23): 5386 - 5403. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Stankova, J. Shang, and R. Rozen Antisense Inhibition of Methylenetetrahydrofolate Reductase Reduces Cancer Cell Survival In vitro and Tumor Growth In vivo Clin. Cancer Res., March 1, 2005; 11(5): 2047 - 2052. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Yamanaka, M. E. Gleave, I. Hara, M. Muramaki, and H. Miyake Synergistic antitumor effect of combined use of adenoviral-mediated p53 gene transfer and antisense oligodeoxynucleotide targeting clusterin gene in an androgen-independent human prostate cancer model Mol. Cancer Ther., February 1, 2005; 4(2): 187 - 195. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. P. Trougakos, A. So, B. Jansen, M. E. Gleave, and E. S. Gonos Silencing Expression of the Clusterin/Apolipoprotein J Gene in Human Cancer Cells Using Small Interfering RNA Induces Spontaneous Apoptosis, Reduced Growth Ability, and Cell Sensitization to Genotoxic and Oxidative Stress Cancer Res., March 1, 2004; 64(5): 1834 - 1842. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kiyama, K. Morrison, T. Zellweger, M. Akbari, M. Cox, D. Yu, H. Miyake, and M. E. Gleave Castration-Induced Increases in Insulin-Like Growth Factor-Binding Protein 2 Promotes Proliferation of Androgen-independent Human Prostate LNCaP Tumors Cancer Res., July 1, 2003; 63(13): 3575 - 3584. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Urban, T. Golden, I. V. Aragon, L. Cowsert, S. R. Cooper, N. M. Dean, and R. E. Honkanen Identification of a Functional Link for the p53 Tumor Suppressor Protein in Dexamethasone-induced Growth Suppression J. Biol. Chem., March 7, 2003; 278(11): 9747 - 9753. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Zellweger, K. Chi, H. Miyake, H. Adomat, S. Kiyama, K. Skov, and M. E. Gleave Enhanced Radiation Sensitivity in Prostate Cancer by Inhibition of the Cell Survival Protein Clusterin Clin. Cancer Res., October 1, 2002; 8(10): 3276 - 3284. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|
 |
 |
 |
