JPET Assistant Professor of Medicine (Clinician-Educator)

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dunford, J. E.
Right arrow Articles by Rogers, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dunford, J. E.
Right arrow Articles by Rogers, M. J.

Vol. 296, Issue 2, 235-242, February 2001


Structure-Activity Relationships for Inhibition of Farnesyl Diphosphate Synthase in Vitro and Inhibition of Bone Resorption in Vivo by Nitrogen-Containing Bisphosphonates

James E. Dunford, Keith Thompson, Fraser P. Coxon, Steven P. Luckman, Frederick M. Hahn, C. Dale Poulter, Frank H. Ebetino and Michael J. Rogers

Department of Medicine and Therapeutics, University of Aberdeen Medical School, Foresterhill, Aberdeen, United Kingdom (J.E.D., K.T., F.P.C., S.P.L., M.J.R.); Department of Chemistry, University of Utah, Salt Lake City, Utah (C.D.P.); Maui Agricultural Research Center, University of Hawaii, Kula, Hawaii (F.M.H.); and Procter & Gamble Pharmaceuticals, Health Care Research Center, Mason, Ohio (F.H.E.)

    Abstract
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

It has long been known that small changes to the structure of the R2 side chain of nitrogen-containing bisphosphonates can dramatically affect their potency for inhibiting bone resorption in vitro and in vivo, although the reason for these differences in antiresorptive potency have not been explained at the level of a pharmacological target. Recently, several nitrogen-containing bisphosphonates were found to inhibit osteoclast-mediated bone resorption in vitro by inhibiting farnesyl diphosphate synthase, thereby preventing protein prenylation in osteoclasts. In this study, we examined the potency of a wider range of nitrogen-containing bisphosphonates, including the highly potent, heterocycle-containing zoledronic acid and minodronate (YM-529). We found a clear correlation between the ability to inhibit farnesyl diphosphate synthase in vitro, to inhibit protein prenylation in cell-free extracts and in purified osteoclasts in vitro, and to inhibit bone resorption in vivo. The activity of recombinant human farnesyl diphosphate synthase was inhibited at concentrations >= 1 nM zoledronic acid or minodronate, the order of potency (zoledronic acid approx  minodronate > risedronate > ibandronate > incadronate > alendronate > pamidronate) closely matching the order of antiresorptive potency. Furthermore, minor changes to the structure of the R2 side chain of heterocycle-containing bisphosphonates, giving rise to less potent inhibitors of bone resorption in vivo, also caused a reduction in potency up to ~300-fold for inhibition of farnesyl diphosphate synthase in vitro. These data indicate that farnesyl diphosphate synthase is the major pharmacological target of these drugs in vivo, and that small changes to the structure of the R2 side chain alter antiresorptive potency by affecting the ability to inhibit farnesyl diphosphate synthase.

    Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Bisphosphonates (BPs) are the most widely used and effective antiresorptive agents currently available for the treatment of Paget's disease, tumor-associated bone disease, and osteoporosis. All BPs have high affinity for bone mineral as a consequence of their P-C-P backbone structure, which allows chelation of calcium ions (for review, see Ebetino et al., 1998). Following release from bone mineral during acidification by osteoclasts, BPs appear to be internalized specifically by osteoclasts but not other bone cells (Sato et al., 1991). The intracellular accumulation of BP leads to inhibition of osteoclast function, due to changes in the cytoskeleton, loss of the ruffled border (Carano et al., 1990; Sato et al., 1991), and apoptosis (Hughes et al., 1995; Selander et al., 1996; Ito et al., 1999; Reszka et al., 1999).

The ability of BPs to inhibit bone resorption is dependent on the presence of the two phosphonate groups in the P-C-P structure, which appear to be required for interaction with a molecular target in the osteoclast as well as for binding bone mineral (Rogers et al., 1995; van Beek et al., 1998). However, the antiresorptive potency is determined by the chemical and three-dimensional structure of the two side chains, R1 and R2, attached to the central, geminal carbon atom (Geddes et al., 1994; Rogers et al., 2000). Following the discovery that CLO and ETI (BPs with a halogen or methyl group in the R2 side chain) could inhibit bone resorption, more potent BPs have been developed by the insertion of a primary, secondary or tertiary nitrogen function in the R2 side chain, for example, PAM, ALN, IBA and INC, which have an alkyl R2 side chain (Schenk et al., 1986; Mühlbauer et al., 1991; Rogers et al., 2000), or RIS, ZOL and MIN, which have a heterocyclic R2 side chain (Sietsema et al., 1989; Green et al., 1994; Sasaki et al., 1998). The R2 side chain, and especially the basic nitrogen group, appear to play an important role in the interaction of BPs with a pharmacological target, since minor modifications to the structure or conformation of the R2 side chain (that alter the position of the basic nitrogen group in relation to the P-C-P backbone) can dramatically affect antiresorptive potency (Sietsema et al., 1989; Ebetino and Dansereau, 1995; Rogers et al., 1995; Ebetino et al., 1996). For example, the pairs of heterocycle-containing BPs RIS and NE58051, and NE11808 and NE11809, differ only in the length of the R2 side chain (which is increased by -CH2 in NE58051) or methylation of the heterocyclic ring (as in NE11809) but differ by up to 3000-fold in antiresorptive potency in rodents in vivo (Rogers et al., 1995).

A possible explanation for these structure-activity relationships of nitrogen-containing BPs (N-BPs) has only recently been raised, following the discovery that these compounds inhibit the biosynthetic mevalonate pathway, thereby preventing the post-translational prenylation (farnesylation and geranylgeranylation) of small GTP-binding proteins (Luckman et al., 1998a,b; Benford et al., 1999; Reszka et al., 1999; Coxon et al., 2000). Prenylation involves the transfer of an isoprenoid lipid moiety (farnesyl or geranylgeranyl) from farnesyl diphosphate (FPP) or geranylgeranyl diphosphate (GGPP) onto a C-terminal cysteine residue of proteins with a characteristic prenylation motif (Zhang and Casey, 1996). Loss of prenylated, especially geranylgeranylated, small GTP-binding proteins such as cdc42, Rac, and Rho in osteoclasts is probably the major route by which N-BPs inhibit bone resorption, since the antiresorptive effect of N-BPs can be overcome in vitro by bypassing the metabolic pathway and replenishing cells with substrate that can be used for protein geranylgeranylation (Fisher et al., 1999; Reszka et al., 1999; van Beek et al., 1999a), and since the effect of BPs in vitro can be mimicked by a specific inhibitor of protein geranylgeranylation (Coxon et al., 2000).

The enzyme of the mevalonate pathway that is inhibited by N-BPs has only just been clarified. van Beek et al. (1999b) and others (Keller and Fliesler, 1999; Bergstrom et al., 2000) recently showed that FPP synthase is inhibited by several N-BPs, although the potent antiresorptive N-BPs ZOL, MIN, and INC were not included. The aim of this study was to determine the potency of a wide range of clinically important N-BPs for inhibition of FPP synthase and, more specifically, to determine whether changes in antiresorptive potency in vivo caused by small changes in the structure of the R2 side chain are due to differences in the ability to inhibit FPP synthase.

    Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Reagents. Clodronate (CLO), etidronate (ETI), alendronate (ALN), risedronate (RIS), pamidronate (PAM), ibandronate (IBA), incadronate (INC, also known as YM-175), NE11808, NE11809, and NE58051 were from Procter & Gamble Pharmaceuticals (Cincinnati, OH). Zoledronic acid (ZOL) (the hydrated disodium salt) was from Novartis Pharma AG (Basle, Switzerland), and minodronate (MIN, also known as YM-529) was from Yamanouchi (Tokyo, Japan). The BPs were dissolved in PBS, the pH adjusted to 7.4 with 1 N NaOH, and then filter-sterilized by using a 0.2-µm filter. Mevastatin was purchased from Sigma Chemical Co. (Poole, UK) and converted from the lactone as described by Luckman et al. (1998b). [14C]Mevalonic acid lactone was from Amersham (Aylesbury, UK). Protease inhibitor cocktail and all other reagents were from Sigma Chemical Co., unless stated otherwise.

Incorporation of [14C]Mevalonate into Prenylated Proteins in Osteoclasts. Protein prenylation in purified rabbit osteoclasts in vitro was measured as described recently by Coxon et al. (2000). Briefly, mature osteoclasts were isolated from rabbit long bones and seeded into six-well plates (Costar, Cambridge, MA). Nonosteoclastic cells were removed using pronase/EDTA, and then the osteoclasts were depleted of mevalonate by incubation in alpha -minimum essential medium containing 10% fetal calf serum and 5 µM mevastatin for 4 h. The medium was replaced with 1.0 ml/well fresh alpha -minimum essential medium/10% fetal calf serum containing 5 µM mevastatin, 7.5 µCi/ml [14C]mevalonic acid lactone (specific activity 57 mCi/mmol) plus 100 µM RIS, NE58051, NE11808, or NE11809 (duplicate wells per treatment). After 24 h the cells were lysed, and then 50 µg of osteoclast lysate from each treatment was electrophoresed on 12% polyacrylamide-SDS gels under reducing conditions. The gels were fixed and dried, and then labeled proteins were visualized on a Bio-Rad personal FX imager after exposure to a Kodak phosphorimaging screen.

In Vitro Assay of Protein Prenylation. The effect of BPs on protein prenylation in vitro was examined using rabbit reticulocyte lysate (Promega, Madison, WI), which contains all the enzymes necessary for the conversion of mevalonic acid to FPP and GGPP, and the prenyl:protein transferases required for prenylation of exogenous protein substrates (Vorburger et al., 1989). Recombinant H-Ras (Ras-CVLS; Calbiochem, La Jolla, CA) was used as a substrate for prenylation (Fig. 2). Briefly, 10 µl of reticulocyte lysate in replicate tubes were diluted to 30 µl with water. Ras-CVLS (1.5 µg) was added to each tube, together with 0.1 to 100 µM (final concentration) BP or equivalent volume of PBS, and mixed with 0.2 µCi of [14C]mevalonic acid lactone. The lysates were then incubated for 16 h at 37°C. As a negative control, lysates were incubated without Ras substrate. Following incubation, 30 µl of 2× Laemmli sample buffer containing 16 M urea and 5 × 10-6 M beta -mercaptoethanol was added to each tube and boiled for 5 min. The entire contents of each tube were electrophoresed on 12% SDS-PAGE gels under reducing conditions. Radiolabeled Ras-CVLS was visualized after overnight exposure of gels to an imaging screen using a Bio-Rad personal imager and Quantity One software. Densitometric analysis of radiolabeled Ras bands was performed on gels from three independent experiments and values were calculated as a percentage of control (mean ± S.E.M., n = 3).

Expression of Recombinant Human IPP Isomerase and FPP Synthase. The human IPP isomerase clone pFMH12 (Hahn et al., 1996) in the bacterial expression vector pARC306N was used to transform Escherichia coli JM101 (Stratagene Cloning Systems, La Jolla, CA). Bacterial cultures were grown in terrific broth with 50 µg/ml ampicillin at 37°C and vigorous aeration. Bacteria were harvested after the log phase of growth, typically after 7 h, by centrifugation at 2500g for 10 min. The bacterial pellet was resuspended in 5 ml/g wet weight of ice-cold homogenization buffer [50 mM HEPES pH 7.0, 2% (v/v) protease inhibitor cocktail, 0.8 mM dithiothreitol, 10% (v/v) glycerol] and homogenized by sonication on medium power for 3 × 10 s on ice with a cooling period between each 10-s burst. The bacterial lysate was then centrifuged at 13,000g for 20 min at 4°C to remove cell debris. The supernatant was aliquoted and stored at -20°C.

The human farnesyl diphosphate synthase clone KIA1293 was a kind gift from the Kazuza DNA Research Institute (Kisarazu, Chiba, Japan). The coding region was excised by PCR using Accurase (Biogene Ltd., Kimbolton, Cambs, UK); forward primer: ATGCCCCTGTCCCGCTGGTTG, reverse primer: TCACTTTCTCCGCTTGTAGATTTTG, 300 ng of plasmid template, 94°C 2 min, 8 cycles of 94°C 30 s, 60°C 60 s, 68°C 90 s, and finally 68°C for 7 min). The 1250-base pair PCR product was separated on a 1% agarose gel and then cloned into the pBAD-TOPO bacterial expression system (Invitrogen BV, Groningen, The Netherlands). Clones were screened for insert orientation by PCR and restriction digest of purified plasmid with either NcoI/EcoRI or BanII. Bacterial clones expressing active FPP synthase were grown overnight in 200 ml of terrific broth with 50 µg/ml ampicillin and 0.02% arabinose. Cultures were harvested at 10,000g for 10 min, and then cell pellets were homogenized by suspension in 5 ml/g wet weight Bug Buster (Novagen, Madison, WI) with 1 unit/ml benzonase, and shaken for 20 min at room temperature. The homogenate was then centrifuged for 10 min at 10,000g to remove cellular debris. FPP synthase was partially purified from the homogenate by ammonium sulfate fractionation. The 30 to 70% fraction was dialyzed against 50 mM Tris pH 7.6, 1 mM dithiothreitol, and the resulting preparation made up to 50% glycerol, aliquoted, and stored at -20°C. The specific activity of FPP synthase in these preparations was approximately 10 pmol of FPP/min/µg of protein.

Homogenization of J774 Cells. IPP isomerase and FPP synthase activity was measured in homogenates of J774 macrophages. These cells undergo apoptosis after treatment with BPs in vitro, as a result of inhibition of protein prenylation (Luckman et al., 1998a,b; Benford et al., 1999). J774 cells were grown to confluence in 10-cm2 tissue culture plates. Cells were harvested by scraping and washed three times in ice-cold PBS. The cells were resuspended in 400 µl of homogenization buffer [50 mM Tris pH 7.7, 10% (v/v) glycerol, 50 µl/ml protease inhibitor cocktail] per 100 mg of cells and were then homogenized by sonication at medium power for 3 × 10 s on ice with a cooling period between each 10-s burst. The homogenate was then centrifuged for 20 min at 13,000g, 4°C to remove cell debris. The supernatant was stored at -20°C until assayed for IPP isomerase or FPP synthase as described below.

FPP Synthase Assay. FPP synthase was assayed by the method of Reed and Rilling (1975) with modifications. Extraction of the reaction products with butan-1-ol ensures that only 14C incorporated into FPP or isoprenoids of greater chain length is counted (Ericsson et al., 1992). Briefly, 40 µl of assay buffer (50 mM Tris pH 7.7, 10 mM NaF, 2 mM MgCl2, 1 mg/ml BSA, 0.5 mM dithiothreitol) containing 2 nmol of 1-[14C]IPP (4 µCi/mmol) and 2 nmol of GPP was prewarmed to 37°C. The assay was initiated by the addition of 1 to 5 µl of J774 homogenate or 1 µl of recombinant FPP synthase (with an activity of 8 pmol of FPP/min) diluted to 10 µl with assay buffer to give a final volume of 50 µl. The assay was allowed to proceed for 30 min and was terminated by the addition of 200 µl of saturated NaCl. The reactions were then extracted with 1 ml of water-saturated butan-1-ol, and after thorough mixing and brief centrifugation the amount of radioactivity in the upper phase was determined by mixing 0.5 ml of the butyl alcohol with 4 ml of general purpose scintillant. This was then counted using a Packard Tricarb 1900CA scintillation counter. To determine the effects of BPs on FPP synthase activity, the BPs were diluted to 5× final concentration in assay buffer and were preincubated with the enzyme preparation for 10 min before initiation of the reaction. Reactions were allowed to proceed until a maximum of approximately 10% of the available substrate was used.

IPP Isomerase Assay. IPP isomerase was assayed by the acid-lability method, based on the principle that IPP is resistant to hydrolysis by concentrated acid, whereas dimethylallyl diphosphate is not. The products of the acid hydrolysis can then be extracted from the reaction mixture using a solvent in which IPP is insoluble (Satterwhite, 1985). Briefly, 40 µl of assay buffer (50 mM HEPES pH 7.0, 200 mM KCl, 10 mM MgCl2, 1 mg/ml BSA, 0.5 mM dithiothreitol) containing 20 nmol of 1-[14C]IPP (2 µCi/mmol) was prewarmed to 37°C. The reaction was initiated by the addition of 1 to 5 µl of enzyme preparation (cell homogenate or recombinant enzyme) diluted to 10 µl in assay buffer. After incubation for up to 10 min, the reaction was terminated by the addition of 200 µl of 1:4 (v/v) concentrated HCl:methanol. After incubation for a further 10 min at 37°C, the hydrolyzed reaction products were solvent extracted into 1 ml of ligroin. The radioactivity contained in 0.5 ml of the ligroin was then determined by mixing with 4 ml of general purpose scintillant and counting using a Packard Tricarb 1900CA scintillation counter. To determine the effects of BPs on IPP isomerase activity, the BPs were dissolved at 5× final concentration in assay buffer and were preincubated with the enzyme preparation for 10 min before initiation of the reaction.

    Results
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Structure-Activity Relationships for Inhibition of Protein Prenylation in Osteoclasts. To determine whether the antiresorptive potency of N-BPs is related to the ability to inhibit protein prenylation in osteoclasts, we examined the effects of pairs of structurally related, inactive/active antiresorptive N-BPs on the incorporation of [14C]mevalonate into prenylated proteins in purified rabbit osteoclasts in vitro. Consistent with our recent studies (Luckman et al., 1998a,b; Coxon et al., 2000), 100 µM RIS (a potent antiresorptive BP) completely inhibited the incorporation of [14C]mevalonate into prenylated, small GTPase proteins (of molecular mass approximately 21-26 kDa) in osteoclasts (Fig. 1B) In addition, RIS inhibited the incorporation of [14C]mevalonate into low molecular mass, nonproteinaceous isoprenoid compounds at the dye front (Luckman et al., 1998b). In contrast, the structurally related, less potent antiresorptive analog NE58051, which differs from RIS only in the length of the R2 side chain (Fig. 1A), did not affect protein prenylation at a concentration of 100 µM, and did not affect labeling of compounds at the dye front. Similarly, 100 µM NE11808 (a potent antiresorptive BP) effectively inhibited protein prenylation in osteoclasts and inhibited labeling of compounds at the dye front, whereas 100 µM NE11809 [a less potent antiresorptive BP that differs in the methylation of the heterocyclic group in the R2 side chain (Rogers et al., 1995)] did not affect protein prenylation or labeling of isoprenoid compounds at the dye front (Fig. 1B). Hence, there was a clear correlation between the ability of N-BPs to inhibit the mevalonate pathway and prevent protein prenylation in osteoclasts in vitro and the ability to inhibit osteoclastic bone resorption in vivo.


View larger version (66K):
[in this window]
[in a new window]
 
Fig. 1.   Inhibition of protein prenylation by bisphosphonates in purified rabbit osteoclasts. Osteoclasts were isolated from rabbits and purified using pronase/EDTA. Cultures of purified osteoclasts were then metabolically labeled for 24 h with [14C]mevalonate in the absence or presence of 100 µM RIS, NE58051, NE11808, or NE11809. Osteoclast lysates were analyzed by SDS-PAGE on 12% gels and radiolabeled, prenylated proteins were detected by phosphorimaging (B). Also shown are the chemical structures of the N-BPs (A).

Nitrogen-Containing Bisphosphonates Inhibit Protein Prenylation in Cell-Free Lysates. Rabbit reticulocyte lysates were used as a source of enzymes of the mevalonate pathway to examine the relative potencies of BPs for inhibiting protein prenylation in cell-free lysates. Inhibition of Ras farnesylation was first examined using two non-N-BPs (CLO and ETI), three BPs containing a primary or tertiary amine group (PAM, ALN, and IBA), and a representative heterocycle-containing BP (RIS). Lysates were incubated with [14C]mevalonate and recombinant Ras-CVLS, a substrate for protein farnesylation. alpha -Hydroxyfarnesyl phosphonate (7.5 and 75 µM), an inhibitor of protein:farnesyl transferase (Gibbs et al., 1993), inhibited the incorporation of [14C]mevalonate into Ras-CVLS by 12 and 83%, respectively. ALN, RIS, PAM, or IBA (all 0.1 µM) did not inhibit the incorporation of [14C]mevalonate into Ras-CVLS (Fig. 2B). However, >= 1 µM RIS or IBA, >= 10 µM ALN, or 100 µM PAM inhibited the incorporation of [14C]mevalonate into Ras-CVLS (Fig. 2, B and C). CLO and ETI slightly inhibited the incorporation of [14C]mevalonate into Ras-CVLS at concentrations of 100 and 1000 µM but had no effect at lower concentrations (data not shown). The order of potency for inhibiting farnesylation of Ras-CVLS in vitro was therefore RIS approx  IBA > ALN > PAM > CLO approx  ETI, almost identical to the order of antiresorptive potency in vivo (RIS approx  IBA > ALN > PAM > CLO > ETI) (Geddes et al., 1994). This confirmed that reticulocyte lysates could be used to study the effect of N-BPs on protein prenylation in a cell-free system.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 2.   Inhibition of incorporation of [14C]mevalonate into farnesylated Ras-CVLS by bisphosphonates in vitro. Simplified representation of the mevalonate pathway (A). The reactions indicated are catalyzed by IPP isomerase (1), FPP synthase (2), GGPP synthase (3), protein:farnesyl transferase (4), protein:geranylgeranyl transferase I (5), and squalene synthase (6). Rabbit reticulocyte lysates were incubated with recombinant Ras-CVLS and [14C]mevalonate for 16 h at 37°C in the absence or presence of 0.1 to 100 µM BPs. 14C-labeled, farnesylated Ras-CVLS was visualized by phosphorimaging after addition of 8 M (final concentration) urea to the lysates and separation of proteins by SDS-PAGE on 12% gels (B). Band density was quantitated as a percentage of control and results were expressed as the mean ± S.E.M. from three independent experiments with 1 or 10 µM ALN, RIS, PAM, and IBA (C).

Pairs of N-BPs with modifications to the R2 side chain were then assayed using this approach. Although 10 µM RIS markedly inhibited farnesylation of Ras-CVLS, 10 µM NE58051 [an analog of RIS that did not affect prenylation in osteoclasts (Fig. 1B) and is 3000 times less potent at inhibiting bone resorption in vivo (Luckman et al., 1998a)] only partially inhibited farnesylation of Ras-CVLS (Fig. 3). Similarly, 10 µM NE11808 (a potent antiresorptive BP that inhibited prenylation in osteoclasts; Fig. 1B) completely inhibited farnesylation of Ras-CVLS, whereas 10 µM NE11809 (a less antiresorptive analog that had no effect on prenylation in osteoclasts) did not inhibit farnesylation of Ras-CVLS (Fig. 3). Hence, this cell-free assay accurately reflected the structure-activity relationships of BPs for inhibiting protein prenylation in osteoclasts in vitro (Fig. 1B) and for inhibiting bone resorption in vivo.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3.   Structure-activity relationships for inhibition of incorporation of [14C]mevalonate into farnesylated Ras-CVLS in rabbit reticulocyte lysates. A, rabbit reticulocyte lysates were incubated with recombinant Ras-CVLS and [14C]mevalonate for 16 h at 37°C in the absence or presence of 100 µM of the potent antiresorptive N-BPs RIS or NE11808, or 100 µM of the less antiresorptive structural analogs NE58051 or NE11809, respectively. 14C-labeled, farnesylated Ras-CVLS was visualized as in Fig. 2. B, band density was quantitated as a percentage of control and results were expressed as the mean ± S.E.M. from three independent experiments.

Nitrogen-Containing Bisphosphonates Do Not Inhibit Recombinant IPP Isomerase. To determine whether N-BPs affected the activity of IPP isomerase, we examined their effect on the activity of recombinant human IPP isomerase. The enzyme was expressed in JM101 cells using the pARC301N bacterial expression system, which was found to constitutively express the protein to a high level (>40% of total bacterial protein). Crude lysates from JM101 cultures expressing recombinant protein were typically found to have specific IPP isomerase activity of 0.13 nmol/min/µg of protein. Native bacterial IPP isomerase activity in JM101 cells under these conditions was negligible. Lysates from J774 cells were also assayed for IPP isomerase activity, which was typically found to be 0.24 pmol/min/µg of protein.

Recombinant enzymes and J774 cell lysates were assayed for IPP isomerase activity in the presence of 1 to 100 µM BPs. All of the BPs tested failed to inhibit IPP isomerase activity even at a concentration of 100 µM (Fig. 4). High (>1000 µM) concentrations of BPs had a slight inhibitory effect, most likely due to chelation of Mg2+ ions required for enzyme activity, rather than more specific enzyme inhibition.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4.   Bisphosphonates do not inhibit IPP isomerase. Bacterial lysate containing recombinant human IPP isomerase was preincubated with 100 µM BPs for 10 min before addition of [14C]IPP substrate. Acid-labile products of the reaction were then extracted and measured by liquid scintillation counting. Data are the mean ± S.D. of triplicate or quadruplicate assays and are representative of at least three independent experiments.

Nitrogen-Containing Bisphosphonates Inhibit FPP Synthase. To assay FPP synthase in J774 homogenates, typically 10 to 20 µg of protein were used per assay and enzyme activities of 0.6 pmol/min/µg of protein were obtained from the crude homogenate. The use of butan-1-ol as the extracting solvent in which neither IPP nor dimethylallyl diphosphate is soluble ensured that any isotope extracted into the solvent had been incorporated into geranyl diphosphate or isoprenoids of greater chain length, thus minimizing interference from the activity of IPP isomerase. Furthermore, since recombinant IPP isomerase was found to be unaffected by BPs, any inhibition by BPs observed with the enzyme preparations could be ascribed fully to an effect on FPP synthase.

The N-BPs ZOL, RIS, IBA, ALN, and PAM inhibited FPP synthase in J774 cell homogenates with IC50 values from 0.02 to 0.85 µM (Fig. 5; Table 1). With recombinant human FPP synthase, the IC50 values were consistently about 10-fold less, with values as low as 0.003 µM for ZOL and MIN (Table 1). At a concentration of 0.1 µM there was a clear difference in effectiveness between the N-BPs for inhibiting recombinant human FPP synthase, with MIN, ZOL, and RIS being significantly more effective at inhibiting FPP synthase than ALN or PAM, whereas ALN was significantly more effective than PAM (Fig. 5B). The non-N-BPs CLO and ETI did not have any significant inhibitory effect on FPP synthase activity (Fig. 5, A and B), even at concentrations as high as 100 µM. CLO was still ineffective even at 1000 µM.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 5.   Inhibition of FPP synthase by bisphosphonates. A, J774 cell homogenate (approximately 20 µg of protein/assay) was preincubated with 0.001 to 100 µM BPs for 10 min before addition of [14C]IPP enzyme substrate. The data shown in A are from one experiment (expressed as a percentage of FPP synthase activity in the absence of BP) and are representative of several independent experiments. CLO (), ETI (black-square), PAM (black-triangle), IBA (), ALN (×), ZOL (black-diamond ), RIS (open circle ). B, bacterial lysate containing recombinant human FPP synthase was preincubated with 0.1 µM BPs for 10 min before addition of [14C]IPP enzyme substrate. The data are the mean ± S.E.M. of at least three independent experiments, expressed as a percentage of FPP synthase activity in the absence of BP. ***p < 0.001 versus control; ap < 0.05 versus ALN; bp < 0.001 versus ALN (ANOVA with Bonferroni's post hoc test).


                              
View this table:
[in this window]
[in a new window]
 
TABLE 1
Antiresorptive potency of bisphosphonates in vivo and their ability to inhibit FPP synthase in vitro

The values for lowest effective dose (LED) are for inhibition of bone resorption in rats in vivo (Geddes et al., 1994; Ebetino and Dansereau, 1995; Luckman et al., 1998a). Values of IC50 (mean ± S.E.M. from three experiments) were calculated from dose-response plots of inhibition of FPP synthase in J774 cell homogenates or inhibition of recombinant human FPP synthase. CLO and ETI were not included since inhibition was negligible at concentrations <= 100 µM. Linear regression analysis demonstrated a significant correlation between antiresorptive potency of N-BPs and potency for inhibition of FPP synthase (r = 0.95, p < 0.0001; Spearman's rho correlation).

A comparison was also made between the potency of RIS and NE58051, and between NE11808 and NE11809, for inhibiting recombinant human FPP synthase. RIS was found to be almost 300-fold more potent at inhibiting recombinant FPP synthase than NE58051 (Fig. 6), whereas NE11808 was 73-fold more potent than NE11809 (Fig. 6; Table 1). Similar results were obtained with J774 cell homogenates (Table 1).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 6.   Structure-activity relationships for inhibition of FPP synthase by RIS/NE58051 and NE11808/NE11809. Recombinant human FPP synthase was preincubated with 0.001 to 10 µM BPs for 10 min before addition of [14C]IPP substrate. Data are the mean ± S.E.M. of three independent experiments, expressed as a percentage of FPP synthase activity in the absence of BP. *p < 0.05 versus NE58051/NE11809; **p < 0.01 versus NE58051/NE11809 (paired t test).

Linear regression analysis of values of in vivo antiresorptive potency and IC50 values for inhibition of recombinant human FPP synthase for the compounds shown in Table 1 was carried out using the nonparametric Spearman's rho correlation test. The value of r was 0.94, with p = 0.0001, indicating a highly significant correlation between the ability to inhibit FPP synthase and the ability to inhibit bone resorption in vivo.

    Discussion
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

We and others have recently shown that N-BPs inhibit bone resorption by preventing protein prenylation in osteoclasts (Fisher et al., 1999; van Beek et al., 1999a; Coxon et al., 2000), owing to inhibition of FPP synthase, an enzyme in the mevalonate pathway (van Beek et al., 1999b; Bergstrom et al., 2000). In this study, we sought to determine the potency of a wider range of N-BPs for inhibiting FPP synthase, and determine whether changes in antiresorptive potency in vivo caused by altering the structure of the R2 side chain of N-BPs are due to differences in potency for inhibiting FPP synthase.

Using a cell-free protein prenylation assay, we found that the order of potency of BPs for inhibiting prenylation of a recombinant Ras substrate (Ras-CVLS) matched the order of antiresorptive potency, with the N-BPs RIS and IBA being more potent than ALN or PAM. Furthermore, CLO and ETI had little effect on prenylation of Ras-CVLS, consistent with the inability of CLO and ETI (which lack a nitrogen in the chemical structure) to inhibit protein prenylation in intact cells (Luckman et al., 1998b; Benford et al., 1999; Coxon et al., 2000) and the finding by us and others (van Beek et al., 1999c; Bergstrom et al., 2000) that CLO and ETI have little effect on the activity of FPP synthase in vitro.

Although many previous studies have demonstrated the importance of the structure and conformation of the R2 side chain of N-BPs in determining antiresorptive potency, an explanation for these structure-activity relationships has not been fully established. In this study we found that for two pairs of heterocycle-containing N-BPs with minor differences in the R2 side chain (RIS versus NE58051, and NE11808 versus NE11809), the ability to inhibit prenylation of Ras-CVLS in the cell-free prenylation assay matched the ability to inhibit protein prenylation in purified osteoclasts in vitro and also matched the relative potency for inhibition of bone resorption in vivo. This difference appears to be due to the ability to inhibit FPP synthase, since both RIS and NE11808 were potent inhibitors of recombinant human FPP synthase and FPP synthase in macrophage lysates, whereas NE58051 and NE11809 were up to 293-fold less potent at inhibiting the enzyme. We recently reported a similar correlation between the ability of these compounds to inhibit protein prenylation in macrophage cells and their antiresorptive potency (Luckman et al., 1998a), although differences in cellular uptake between the pairs of N-BPs could have accounted for the differences in ability to inhibit protein prenylation. Since we found in the present study that these pairs of compounds also differ in their ability to inhibit recombinant FPP synthase and protein prenylation in cell-free lysates, this demonstrates for the first time that the structure-activity relationships of N-BPs for inhibition of bone resorption in vivo are related to differences in the ability to inhibit FPP synthase rather than to differences in cellular uptake or bioavailability.

The relative ability of N-BPs to inhibit FPP synthase appears to be dependent on the orientation of the nitrogen atom in the heterocyclic group relative to the phosphonate groups. The potent antiresorptive N-BP NE58025 adopts a rigid three-dimensional conformation with the nitrogen atom located at a fixed position (Ebetino et al., 1993). A comparison between the three-dimensional structure of NE58025 and possible conformations of RIS and NE11808 (Fig. 7) shows that a close overlap is possible between the position of the nitrogen in NE58025, RIS, and NE11808. In contrast, a close overlap of the nitrogen is not energetically favored with NE58051 or NE11809, which are less potent inhibitors of FPP synthase than RIS or NE11808. This suggests that the nitrogen atom in N-BPs interacts with amino acid residues in a binding site in FPP synthase. Martin et al. (1999) recently suggested that N-BPs could inhibit IPP isomerase or FPP synthase because the nitrogen atom of N-BPs may mimic a carbocation in the transition state of IPP, GPP, or FPP in the active site of IPP isomerase or FPP synthase. Our data confirm that the orientation of the nitrogen atom is indeed essential for inhibition of FPP synthase. However, none of the BPs examined inhibited recombinant human IPP isomerase in vitro at concentrations up to 1000 µM [i.e., 100-fold higher than concentrations that inhibit prenylation in intact osteoclasts or macrophages (Luckman et al., 1998b; Bergstrom et al., 2000; Coxon et al., 2000)], confirming that IPP isomerase is not a target of N-BPs (van Beek et al., 1999b; Bergstrom et al., 2000). Further crystallographic studies are therefore necessary to identify the exact manner in which N-BPs bind to and inhibit FPP synthase rather than IPP isomerase.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 7.   Comparison between the three-dimensional structures of NE58025, RIS/NE58051, and NE11808/NE11809 The nitrogen (arrow) of the heterocyclic group in the rigid conformation of NE58025 closely overlaps the nitrogen in RIS and NE11808.

Our studies also demonstrate that FPP synthase is a molecular target of the antiresorptive N-BPs ZOL, MIN, and INC, which have not previously been studied. The N-BPs ZOL, MIN, RIS, IBA, INC, ALN, and PAM dose dependently inhibited FPP synthase activity in lysates of J774 macrophages [a murine cell line in which the inhibitory effect of N-BPs on protein prenylation was first demonstrated (Luckman et al., 1998b)], or recombinant human FPP synthase, with a statistically significant correlation between the order of potency for inhibition of recombinant human FPP synthase in vitro and the order of antiresorptive potency in vivo. ZOL and MIN inhibited recombinant human FPP synthase at concentrations >= 1 nM. This is consistent with our finding that a concentration of 10 µM ZOL or RIS completely inhibits prenylation in intact J774 cells and osteoclasts (Luckman et al., 1998b; Coxon et al., 2000). Similar values of IC50 for inhibition of FPP synthase and FPP synthase/IPP isomerase by RIS, IBA, ALN, and PAM were recently reported by Bergstrom et al. (2000) and van Beek et al. (1999c).

Interestingly, INC and IBA have also been shown to inhibit squalene synthase, another enzyme in the mevalonate pathway required for cholesterol biosynthesis (Amin et al., 1992, 1996). However, these N-BPs appear to inhibit bone resorption due to inhibition of FPP synthase (resulting in the loss of the downstream metabolite GGPP required for geranylgeranylation of small GTPases essential for osteoclast function (Coxon et al., 2000) rather than squalene synthase, since the addition of cholesterol (hence bypassing the requirement for squalene synthase) could not rescue osteoclasts in vitro from the effect of N-BPs (Fisher et al., 1999; van Beek et al., 1999a).

Our observations demonstrate that the antiresorptive property of N-BPs in vivo results from their ability to prevent protein prenylation in osteoclasts following inhibition of FPP synthase. Furthermore, the changes in antiresorptive potency that arise due to changes in the R2 side chain of N-BPs can also be explained largely by differences in the ability to inhibit FPP synthase rather than differences in cellular uptake or pharmacokinetics.

    Acknowledgment

We thank Dr. Bobby Barnett, Procter & Gamble Pharmaceuticals, for providing the structures shown in Fig. 7.

    Footnotes

Accepted for publication October 16, 2000.

Received for publication August 22, 2000.

This work was supported by a project grant to F.P.C. and M.J.R. from the Arthritis Research Campaign (CO583), by National Institutes of Health Grant GM 25521 (to C.D.P.), and by Procter & Gamble Pharmaceuticals, Cincinnati, OH, and Aventis Pharma, Bridgewater, NJ.

Send reprint requests to: Dr. M. J. Rogers, Department of Medicine and Therapeutics, University of Aberdeen Medical School, Polwarth Bldg., Foresterhill, Aberdeen, AB25 2ZD, UK. E-mail: m.j.rogers{at}abdn.ac.uk

    Abbreviations

BP, bisphosphonate; CLO, dichloromethylene-1,1-bisphosphonate; ETI, 1-hydroxyethylidene-1,1-bisphosphonate; PAM, 3-amino-1-hydroxypropylidene-1,1-bisphosphonate; ALN, 4-amino-1-hydroxybutylidene-1,1-bisphosphonate; IBA, 1-hydroxy-3(methylpentylamino)-propylidene-1,1-bisphosphonate; INC, [(cycloheptylamino)-methylene]bisphosphonate; RIS, 2-(3-pyridinyl)-1-hydroxyethylidene-1,1-bisphosphonate; ZOL, 2-(imidazol-1-yl)-hydroxyethylidene-1,1-bisphosphonate; MIN, [1-hydroxy-2-imidazo(1,2-a)pyridin-3-ylethylidene]bisphosphonate; N-BP, nitrogen-containing bisphosphonate; FPP, farnesyl diphosphate; GGPP, geranylgeranyl diphosphate; PAGE, polyacrylamide gel electrophoresis; IPP, isopentenyl diphosphate; PCR, polymerase chain reaction.

    References
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References


0022-3565/01/2962-0235$03.00/0
THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS
Copyright © 2001 by The American Society for Pharmacology and Experimental Therapeutics



This article has been cited by other articles:


Home page
Ann OncolHome page
E. Terpos, O. Sezer, P. I. Croucher, R. Garcia-Sanz, M. Boccadoro, J. San Miguel, J. Ashcroft, J. Blade, M. Cavo, M. Delforge, et al.
The use of bisphosphonates in multiple myeloma: recommendations of an expert panel on behalf of the European Myeloma Network
Ann. Onc., May 22, 2009; (2009) mdn796v1.
[Abstract] [Full Text] [PDF]


Home page
CJASNHome page
N. D. Toussaint, G. J. Elder, and P. G. Kerr
Bisphosphonates in Chronic Kidney Disease; Balancing Potential Benefits and Adverse Effects on Bone and Soft Tissue
Clin. J. Am. Soc. Nephrol., January 1, 2009; 4(1): 221 - 233.
[Abstract] [Full Text] [PDF]


Home page
IBMS BoneKEyHome page
F. P. Coxon
An Update on the Pharmacology of Bisphosphonates and Analogues with Lower Bone Affinity
IBMS BoneKEy, October 1, 2008; 5(10): 357 - 369.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. D. Miller, P. D. Delmas, R. Lindsay, N. B. Watts, M. Luckey, J. Adachi, K. Saag, S. L. Greenspan, E. Seeman, S. Boonen, et al.
Early Responsiveness of Women with Osteoporosis to Teriparatide After Therapy with Alendronate or Risedronate
J. Clin. Endocrinol. Metab., October 1, 2008; 93(10): 3785 - 3793.
[Abstract] [Full Text] [PDF]


Home page
Mayo Clin Proc.Home page
M. T. Drake, B. L. Clarke, and S. Khosla
Bisphosphonates: Mechanism of Action and Role in Clinical Practice
Mayo Clin. Proc., September 1, 2008; 83(9): 1032 - 1045.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
P. D. Ottewell, H. Monkkonen, M. Jones, D. V. Lefley, R. E. Coleman, and I. Holen
Antitumor Effects of Doxorubicin Followed by Zoledronic Acid in a Mouse Model of Breast Cancer
J Natl Cancer Inst, August 20, 2008; 100(16): 1167 - 1178.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
P. D. Ottewell, B. Deux, H. Monkkonen, S. Cross, R. E. Coleman, P. Clezardin, and I. Holen
Differential Effect of Doxorubicin and Zoledronic Acid on Intraosseous versus Extraosseous Breast Tumor Growth In vivo
Clin. Cancer Res., July 15, 2008; 14(14): 4658 - 4666.
[Abstract] [Full Text] [PDF]


Home page
J Biomol ScreenHome page
M. Simonen, Y. Ibig-Rehm, G. Hofmann, J. Zimmermann, G. Albrecht, M. Magnier, V. Heidinger, and D. Gabriel
High-Content Assay to Study Protein Prenylation
J Biomol Screen, July 1, 2008; 13(6): 456 - 467.
[Abstract] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
A. Dudakovic, A. J. Wiemer, K. M. Lamb, L. A. Vonnahme, S. E. Dietz, and R. J. Hohl
Inhibition of Geranylgeranyl Diphosphate Synthase Induces Apoptosis through Multiple Mechanisms and Displays Synergy with Inhibition of Other Isoprenoid Biosynthetic Enzymes
J. Pharmacol. Exp. Ther., March 1, 2008; 324(3): 1028 - 1036.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Holderness, L. Jackiw, E. Kimmel, H. Kerns, M. Radke, J. F. Hedges, C. Petrie, P. McCurley, P. M. Glee, A. Palecanda, et al.
Select Plant Tannins Induce IL-2R{alpha} Up-Regulation and Augment Cell Division in {gamma}{delta} T Cells
J. Immunol., November 15, 2007; 179(10): 6468 - 6478.
[Abstract] [Full Text] [PDF]


Home page
JDRHome page
D.B. Kimmel
Mechanism of Action, Pharmacokinetic and Pharmacodynamic Profile, and Clinical Applications of Nitrogen-containing Bisphosphonates
Journal of Dental Research, November 1, 2007; 86(11): 1022 - 1033.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Ling, Z.-H. Li, K. Miranda, E. Oldfield, and S. N. J. Moreno
The Farnesyl-diphosphate/Geranylgeranyl-diphosphate Synthase of Toxoplasma gondii Is a Bifunctional Enzyme and a Molecular Target of Bisphosphonates
J. Biol. Chem., October 19, 2007; 282(42): 30804 - 30816.
[Abstract] [Full Text] [PDF]


Home page
IBMS BoneKEyHome page
M. M. McDonald, A. Schindeler, and D. G. Little
Bisphosphonate Treatment and Fracture Repair
IBMS BoneKEy, September 1, 2007; 4(9): 236 - 251.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Fiore, B. Castella, B. Nuschak, R. Bertieri, S. Mariani, B. Bruno, F. Pantaleoni, M. Foglietta, M. Boccadoro, and M. Massaia
Enhanced ability of dendritic cells to stimulate innate and adaptive immunity on short-term incubation with zoledronic acid
Blood, August 1, 2007; 110(3): 921 - 927.
[Abstract] [Full Text] [PDF]


Home page
PediatricsHome page
R. G. G. Russell
Bisphosphonates: Mode of Action and Pharmacology
Pediatrics, March 1, 2007; 119(Supplement_2): S150 - S162.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. J. Roelofs, K. Thompson, S. Gordon, and M. J. Rogers
Molecular mechanisms of action of bisphosphonates: current status.
Clin. Cancer Res., October 15, 2006; 12(20): 6222s - 6230s.
[Abstract] [Full Text] [PDF]


Home page
IBMS BoneKEyHome page
K. Thompson and M. J. Rogers
Bisphosphonates and {gamma}{delta} T-Cells: New Insights into Old Drugs
IBMS BoneKEy, August 1, 2006; 3(8): 5 - 13.
[Abstract] [Full Text] [PDF]


Home page
Journal of the American Dental AssociationHome page
J. B. Nase and J. B. Suzuki
Osteonecrosis of the jaw and oral bisphosphonate treatment.
J Am Dent Assoc, August 1, 2006; 137(8): 1115 - 1119.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
A. Ortiz-Gomez, C. Jimenez, A. M. Estevez, J. Carrero-Lerida, L. M. Ruiz-Perez, and D. Gonzalez-Pacanowska
Farnesyl Diphosphate Synthase Is a Cytosolic Enzyme in Leishmania major Promastigotes and Its Overexpression Confers Resistance to Risedronate.
Eukaryot. Cell, July 1, 2006; 5(7): 1057 - 1064.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. L. Kavanagh, K. Guo, J. E. Dunford, X. Wu, S. Knapp, F. H. Ebetino, M. J. Rogers, R. G. G. Russell, and U. Oppermann
The molecular mechanism of nitrogen-containing bisphosphonates as antiosteoporosis drugs
PNAS, May 16, 2006; 103(20): 7829 - 7834.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
K. Thompson, M. J. Rogers, F. P. Coxon, and J. C. Crockett
Cytosolic Entry of Bisphosphonate Drugs Requires Acidification of Vesicles after Fluid-Phase Endocytosis
Mol. Pharmacol., May 1, 2006; 69(5): 1624 - 1632.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
M. Caraglia, D. Santini, M. Marra, B. Vincenzi, G. Tonini, and A. Budillon
Emerging anti-cancer molecular mechanisms of aminobisphosphonates.
Endocr. Relat. Cancer, March 1, 2006; 13(1): 7 - 26.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Thompson, J. Rojas-Navea, and M. J. Rogers
Alkylamines cause V{gamma}9V{delta}2 T-cell activation and proliferation by inhibiting the mevalonate pathway
Blood, January 15, 2006; 107(2): 651 - 654.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. Inoue, T. Karashima, S. Fukata, A. Nomura, C. Kawada, A. Kurabayashi, M. Furihata, Y. Ohtsuki, and T. Shuin
Effect of Combination Therapy with a Novel Bisphosphonate, Minodronate (YM529), and Docetaxel on a Model of Bone Metastasis by Human Transitional Cell Carcinoma
Clin. Cancer Res., September 15, 2005; 11(18): 6669 - 6677.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
I. R. Reid, P. Miller, K. Lyles, W. Fraser, J. P. Brown, Y. Saidi, P. Mesenbrink, G. Su, J. Pak, K. Zelenakas, et al.
Comparison of a Single Infusion of Zoledronic Acid with Risedronate for Paget's Disease
N. Engl. J. Med., September 1, 2005; 353(9): 898 - 908.
[Abstract] [Full Text] [PDF]


Home page
The Annals of PharmacotherapyHome page
A. A Licata
Discovery, Clinical Development, and Therapeutic Uses of Bisphosphonates
Ann. Pharmacother., April 1, 2005; 39(4): 668 - 677.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Abe, K. Hiura, J. Wilde, A. Shioyasono, K. Moriyama, T. Hashimoto, S. Kido, T. Oshima, H. Shibata, S. Ozaki, et al.
Osteoclasts enhance myeloma cell growth and survival via cell-cell contact: a vicious cycle between bone destruction and myeloma expansion
Blood, October 15, 2004; 104(8): 2484 - 2491.
[Abstract] [Full Text] [PDF]


Home page
J Clin PharmacolHome page
J. Barrett, E. Worth, F. Bauss, and S. Epstein
Ibandronate: A Clinical Pharmacological and Pharmacokinetic Update
J. Clin. Pharmacol., September 1, 2004; 44(9): 951 - 965.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
J. R. Green
Bisphosphonates: Preclinical Review
Oncologist, September 1, 2004; 9(suppl_4): 3 - 13.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
A. L. Langston and S. H. Ralston
Management of Paget's disease of bone
Rheumatology, August 1, 2004; 43(8): 955 - 959.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
J. Berenson and R. Hirschberg
Safety and Convenience of a 15-Minute Infusion of Zoledronic Acid
Oncologist, June 1, 2004; 9(3): 319 - 329.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Bezzi, M. Hasmim, G. Bieler, O. Dormond, and C. Ruegg
Zoledronate Sensitizes Endothelial Cells to Tumor Necrosis Factor-induced Programmed Cell Death: EVIDENCE FOR THE SUPPRESSION OF SUSTAINED ACTIVATION OF FOCAL ADHESION KINASE AND PROTEIN KINASE B/Akt
J. Biol. Chem., October 31, 2003; 278(44): 43603 - 43614.
[Abstract] [Full Text] [PDF]


Home page
Palliat MedHome page
H L Neville-Webbe and R E Coleman
The use of zoledronic acid in the management of metastatic bone disease and hypercalcaemia
Palliative Medicine, September 1, 2003; 17(6): 539 - 553.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
A. Montalvetti, A. Fernandez, J. M. Sanders, S. Ghosh, E. Van Brussel, E. Oldfield, and R. Docampo
Farnesyl Pyrophosphate Synthase Is an Essential Enzyme in Trypanosoma brucei. IN VITRO RNA INTERFERENCE AND IN VIVO INHIBITION STUDIES
J. Biol. Chem., May 2, 2003; 278(19): 17075 - 17083.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
H.-J. Gober, M. Kistowska, L. Angman, P. Jeno, L. Mori, and G. De Libero
Human T Cell Receptor {gamma}{delta} Cells Recognize Endogenous Mevalonate Metabolites in Tumor Cells
J. Exp. Med., January 20, 2003; 197(2): 163 - 168.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. Adam, S. Hecht, W. Eisenreich, J. Kaiser, T. Grawert, D. Arigoni, A. Bacher, and F. Rohdich
Biosynthesis of terpenes: Studies on 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate reductase
PNAS, September 17, 2002; 99(19): 12108 - 12113.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
P. P. Lehenkari, M. Kellinsalmi, J. P. Napankangas, K. V. Ylitalo, J. Monkkonen, M. J. Rogers, A. Azhayev, H. K. Vaananen, and I. E. Hassinen
Further Insight into Mechanism of Action of Clodronate: Inhibition of Mitochondrial ADP/ATP Translocase by a Nonhydrolyzable, Adenine-Containing Metabolite
Mol. Pharmacol., May 1, 2002; 61(5): 1255 - 1262.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. P. Coxon, M. H. Helfrich, B. Larijani, M. Muzylak, J. E. Dunford, D. Marshall, A. D. McKinnon, S. A. Nesbitt, M. A. Horton, M. C. Seabra, et al.
Identification of a Novel Phosphonocarboxylate Inhibitor of Rab Geranylgeranyl Transferase That Specifically Prevents Rab Prenylation in Osteoclasts and Macrophages
J. Biol. Chem., December 14, 2001; 276(51): 48213 - 48222.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Montalvetti, B. N. Bailey, M. B. Martin, G. W. Severin, E. Oldfield, and R. Docampo
Bisphosphonates Are Potent Inhibitors of Trypanosoma cruzi Farnesyl Pyrophosphate Synthase
J. Biol. Chem., August 31, 2001; 276(36): 33930 - 33937.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dunford, J. E.
Right arrow Articles by Rogers, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dunford, J. E.
Right arrow Articles by Rogers, M. J.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition