Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

Lung fibrosis is a pathological process characterized by the replacement of normal tissue by mesenchymal cells and the extracellular matrix produced by these cells. A number of studies have documented that cytokines are released in the lungs of patients with pulmonary fibrosis as well as in animal models of this disease. Inflammatory cells such as macrophages, lymphocytes, and neutrophils play a key role in production of a variety of cytokines and growth factors that regulate the proliferation, chemotactism, and secretary activity of the fibroblasts. Activated macrophages in inflamed lungs in response to bleomycin (BL) instillation synthesize increased amounts of several cytokines, including interleukin (IL)-1, IL-1, IL-6, platelet-derived growth factor, transforming growth factor (TGF)-, TGF-, basic fibroblast growth factor, insulin like growth factor, tumor necrosis factor (TNF)-, and monocyte chemoattractant protein (MCP)-1 that mediate an enhanced fibroproliferative response (Scheule et al., 1992; Khalil and O'Connor, 1995). The roles of these cytokines in the pathophysiology of BL-induced lung inflammation have been extensively studied. It is commonly understood that not a single cytokine but a network of cytokines controls the inflammatory processes (Smith et al., 1996).

In the BL-rodent model of lung fibrosis, proinflammatory mediators such as IL-1, IL-6, and TNF- are found initially in the airway and alveoli with subsequent increases in the expression of MCP-1 and macrophage inhibitory protein-1 in alveolar macrophages and airway epithelial cells (Piguet et al., 1989, 1994; Smith et al., 1994). During this process, arachidonic acid metabolites and reactive oxygen species also are generated from resident macrophages and newly recruited neutrophils, which contribute to the BL-induced airway epithelial cell injury (Giri and Witt, 1985). As time progresses, the chemoattractants, MCP-1, and macrophage inhibitory protein-1 facilitate recruitment and activation of specific subsets of lymphocytes, eosinophils, and macrophages in the alveolar space. These cells in turn secrete cytokines such as TGF- that is capable of stimulating the proliferation of myofibroblasts and up-regulating the procollagen gene expression. The macrophages, lymphocytes, and myofibroblasts present in the BL-induced established fibrotic lesions stimulate one another and thus initiate and maintain an excess collagen synthesis via a complex network of chemokines and other soluble proinflammatory substances (Smith et al., 1996).

Other studies indicate that the regulation of these cytokines in macrophages is controlled, at least in part, at the level of gene transcription. Many cytokine genes are regulated in part by nuclear factor-B (NF-B), a widely distributed transcription factor that is normally sequestered in the cytoplasm as an inactive multiunit complex bound to an inhibitory protein, IB (Baeuerle and Henkel, 1994). Several agents are found to activate this complex by causing phosphorylation and degradation of IB and translocation of the active dimer of NF-B into the nucleus, where it binds to the promoter region of genes such as IL-1, IL-6, and TNF- containing the NF-B motif and stimulates the expression of these genes. The generation of reactive oxygen species (ROS) has been associated with NF-B activation by a variety of stimuli (Bauerle and Henkel, 1994). All these events represent possible strategic points for investigation of the mechanisms for unremitting fibrotic lung diseases as well as potential targets for therapeutic intervention.

Our laboratory has consistently demonstrated that the combined treatment with taurine (T) and niacin (N) minimizes the BL-induced increased accumulation of collagen in the lung in a three-dose BL-hamster model of lung fibrosis (Wang et al., 1991; Gurujeyalakshmi et al., 1996). The molecular basis for a reduction in the collagen content by taurine and niacin treatment partly resides in their ability to down-regulate the BL-induced overexpression of procollagen I and III mRNAs at the transcriptional level. This is preceded by down-regulation of TGF- mRNA and TGF- protein as demonstrated in our earlier studies (Gurujeyalakshmi et al., 1996, 1998). The present study was conducted to develop a better understanding of the role of proinflammatory mediators such as IL-1, TNF-, IL-6, and TGF- in the pathogenesis of BL-induced lung fibrosis in mice with and without taurine and niacin treatment. Because BL-induced inflammation in rodents is mediated by the production of ROS (Caspary et al., 1982), we hypothesized that the involvement of cytokines in BL-induced lung injury is due to activation of NF-B. To test this hypothesis, we investigated the effects of saline (SA) or BL instillation on NF-B activation, IB levels, and changes in cytokines mRNA and protein levels during the course of development of lung fibrosis in mice with and without taurine and niacin treatment. Our results demonstrate that the effects of combined treatment with taurine and niacin depends on their ability to suppress the BL-induced activation of NF-B and increased production of proinflammatory and fibrogenic cytokines such as IL-1, TNF-, IL-6, and TGF-.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

Animal Model. A single-dose BL-mouse model of acute lung injury that eventuates into fibrosis has been previously established in our laboratory and the same model was used in the present study (Giri et al., 1986). Briefly, all experiments were carried out in male C57BL/6 mice weighing 25 to 28 g (Simonsen, Gilroy, CA). Animals were caged in groups of four or five in Animal Resource Services facilities approved by the American Association for the Accreditation of Laboratory Animal Care and allowed to acclimatize for 1 week before the start of this project. The mice had access to water and either pulverized Rodent Laboratory Chow 5001 (Purina Mills, St. Louis, MO) or the same pulverized chow containing 2.5% niacin (w/w) and 1% taurine in water. Animals were randomly divided into four experimental groups: SA-instilled with a control diet (CD) and drinking water (SA + CD); SA-instilled with taurine in drinking water and niacin in diet (SA + TN); BL-instilled with the control diet and drinking water (BL + CD); and BL-instilled with taurine in drinking water and niacin in diet (BL + TN). The animals were fed these diets starting 3 days before the intratracheal (IT) instillation and continuing through out the course of the experiment. After mice were anesthetized with ketamine and xylazine, either 50 µl of sterile isotonic saline or 0.1 U of bleomycin sulfate in 50 µl of saline per mouse was IT instilled.

Bronchoalveolar Lavage Fluid (BALF) Collection and Lung Processing. The mice were sacrificed by an overdose of sodium pentobarbital at 1, 3, 5, 7, 14, and 21 days after IT instillation and bronchoalveolar lavage was carried out as previously described (Giri et al., 1981). Briefly, the lung was lavaged with 1 ml of isotonic sterile saline four times. The recovery of the lavaged fluid ranged from 3.0 to 3.6 ml. After the lavage, the lung was dissected out, freeze clamped, and stored at 80°C. The BALF was centrifuged at 4°C for 10 min at 1500 rpm. The supernatant was gently aspirated and stored at 80°C until used for cytokine assays. In another set, the animals were sacrificed by decapitation and their lungs were quickly removed, freeze clamped and dropped in liquid N₂, and later stored at 80°C until used for mRNA analysis.

RNA Extraction and Reverse Transcription-Polymerase Chain Reaction (RT-PCR). Total RNA from the lung was isolated with the RNeasy total RNA extraction protocol (Qiagen, Chatsworth, CA) according to the manufacturer's description. The PCR primers for GAPDH, IL-1, and TNF- in message amplification and phenotyping analysis of cytokine mRNAs were obtained from Clontech Laboratories (Palo Alto, CA). The following 5'-primer and 3'-primer sequences were used: GAPDH: (5') primer 5' TGAAGGTCGGTGTGAACGGATTTGGC 3' and (3') primer 5' CATGTAGGCCATGAGGTCCACCAC 3'; IL-1: (5') primer 5' AAGATGTCCAACTTCACCTTCAAGGAGAGCCG 3' and (3') primer 5' AGGTCGGTCTCACTACCTGTGATGAGTTTTGG 3'; and TNF-: (5') primer 5' TTCTGTCTACTGAACTTCGGGGTGATCGGTCC 3' and (3') primer 5' GTATGAGATAGCAAATCGGCTGACGGTGTGGG 3'.

Determination of IL-1, TNF-, IL-6, and TGF- in BALF. IL-1, TNF-, IL-6, and TGF- were assayed by specific enzyme-linked immunosorbent assay from Genzyme (Cambridge, MA). The sensitivities of the assay for different cytokines were as follows: IL-1, 15 pg/ml; TNF-, 15 pg/ml; IL-6, 5 pg/ml; and TGF-, 50 pg/ml.

Lung Hydroxyproline Content. Collagen deposition was estimated by determining the hydroxyproline content of the whole lung. The lung was excised, homogenized, and hydrolyzed in 6 N HCl for 16 to 18 h at 110°C. Hydroxyproline content was assessed by the colorimetric method of Woessner (1961). Data are expressed as micrograms of hydroxyproline per lung.

Protein Assay and Tissue Protein Extraction. Total proteins extracted from the lung were determined by the coomassie blue-dye binding assay (Bio-Rad). For tissue protein extraction, frozen tissue samples were minced and homogenized in protein extraction buffer (20 mM HEPES, pH 7.5, 1.5 mM magnesium chloride, 0.2 mM EDTA, 100 mM sodium chloride, 2 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride). The homogenized samples were transferred to a microfuge tube, adjusted to a final concentration of 0.4 M sodium chloride, and centrifuged at 9000g at 4°C for 30 min. The supernatants were collected and added to an equal volume of protein extraction buffer containing 20% glycerol and 0.4 M sodium chloride (Choi et al., 1995). Protein concentrations of the tissue extracts were determined by the Bio-Rad reagent (Bio-Rad).

Electrophoretic Mobility Shift Assay. NF-B activity in lung nuclei of BL-instilled mice in BL + CD and BL + TN groups was determined by electrophoretic mobility shift assays with the Promega gel shift assay system (Promega, Madison, WI). DNA-binding activity was determined after incubation of 20 µg of tissue proteins at room temperature for 20 min with ³²P-labeled double stranded oligonucleotide containing the NF-B (5'-AGTTGAGGGGACTTTCCCAGGC-3')-binding motif. The incubation mixture included 50 µg/ml of poly(dI-dC) in a binding buffer (4% glycerol, 0.5mM EDTA, 0.5mM dithiothreitol, 1 mM MgCl₂, 50 mM NaCl, 10 mM Tris-HCl, pH 8.0). The DNA/protein complexes were analyzed on 6% polyacrylamide gels in 0.5× Tris/Borate/EDTA buffer (0.0445 Tris, 0.0445 M borate, 0.001 M EDTA). The specificity of binding was determined by the addition of an excess amount of the same unlabeled oligonucleotide (100-fold). Nonspecific competitions were similarly performed with an unlabeled oligonucleotide probe encompassing an activator protein-2 (AP-2) transcription factor site. The gels were autoradiographed on X-ray film.

Western Blot Analysis. Whole-lung tissue was homogenized in lysis buffer (10 mM HEPES, pH 7.9, 150 mM NaCl, 1 mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, 1 µg/ml aprotenin, and 1 µg/ml pepstatin) on ice. Homogenates were centrifuged at 9000g at 4°C for 30 min to remove cellular debris. IB proteins were immunoprecipitated from lung homogenates with agarose conjugates specific for IB (Santa Cruz Biotechnology, Santa Cruz, CA). Protein concentrations were determined as described for nuclear extracts. Total cellular protein (200 µg) was immunoprecipitated with 10 µg of IB antibody-agarose conjugate. Immunoprecipitates were processed according to the manufacturer's instructions. Aliquots of immunoprecipitates were separated on SDS-polyacrylamide gel electrophoresis gels (4-20% Tris-glycine minigels) and transferred to polyvinylidene difluoride membrane and immunoblotted as described previously (Gurujeyalakshmi et al., 1999). Nonspecific binding sites were blocked with Tris-buffered saline-Tween (TBS-T) (100 mM Tris, 0.9% NaCl, pH 7.5, 0.1% Tween 20) and 5% nonfat dry milk at room temperature for 18 h. Membranes were then incubated in a 1:1000 dilution of a rabbit polyclonal anti-IB (Santa Cruz Biotechnology) in TBS-T. After four washes in TBS-T, membranes were incubated in a 1:5000 dilution of horseradish peroxidase-conjugated anti-rabbit IgG (Santa Cruz Biotechnology). Immunoreactive IB proteins were detected by enhanced chemiluminescence. IB protein was quantitated on a scanning densitometer (model CS-9301 PC; Shimadzu Scientific Instruments, Columbia, MD).

Statistics. Treatment-related differences were evaluated with a two-way ANOVA, followed by pairwise comparisions with the Newman-Keuls test. Statistical significance was considered at the P values of .05.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

Hydroxyproline Content of Lungs. Having demonstrated that the combined treatment with taurine and niacin reduces lung injury and fibrosis in the BL-hamster model of lung fibrosis (Wang et al. 1991; Gurujeyalakshmi et al., 1996), we performed studies to determine whether treatment with this combination also attenuates BL-induced lung injury and fibrosis in mice. We evaluated lung levels of hydroxyproline content, a marker of collagen deposition, in whole-lung homogenates. There were significant increases in the lung hydroxyproline content in mice in BL + CD groups at 14 and 21 days after BL instillation compared with the mice in either saline control (SA + CD and SA + TN) groups; and treatment with taurine and niacin significantly attenuated these increases in BL + TN groups compared with their respective BL + CD groups at both time points (Fig. 1).

View larger version (47K): [in this window] [in a new window]   Fig. 1.   Effects of IT instillation of saline or BL (0.1 U/mouse) with or without 1% taurine in drinking water and 2.5% niacin (w/w) in diet on hydroxyproline content of mouse lungs at different times after instillation. See Materials and Methods for treatment details. Each value represents the mean ± S.E. of five animals. *, significantly higher (P  .05) than all other groups at the corresponding times, and +, significantly lower than the BL + CD group at the corresponding time.

Levels of Cytokines in BALF. To test the hypothesis that treatment with taurine and niacin alters cytokine release during the course of BL-induced lung fibrosis, we evaluated the release or secretion of proinflammatory cytokines IL-1, TNF-, IL-6, and TGF- in the BALF (Fig. 2). Enzyme-linked immunosorbent assay was used to determine the time course of the release for these cytokines in the BALF from mice in SA + CD, BL + CD, and BL + TN groups. IL-1 protein levels in the BALF from BL-treated mice in BL + CD groups were increased significantly by 2- and 3-fold at 3 and 5 days compared with the corresponding SA + CD control groups, respectively. Thereafter, the levels declined to the control levels and stayed that way for the remaining part of the study (Fig. 2A). Treatment with taurine and niacin prevented the BL-induced increases in IL-1 protein levels in the BALF from mice in BL + TN groups at 3 and 5 days and thereafter the protein levels returned to the control values. The TNF- protein levels in the BALF from BL-treated mice in BL + CD groups continued to remain elevated from day 1 through day 21 compared with the corresponding SA + CD control groups and significant increases occurred at all times except the initial two time points (Fig. 2B). Treatment with taurine and niacin decreased BL-induced increases in TNF- levels almost at all time points but significant decreases occurred only at 7 and 21 days in BL + TN groups compared with BL + CD groups at the corresponding times. The IL-6 levels were significantly elevated starting day 1 through day 5 in the BALF from mice in BL + CD groups compared with mice in SA + CD groups at the corresponding times. Although treatment with taurine and niacin decreased the IL-6 levels at these times in BL + TN groups compared with BL + CD groups at the corresponding times, significant decrease between the two groups occurred only at day 5 (Fig. 2C). Compared with SA + CD control groups, the TGF- protein levels in BALF were significantly increased in BL + CD groups at the corresponding times by 3-, 14-, 3.4-, and 7.9-fold at 5, 7, 14, and 21 days after IT instillation of BL, respectively (Fig. 2D). Treatment with taurine and niacin decreased the BL-induced increases in the TGF- levels in BL + TN groups at these time points by 40, 57, 40, and 47% compared with BL + CD groups at the corresponding time points, respectively. And the decreases were significant at the last three time points (Fig. 2D).

View larger version (41K): [in this window] [in a new window]   Fig. 2.   Effects of combined treatment with taurine and niacin on cytokine levels in the BALF of mice receiving IT instillation of either saline or BL at different times. See Materials and Methods for treatment details. Each value represents the mean ± S.E. of five animals. *, significantly higher (P  .05) than all other groups at the corresponding times, and +, significantly lower than the BL + CD groups at the corresponding times. A, IL-1; B, TNF-; C, IL-6; and D, TGF-.

Effects of Taurine and Niacin on IL-1 and TNF- mRNA Expression. RT-PCR analysis was carried out to evaluate the effects of treatment with taurine and niacin on the steady-state level of IL-1 and TNF- mRNAs in the lungs from mice in SA + CD, BL + CD, and BL + TN groups. The increases in IL-1 mRNA levels occurred in BL + CD groups from day 1 through day 14 but significant increases were seen only at day 7 and day 14 compared with SA + CD groups at the corresponding times (Fig. 3). Although, treatment with taurine and niacin decreased the message levels in BL + TN groups from day 3 through day 14, significant decrease occurred only at day 7 compared with mice in BL + CD groups at this time (Fig. 3). The TNF- message levels were significantly increased in lungs from mice in BL + CD groups from day 1 through day 14 compared with mice in SA + CD groups at the corresponding times, and treatment with taurine and niacin significantly decreased the TNF- mRNA in the BL + TN group only at day 7 compared with the BL + CD group at this time (Fig. 4).

View larger version (49K): [in this window] [in a new window]   Fig. 3.   Effects of combined treatment with taurine and niacin on steady-state levels of IL-1  mRNA in lungs of mice receiving IT instillation of either saline or BL at different times. RNA was isolated and RT-PCR was performed with primers specific for IL-1 and the housekeeping gene GAPDH. See Materials and Methods for treatment details. Each value represents the mean ± S.E. of five animals. *, significantly higher (P  .05) than all other groups at the corresponding times, and +, significantly lower than the BL + CD group at the corresponding time.

View larger version (58K): [in this window] [in a new window]   Fig. 4.   Effects of combined treatment with taurine and niacin on steady-state levels of TNF- mRNA in lungs of mice receiving IT instillation of either saline or BL at different times. RNA was isolated and RT-PCR was performed with primers specific for TNF- and the housekeeping gene GAPDH. See Materials and Methods for treatment details. Each value represents the mean ± S.E. of five animals. *, significantly higher (P < .05) than all other groups at the corresponding times, and +, significantly lower than the BL + CD group at the corresponding time.

Activation of NF-B during BL-Induced Lung Injury and Fibrosis. The specificity of the NF-B consensus oligonucleotide probe was first confirmed by experiments with nuclear extracts from whole lungs of mice at 5 days after BL instillation (Fig. 5). In DNA-binding reactions, nuclear extract from lungs of BL-treated mice was incubated with only ³²P-labeled NF-B consensus oligonucleotide probe and it showed typical binding to the labeled oligonucleotide (Fig. 5A) (lanes 1 and 2). Competition with excess amount of unlabeled AP-2 oligonucleotide (100-fold) showed no reduction of NF-B binding (lane 3), whereas competition with an excess amount of unlabeled NF-B oligonucleotide (100-fold) completely prevented NF-B binding to the labeled probe. Thus, it confirmed the signal specific to NF-B (lane 4). The DNA-binding reaction with nuclear extracts from the lungs of mice in SA + CD control groups also was carried out in the same way (gel picture not shown).

View larger version (120K): [in this window] [in a new window]   Fig. 5.   Demonstration of specificity of NF-B consensus oligonucleotide gel shift assays. Binding reactions with nuclear extracts from whole lungs harvested 5 days after BL instillation. The extracts were incubated with 32P-labeled NF-B oligonucleotide (lanes 1 and 2). Specificity of NF-B complex formation was confirmed by competition experiments with a 100-fold excess of unlabeled AP-2 oligonucleotide (lane 3) or unlabeled NF-B oligonucleotide (lane 4).

View larger version (58K): [in this window] [in a new window]   Fig. 6.   Effects of combined treatment with taurine and niacin on the kinetics of NF-B activation in lungs of mice receiving IT instillation of either saline or BL at different times. A, nuclear extracts were obtained from mouse lungs at the indicated time points and analyzed for NF-B activity with a 22-mer double-stranded oligonucleotide probe containing a NF-B site. Each lane represents lung nuclear extracts from the SA + CD, BL + CD, or BL + TN group. FP, free probe. Arrowhead represents NF-B complex. This gel is a representative of three independent experiments. See Materials and Methods for treatment. B, time course of densitometric scanning of the band shift data as percentage of maximum of NF-B binding activity. Each value represents the mean ± S.E. of three animals. *, significantly higher (P  .05) than the corresponding SA + CD groups, and +, significantly lower than the corresponding BL + CD groups.

Preservation of IB Protein by Taurine and Niacin Treatment. Because treatment with taurine and niacin inhibited the NF-B activation in whole lungs of mice receiving IT BL (Fig. 6, A and B), we determined if the protective effects of these compounds against BL-induced lung injury might be related to their effects in preserving IB, the NF-B regulatory protein. Western blot analysis of whole-lung homogenates revealed that IB protein levels were elevated in BL + TN groups compared with BL + CD and SA + CD groups (Fig. 7). Although, a marginal level of IB was detected in SA + CD groups, the IB protein levels were completely depleted in BL + CD groups, indicating that NF-B activation in BL + CD groups occurred via IB degradation. In contrast, treatment with taurine and niacin in BL + TN groups protected the IB degradation, which in turn, prevented the translocation of NF-B from the cytoplasm to the nucleus. These results suggest that treatment with taurine and niacin prevented the BL-induced NF-B activation in BL + TN groups through preserving the IB protein. This may, in part, explain for the reduced levels of fibrogenic cytokines, in general, in the BALF from mice in BL + TN groups compared with mice in BL + CD groups as found in the present study.

View larger version (20K): [in this window] [in a new window]   Fig. 7.   Effects of combined treatment with taurine and niacin on the IB protein expression in the lungs of mice receiving IT instillation of either saline or BL at different times. Western blot analysis shows a time-dependent increased preservation in the IB levels in BL + TN groups as opposed to depletion in BL + CD groups. This gel is representative of three independent experiments. See Materials and Methods for treatment details.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

In an earlier study, we reported that treatment with taurine and niacin inhibits the expression of procollagen I and procollagen III genes at the transcription level in the BL-hamster model of lung fibrosis (Gurujeyalakshmi et al., 1996). Subsequently, we reported that this treatment also inhibits the synthesis of TGF- mRNA and TGF- protein in the same model of lung fibrosis (Gurujeyalakshmi et al., 1998). We suggested that TGF-₁ plays a critical role in the down-regulation of BL-induced overexpression of procollagen I and III genes by taurine and niacin treatment in this model. The data presented in this report demonstrate that taurine and niacin treatment significantly attenuates BL-induced lung injury and fibrosis not only in hamsters but also in mice as reflected by decreased content of the lung hydroxyproline, an index of fibrosis.

The results of the present study demonstrate that taurine and niacin treatment suppressed the BL-induced increased levels of inflammatory cells-derived fibrogenic cytokines such as IL-1, IL-6, TNF-, and TGF-.These results are consistent with the results reported by other investigators that the release of proinflammatory cytokines plays a central role in the BL-induced lung fibrosis (Piguet et al., 1989; Phan and Kunkel, 1992; Scheule et al., 1992); and the ability of the combined treatment with taurine and niacin to suppress the BL-induced release of these cytokines may constitute one of the possible mechanisms for their antifibrotic effects as demonstrated in the present study.

We postulated that the beneficial effects of the combined treatment with taurine and niacin against BL-induced lung inflammation and fibrosis reside in their ability to inhibit the NF-B activation and to thereby suppress the production of proinflammatory and fibrogenic cytokine genes. This was based on the documented effects of antioxidants to suppress cytokine gene activation via inhibiting the activation of NF-B in vitro (Phan and Kunkel, 1992; Collins et al., 1995; Nathens et al., 1997). To elucidate the involvement of this mechanism, we have quantified the levels of some proinflammatory cytokines in the BALF from mice in all experimental groups with and without taurine and niacin treatment. It is interesting that this treatment generally decreased the BL-induced increased levels of IL-1, TNF-, IL-6, and TGF- in the BALF from mice in BL + TN groups compared with mice in BL + CD groups. The data presented in this paper confirm our previous findings that dietary intake of taurine and niacin down-regulates the BL-induced over expression of TGF- mRNA and TGF- protein in hamsters (Gurujeyalakshmi et al., 1996). In addition, it demonstrates the inhibitory effects of these compounds on BL-induced increases on other fibrogenic cytokines, including IL-1, TNF-, and IL-6 in mice in BL + TN groups. These findings have special significance with respect to IL-1 and TNF- because BL-induced lung injury is associated with the overexpression of their genes and antioxidants are shown to down-regulate the expression of these genes in vitro (Leff et al., 1993; Park et al., 1995).

Our in vivo data are consistent with the above-mentioned findings because the BL-treated mice had higher levels of IL-1 and TNF- mRNAs in the BL + CD groups than in the saline control groups. It is interesting that treatment with taurine and niacin down-regulated the BL-induced overexpression of IL-1 and TNF- mRNAs and proteins at varying time points without any definite pattern, in the BL + TN groups. We also found a higher level of IL-6 at the early time points in the BALF from BL-treated mice in BL + CD groups than in the saline control groups; and treatment with taurine and niacin suppressed the BL-induced increases in the IL-6 levels of BALF from mice in BL + TN groups.

The measurement of cytokine levels in the BALF has provided valuable information in demonstrating the expression of early response (IL-1, IL-6, and TNF-) and late response (TGF-) cytokines secondary to activation of NF-B and this may be one of the underlying mechanisms for BL-induced lung inflammation and fibrosis. Furthermore, studies using antibodies against TGF-, TNF-, or their soluble receptors demonstrated an amelioration of BL-induced lung fibrosis (Giri et al. 1993; Piguet and Vesin, 1994; Wang et al. 1999). Thus, the ability of taurine and niacin to suppress the BL-induced increased production of these cytokines secondary to their inhibitory effects on BL-induced NF-B activation in BL + TN groups provides a mechanistic basis for their antiinflammatory and antifibrotic effects as found in this study.

A number of cytokines have been implicated in the pathogenesis of lung fibrosis, including TGF-, TNF-, platelet-derived growth factor, insulin-like growth factor-1, endothelin-1, and the interleukins (Coker and Laurent, 1995). New therapeutic approaches have been exploited to suppress the functions of these cytokines to control the progression of lung fibrosis, including 1) the use of natural inhibitors of cytokines such as the IL-receptor antagonist (IL-1ra); 2) soluble receptors and blocking antibodies that bind the cytokines and prevent their interactions with receptors on cells; 3) antiproteases that block the enzymes needed to convert a synthesized cytokine to its active form; 4) cytokines inhibiting the expression of other cytokines such as regulation of IL-1 gene expression by IL-4; and 5) gene therapy targeting at the inhibition of specific growth factors and cytokines (Hunninghake and Kalica, 1995). Therefore, the release of fibrogenic cytokines secondary to NF-B activation by oxidants that are generated during BL-induced lung inflammation (Tracey and Cerami, 1993; Rodenas et al., 1995) may dictate the clinical outcome of the lung fibrosis.

Binding sites for the NF-B family of transcription factors are found in the promoter and enhancer regions of a multitude of genes, including cytokines, chemokines, and growth factors that are known to be involved in the inflammatory response. Transcriptional activation of specific inflammatory cytokine genes such as IL-1, IL-6, IL-8, and TNF- is mediated by NF-B activation in various cell types under a wide range of conditions (Baeurle and Henkel, 1994). Transcription factors regulate cell development, differentiation, and growth by binding to specific DNA sites and controlling gene expression (Pabo and Saver, 1992). The two important requirements for gene regulation include transcription factor activation followed by binding of transcription factor to DNA. At the cellular level, NF-B activation and nuclear translocation occur on phosphorylation and subsequent removal of the inhibitory IB subunit (Didonato et al., 1995). In some cell lines, this has been shown to occur in response to elevated levels of reactive oxygen species (Schreck et al., 1992; Brennan and O'Neil, 1995; Barchowsky et al., 1996).

One of the widely accepted mechanisms for BL-induced lung injury is its ability to generate ROS. BL is known to bind to DNA/Fe²⁺ and form a complex (Caspary et al., 1982). This DNA/Fe²⁺/BL complex undergoes redox cycling and generates ROS such as superoxide and hydroxy radicals. The BL-induced generation of ROS will explain our finding of NF-B activation in the lungs of mice in BL + CD groups. This also will explain the inhibitory effect of taurine and niacin (taurine in particular) on BL-induced NF-B activation by scavenging ROS in BL + TN groups because taurine is known to scavenge ROS. It appears that the pathway for NF-B activation involves the degradation of its regulatory protein IB. This is based on our findings that the amount of IB, as analyzed by Western blot, was barely detectable in BL + CD groups as opposed to complete preservation of this protein in BL + TN groups.

It appears that the activation of NF-B plays a critical role in cytokine-mediated inflammation by up-regulating the transcription of a specific set of cytokine genes in response to IT instillation of BL in mice. However, it is not known how the activation of NF-B coordinates the differential production of these cytokines. The temporal sequence for production of various cytokines and their relative amounts in response to a fibrogenic dose of BL in mice are probably functions of interactions between NF-B and other transcription factors as well as factors independent of NF-B (Blackwell and Christman, 1997).

Organ-system dysfunction in a variety of inflammatory diseases appears to be determined either directly or indirectly by an overproduction of cytokine-mediated inflammation. For the purpose of intervening therapeutically in these diseases and modulating the entire cytokine network, it would be valuable to decipher mechanisms common to the production of many cytokines through transcriptional regulation of NF-B. Therefore, the elucidation of the functions of NF-B and other transcription factors may be fundamental to our understanding of the mechanisms of cytokine-mediated inflammation; and this also may provide novel therapeutic strategies for management of a number of inflammatory diseases.

Our data suggest that nuclear translocation of the transcription factor NF-B is important for BL-induced lung injury in mice (Fig. 6) and provide evidence for activation of NF-B being linked to BL-induced lung injury. Our data also indicate that activation of NF-B is critical for the initiation of inflammatory events in this model. The activation of NF-B is thought to occur secondary to the proteolytic degradation of IB, allowing free NF-B to translocate to the nucleus where it binds to specific promoter sequences and initiates gene transcription (Henkel et al., 1993). Our findings support a role for IB in vivo because activation of NF-B during BL-induced lung inflammation in BL + CD groups was accompanied by depletion of IB from the whole lungs (Fig. 7), presumably through proteolytic degradation. It has been reported that the nuclear translocation of NF-B in lung epithelial cells is stimulated by IL-1, TNF- (Ray and Kennard, 1993; Jany et al., 1995), phorbol esters (Jany et al., 1995; Newton et al., 1996), and asbestos (Janssen et al., 1995). Therefore, the nuclear translocation of NF-B after IT instillation of BL in mice and subsequent activation of proinflammatory cytokine genes as found in this study (TNF- and IL-1) are consistent with the transcriptional activation of proinflammatory cytokine genes via NF-B as found in the above-mentioned studies. The data reported in this article strongly suggest that the activation of NF-B in vivo is a necessary step in the production of early response cytokines such as IL-1 and TNF- in BL-induced lung inflammation. It is known that taurine offers protection against oxidant-induced lung injury by inhibiting production of nitric oxide and TNF-, which are directly linked to tissue injury (Schuller-Levis et al., 1994a,b). We now demonstrate that combined treatment with taurine and niacin suppresses the BL-induced NF-B activation in whole lungs and provide experimental evidence that this suppressive effect may be responsible for limiting the BL-induced lung inflammation and fibrosis in mice in BL + TN groups (Fig. 6). We also provide in vivo evidence for the first time that inhibition of NF-B activation by taurine and niacin is due to preservation of IB protein in whole-lung tissues (Fig. 7). It is not known whether taurine and niacin administered alone will produce similar effects. However, it should be noted that these two compounds were found to produce an antifibrotic effect independently in a single-dose BL-hamster model of lung fibrosis (Wang et al., 1989, 1990). Our findings are consistent with the findings of other in vitro and in vivo studies in which treatment with antioxidants such as N-acetyl cysteine (Leff et al., 1993), pyrrolidine dithiocarbamate (Nathens et al., 1997), epigallocatechin-3-gallate (Lin and Lin, 1997) were found to block the activation of NF-B by inhibiting the signal transduction-induced phosphorylation of IB. It has been demonstrated in several studies that activation of NF-B can often be prevented by antioxidants and has led to the prevailing theory that NF-B is an oxidant-sensitive transcription factor (Sun and Oberley, 1996).

In summary, we have provided evidence that the activation of transcription factor NF-B plays a central role in BL-induced lung injury and fibrosis in mice; and the anti-inflammatory and antifibrotic effects of the combined treatment with taurine and niacin may reside in their ability to suppress the NF-B activation by preserving the IB protein. The results of the present investigation also have uncovered a novel strategy to develop specific inhibitors of NF-B activation that might prove to be therapeutically efficacious for the management of inflammation and fibrosis in general. Thus, these studies have identified a novel mechanism for the in vivo anti-inflammatory and antifibrotic effects of taurine and niacin in the BL-mouse model.