![]() |
|
|
Vol. 291, Issue 1, 124-130, October 1999
Division of Rheumatology, Allergy, and Immunology, University of California at San Diego School of Medicine (Z.H., D.L.B., K.R.A., G.S.F.) , La Jolla, California; and Department of Inflammation, Signal Pharmaceuticals, Inc. (B.B., A.M.M.), San Diego, California
| |
Abstract |
|---|
|
|
|---|
Potential mechanisms of joint destruction in rheumatoid arthritis (RA) were examined by studying the regulation of mitogen-activated protein kinases and collagenase gene expression in fibroblast-like synoviocytes (FLS). The three main mitogen-activated protein kinase families [p38, Jun N-terminal kinase (JNK), and extracellular signal-regulated kinases (ERKs)] were constitutively expressed in RA and osteoarthritis (OA) FLS. p38 and ERK1/2 were readily phosphorylated in both RA and OA FLS after interleukin-1 (IL-1) stimulation. JNK was phosphorylated in RA FLS but not OA FLS after IL-1 stimulation. Reverse transcription-polymerase chain reaction studies suggested that JNK2 is the major isoform of the JNK family expressed by FLS. Northern blot analysis of collagenase gene expression demonstrated that RA FLS contained significantly more collagenase mRNA than OA FLS after IL-1 stimulation. The roles of JNK and p38 kinase were evaluated with the p38/JNK inhibitor SB 203580. Low concentrations of SB 203580 (1 µM, a concentration that only inhibits p38) had no significant effect on IL-1-induced collagenase expression in RA FLS whereas 25 µM (which inhibits p38, JNK2, and c-raf) blocked collagenase mRNA accumulation. IL-1-stimulated AP-1 binding was also inhibited by 25 µM SB 203580 in RA FLS. These studies suggest that OA and RA FLS have a different pattern of JNK phosphorylation, which might lead to enhanced collagenase gene expression in RA.
| |
Introduction |
|---|
|
|
|---|
Rheumatoid
arthritis (RA) is a chronic inflammatory arthritis marked by synovial
hyperplasia with local invasion of bone and cartilage. Accumulating
evidence suggests that RA fibroblast-like synoviocytes (FLS), which
form the leading destructive front of rheumatoid synovium, possess
unique characteristics. For instance, the rheumatoid cells proliferate
in an anchorage-independent manner, lack contact inhibition, and
constitutively produce increased amounts of growth factors (Kumkumian
et al., 1989
; Bucala et al., 1991
). Also, RA FLS that have been
implanted into SCID mice autonomously invade cartilage explants,
whereas osteoarthritis (OA) FLS do not (Muller-Ladner et al., 1996
).
These studies suggest that RA synoviocytes are permanently imprinted or
altered by the rheumatoid environment.
To explore the potential mechanisms of joint destruction, we evaluated
the signal transduction and transcription factor pathways involved in
collagenase gene expression by cultured FLS. Induction and activation
of the transcription factor activator protein-1 (AP-1) were of
particular interest (Karin et al., 1997
; Firestein and Manning,
1999
). AP-1 can be activated by protein kinases that phosphorylate specific amino acid residues, especially members of the
mitogen-activated protein kinase (MAPK) family. Three major MAPK
families have been identified: Jun N-terminal kinases (JNKs), extracellular signal-regulated kinases (ERKs), and the p38 kinases (Seger and Krebs, 1995
). JNK is particularly important due to its ability to phosphorylate c-Jun, a key AP-1 component (Minden and
Karin, 1997
). In this study, the role of MAPK phosphorylation with subsequent AP-1 activation and collagenase gene expression was
evaluated in interleukin-1 (IL-1)-stimulated FLS. Our data suggest that
IL-1-induced JNK phosphorylation is increased in RA and that this
pathway regulates collagenase gene expression. Hence, JNK
phosphorylation in RA is a potential mechanism for excessive
extracellular matrix destruction.
| |
Materials and Methods |
|---|
|
|
|---|
Patient Selection and Cell Preparation.
FLS were isolated
from RA and OA synovial tissues obtained at joint replacement surgery
as described previously (Alvaro-Gracia et al., 1990
). The diagnosis of
RA conformed to the 1987 revised American College of
Rheumatology criteria (Arnett et al., 1988
). Briefly, the
tissues were minced and incubated with 1 mg/ml collagenase in
serum-free Dulbecco's modified Eagle's medium (DMEM; Gibco, Grand
Island, NY) for 2 h at 37°C, filtered through a nylon mesh, extensively washed, and cultured in DMEM supplemented with 10% fetal
calf serum (Gibco, endotoxin content <0.006 ng/ml), penicillin, streptomycin, and L-glutamine in a humidified 5%
CO2 atmosphere. After overnight culture, nonadherent
cells were removed, and adherent cells were cultivated in DMEM plus
10% fetal calf serum. At confluence, cells were trypsinized, split at
a 1:3 ratio, and recultured in medium. Synoviocytes were used from
passages 3 through 9 in these experiments, during which time they were
a homogeneous population of FLS (<1% CD11b, <1% phagocytic, and
<1% Fc-gamma RII receptor-positive).
Western Blot Analysis.
Cells (5 × 106)
were incubated with medium, IL-1 (2 ng/ml), phorbol myristate acetate
(PMA, 20 ng/ml; Sigma, St. Louis, MO) or tumor necrosis factor
(TNF)-
(100 ng/ml; Boehringer Mannheim, Indianapolis, IN) for 15 min. Protein samples (25 µg/lane) from FLS were run on a 10%
SDS-polyacrylamide gel electrophoresis and transferred onto a
nitrocellulose membrane at 140 mA in 25 mM Tris-HCl pH 8.3, 192 mM
glycine, 50% methanol. Western blot analysis was performed using a
stress-activated protein kinase/JNK assay kit, a PhosphoPlus
MAPK antibody kit, and a PhosphoPlus p38 MAPK (Thr180/Tyr182) antibody
kit (New England BioLabs, Inc., Beverly, MA) according to the
manufacturer's instructions. Briefly, filters were blocked with
Tris-buffered saline plus 0.1% Tween 20 and 5% dry milk for 1 to 3 h. This was followed by incubation with the appropriate
antibody at 4°C overnight. The membrane was washed 3 times and
incubated with horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature. The proteins were visualized by chemiluminescence using hydrogen peroxide and luminol as a substrate
using Kodak X-AR film.
Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Detection of JNK Isoforms. Total RNA (5 µg) was used for RT reactions with random hexamer primers (GeneAmp RNA PCR Kit; Perkin Elmer, NJ) after PCR according to the Perkin-Elmer protocol. PCR products were visualized on 10% high-melting agarose gel with ethidium bromide. Upstream and downstream primer sequences (5' to 3') were as follows:
JNK1 CAATGGCTCTCAGCATCCATCATC; GACTAACCGACTCCCCATCC JNK2 GTAGCAACGCCACTCCTTCTCAG; GTCTGAATAGGGCAAGGCATTG JNK3 GCCTTTTGTCAGGGATTCG; CGTTTTCTGGGTGTGAAGACNorthern Blot Analysis.
FLS were incubated in the
presence of IL-1 (Boehringer Mannheim), IL-1 plus SB 203580 (Calbiochem, San Diego, CA), or medium for 18 h. Total RNA was
isolated using 1 ml of RNA STAT-60 (Tel Test, Friendswood, TX) per
4 × 106 cells. Equal amounts of RNA were fractionated
in a 1.2% agarose gel containing 5.5% formaldehyde. RNA was then
transferred to a nylon membrane using the turbo blotter system
(Schleicher & Schuell, Keene, NH) and cross-linked at 80°C for 60 min. The blots were prehybridized in 50% formamide, 5× saline-sodium
phosphate-EDTA (SSPE), 5× Denhardt's solution, 1% SDS, 200 µg/ml
ssDNA, and 50 µg/ml tRNA. The cDNA probes were denatured and labeled
by random-primed incorporation of [32P]dATP (Ambion,
Austin, TX) The probes were denatured at 100°C and the blots
hybridized overnight at 42°C. The membrane was washed in 2× SSPE and
0.1% SDS at 37°C and exposed to Kodak X-Omat AR film (Rochester, NY)
with an intensifying screen for 18 to 24 h at
80°C. Membranes
were then stripped by washing in 50% formamide, 1% SDS, and 2× SSPE
for 30 to 60 min at 65°C and reprobed as needed. Image analysis was
performed on digitized images using National Institutes of Health image software.
Preparation of Nuclear Extracts.
RA and OA FLS were
incubated with medium, IL-1 (2 ng/ml), or IL-1 plus SB 203580 (25-50
µM) for 1 h. The cells were then lysed with 1 ml buffer A (10 mM
HEPES pH 7.4, 1.5 mM MgCl2, 10 mM KCl, 1 mM dithiothreitol,
1 mM PMSF, and 0.1% NP-40), incubated on ice for 15 min, and
centrifuged at 8500g at 4°C. The supernatants were
discarded and the pellets resuspended in 4 ml of buffer A without
NP-40. The samples were centrifuged again and the supernatant was
discarded. Buffer C (100 µl; 25% glycerol, 20 mM HEPES pH 7.9, 0.42 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA pH 8.0, 1 mM
dithiothreitol, and 1 mM phenylmethylsulfonyl fluoride) was added to
the pellets and the samples were rocked at 4°C for 30 min.
Particulate matter was pelleted for 30 min at 4°C in a microfuge and
the supernatants were aliquoted and stored at
80°C.
Electrophoretic Mobility Shift Assay (EMSA).
The Bandshift
kit (Promega, Madison, WI) was used according to the manufacturer's
instructions. Consensus and control oligonucleotides (Santa Cruz
Biotechnology) were labeled by polynucleotide kinase incorporation of
[
-32P]ATP. Oligonucleotides sequences included the
AP-1 consensus (5' to 3') (CGCTTGATGACTTGGCCGGAA) or mutant binding
sequence (CGCTTGATGACTTGGCCGGAA) and the NF-
B consensus
(AGTTGAGGGGACTTTCCCAGGC) or mutant sequence (AGTTGAGGCGACTTTCCCAGGC).
After the oligonucleotide was radiolabeled, the nuclear extracts (4 µg of protein in 2 µl of nuclear extract) were mixed with 20 pmol
of the appropriate 32P-labeled consensus or mutant
oligonucleotide in a total volume of 20 µl for 30 min at room
temperature. The samples were then resolved on a 4% polyacrylamide
gel. The gel was transferred to Whatman paper, dried, and visualized by
autoradiography. Controls were performed in each case with mutant
oligonucleotides or cold oligonucleotides to compete with labeled sequences.
Statistical Analysis. Statistics were performed by paired or unpaired Student's t test unless otherwise stated. A comparison was considered statistically significant if p < .05.
| |
Results |
|---|
|
|
|---|
Time Course of JNK, ERK, and p38 Phosphorylation in RA FLS.
Preliminary studies were performed to evaluate MAPK regulation in
IL-1-activated FLS. Cells were stimulated with 2 ng/ml of IL-1 from 5 min to 6 h, and total and phosphorylated kinase levels were
evaluated by Western blot analysis. Figure
1 shows that 15 min was the optimal time
point for evaluating MAPK phosphorylation under these experimental
conditions. A dose response experiment with IL-1 (0.1-5 ng/ml) at that
time point demonstrated maximal phosphorylation at 0.5 to 1 ng/ml (data
not shown). Unless specified, cells were stimulated with 2 ng/ml of
IL-1 for 15 min in subsequent studies.
|
Phosphorylation Patterns of JNK, p38, and ERK in FLS.
RA and
OA FLS were subsequently incubated with 2 ng/ml of IL-1 for 15 min and
MAPK phosphorylation was determined by Western blot analysis. Figure
2 shows that each of the MAPKs was
expressed and that this short incubation had no significant effect on
the total amount of immunoreactive ERK, JNK, or p38 protein. The total amount of ERK, JNK, and p38 protein in RA FLS was not significantly greater than in OA FLS (n = 3 OA and RA FLS for ERK
and p38; n = 7 for RA and n = 6 OA for JNK, p > .10; see also Fig.
3 for additional JNK examples). Using
phospho-MAPK-specific antibodies, phosphorylated ERK1/2 and p38 were
detected after IL-1 stimulation in RA and OA FLS (n = 3 OA and RA FLS for ERK and p38; n = 7 for RA and
n = 8 OA for JNK). However, JNK phosphorylation was
detected in RA (7/7 different cell lines) but not OA FLS (1/8 cell
lines; p < .01 compared with RA by Fisher's exact
test). In subsequent time course studies, JNK phosphorylation in OA FLS
was not detected up to 60 min after IL-1 stimulation (data not shown).
|
|
(100 ng/ml) or PMA (20 ng/ml) as the
activation signal. As with IL-1, PMA rapidly induced JNK
phosphorylation in RA FLS (n = 3 each). One OA cell
line contained small amounts of immunoreactive phospho-JNK after PMA
stimulation (see Fig. 3A). Incubation of two additional OA FLS lines
and one RA FLS line with anisomycin (50-100 µM)-induced JNK
phosphorylation, confirming that the protein had the potential for
activation under some conditions in OA (see Fig. 3B). TNF-
induced a
small amount of phospho-JNK (the 46-kD isoform) in RA FLS but not in OA cells.
Relative Expression of JNK Isoforms in RA FLS.
The expression
of the three known JNK isoforms (JNK1, JNK2, and JNK3) was measured to
determine whether differential MAPK gene expression accounted for the
differences between OA and RA FLS. As noted above, the relative levels
of JNK protein were similar in RA and OA. This was confirmed at the
mRNA level and JNK2 was also identified the major isoform expressed
(see Fig. 4). Little or no JNK1 or JNK3
mRNA was detected under these conditions.
|
JNK Phosphorylation in RA and OA Synovium.
Our studies
suggested that JNK is activated by IL-1 in RA FLS and that it might be
a major pathway for AP-1 and collagenase gene regulation. To determine
whether this process occurs in vivo, JNK phosphorylation was determined
in extracts of intact RA and OA synovium. Figure
5 shows that phospho-JNK was detected in
the synovium of all RA synovium tested (n = 3) but
not in the OA tissue (n = 3).
|
Effect of SB 203580 on Collagenase Gene Expression.
Increased
JNK activation in RA FLS suggested that expression of genes regulated
by c-jun and AP-1 activation might be increased in RA. Therefore,
Northern blot analysis was performed to compare collagenase gene
expression in OA and RA FLS. Collagenase mRNA accumulation after IL-1
stimulation was significantly higher in RA FLS compared with OA FLS
(G3PDH-normalized absorbance = 0.967 ± 0.163 for RA
(n = 3) and 0.456 ± 0.110 for OA
(n = 4); p < .05). RA FLS were
then incubated in the presence of increasing concentrations of SB
203580. This compound, which is a potent inhibitor of p38 (IC50 = 70 nM; Cuenda et al., 1995
) also inhibits
1
and
2 isoforms of JNK2 (Whitmarsh et al., 1997
) as well as c-Raf (de
Laszlo et al., 1998
) at higher concentrations (10-25 µM). When SB
203580 was added at a concentration that completely inhibits p38 (1 µM), there was no significant effect on IL-1-induced collagenase gene expression in RA FLS (see Fig. 6)
(p > .10; n = 3 RA cell
lines). However, higher concentrations of SB 203580 that also inhibit JNK2 and c-raf suppressed IL-1-induced collagenase mRNA accumulation in
RA FLS (p < .05; n = 3). The
MEK1/2 inhibitor PD 98059 (100 µM; Dudley et al., 1995
), which blocks
ERK activation, also modestly decreased IL-1-induced collagenase gene
expression in FLS (absorbance for IL-1 = 0.499 ± 0.135;
absorbance for IL-1+PD 98059 = 0.283 ± 0.49;
n = 3 RA and 3 OA).
|
Effects of SB 203580 on IL-1-Induced AP-1 Activation.
Because
of the effects of SB 203580 on collagenase gene expression in FLS, its
ability to regulate AP-1 binding activity was determined in RA FLS by
EMSA (n = 4). RA FLS were incubated with IL-1 (2 ng/ml), IL-1 plus SB 203580 (25-50 µM), or medium alone for 1 h. Nuclear extracts were isolated and evaluated for AP-1 binding
activity. Figure 7 shows representative
experiments in which a small amount of AP-1 was constitutively
expressed by FLS and subsequently induced by IL-1. The IL-1-mediated
increase was partially blocked by SB 203580. In other experiments,
lower concentrations of SB 203580 (1 µM) had no effect on AP-1
binding (data not shown). Also, the compound had no effect on
IL-1-induced NF-
B activation in RA synoviocytes (data not
shown).
|
| |
Discussion |
|---|
|
|
|---|
The MAPKs are a family of kinases that respond to diverse stimuli
and are composed of parallel protein kinase cascades. In addition to
the JNKs (also called stress-activated protein kinases), there are two
other well-defined pathways: ERK1 and ERK2, also referred to as p42/p44
MAPKs, and the p38 kinases (Karin, 1998
). Activation of certain
cytokine receptors, growth factor receptor tyrosine kinases, and G
protein-coupled receptors activate the ERKs. p38 protein kinases are
induced by lipopolysaccharide, proinflammatory cytokines, and cellular
stresses like osmotic shock. The JNK proteins, which include three
different isoforms and two to four splice variants each (Casanova et
al., 1996
) are activated by a variety of stimuli, including UV
irradiation, protein synthesis inhibitors, and cytokines.
The MAPK families regulate a number of transcription factors, with
subsequent activation of matrix metalloproteinase (MMP) and cytokine
gene expression (Lee et al., 1994
). In light of the key role of these
inflammatory mediators in RA, we surmised that MAPKs are likely
important regulatory proteins in FLS. AP-1 is of particular interest
due to the promiscuous distribution of its binding site within the
upstream regulatory regions of MMP genes (including collagenase-1 and
collagenase-3; Rutter et al., 1997
; Pendas et al., 1997
). AP-1 is a
protein complex, including c-Jun and c-Fos, held together by a leucine
"zipper", in which residues of leucine interact with the homologous
region on its partner.
AP-1 activation is due to both transcriptional and post-translational
regulation. For instance, cytokine stimulation induces mRNA
accumulation for both the c-jun and c-fos genes
in cultured FLS (Boyle et al., 1997
). In addition, AP-1 proteins can be
activated by protein kinases that phosphorylate specific amino acid
residues (Minden et al., 1994
; Kallunki et al., 1994
). c-Jun is
phosphorylated at two N-terminal serines (amino acids 63 and 73) by two
closely related c-Jun amino-terminal kinases (JNK1 and JNK2). Recently, a third JNK (JNK3), which is primarily expressed in neural cells, has
also been identified (Gupta et al., 1996
). JNK2 binds c-Jun with
at least 25-fold higher affinity than JNK1 and may be the more
physiologically relevant activator of AP-1 in FLS (Kallunki et al.,
1994
). The N-terminal phosphorylation of c-Jun by JNKs enhances the
transcriptional activity 30-fold. Notably, JNK1 appears to be a key
regulator of Th1 differentiation in mice (Dong et al., 1998
).
To evaluate the potential role of MAPKs in RA, Western blot analysis was performed using specific antibodies for ERK, JNK, and p38. All three MAPK families were expressed by OA and RA FLS to a similar extent (both at the protein and mRNA levels). IL-1 induced rapid phosphorylation of ERK and p38 in both OA and RA FLS. Surprisingly, immunoreactive phospho-JNK was detected only in the IL-1-induced RA FLS even though OA and RA synoviocytes expressed similar amounts of JNK mRNA and protein. This suggests that the mechanism resides in a more proximal site in the MAPK cascade. The explanation is not likely due to variability in IL-1 receptor density because IL-1 readily induced phosphorylation of p38 and ERK pathways.
Like IL-1, PMA and TNF-
induced JNK phosphorylation in RA FLS
whereas less phosphorylated product was detected in OA FLS. In some OA
cell lines, PMA and anisomycin increased JNK phosphorylation, indicating that the protein can be activated under some culture conditions. The mechanism by which phorbol esters activate JNK is
distinct from IL-1 and involves activation of PKC-
in conjunction with calcineurin (Werlen et al., 1998
). The lower activity of TNF-
compared with IL-1 in RA cells is consistent with the observation that
TNF-
is a much weaker inducer of collagenase than IL-1 in synoviocytes (Firestein and Paine, 1992
) and that TNF-
primarily activates JNK1 in other types of fibroblasts (Westwick et
al., 1994
). The differences in JNK phosphorylation were also observed in synovial tissue, because phospho-JNK was detected in RA but not OA
synovium. Our observation of increased JNK phosphorylation in RA is
consistent with a recent study implicating JNK and AP-1 activation in
Fas-mediated apoptosis in RA but not OA synoviocytes (Okamoto et al.,
1997
). Taken together, these data suggest that RA synoviocytes
preferentially utilize the JNK pathway in response to a variety of
stimuli (including IL-1, TNF-
, Fas ligand, and phorbol esters)
compared with OA FLS.
RA synoviocytes are known to produce increased amounts of several
cytokines and growth factors compared with OA FLS (Firestein and
Zvaifler, 1990
). Our studies showed that collagenase gene expression is significantly greater in RA FLS, which is consistent with
these previous observations. The MAPK inhibitor SB 203580 was then used
to evaluate the mechanisms of enhanced collagenase expression. Although
primarily considered a p38 inhibitor, certain isoforms of JNK (namely,
JNK2
1 and JNK2
2) as well as other kinases like c-Raf are also
inhibited at higher concentrations. Low concentrations of SB 203580 that inhibit p38 (but do not block JNK) had little effect on
IL-1-induced collagenase gene expression in RA FLS. However,
concentrations that also inhibit JNK2 (10-25 µM) blocked collagenase
gene expression. A role for c-Raf, which is also inhibited by SB
203580, has not been defined and additional studies to determine the
precise role of JNK will require more selective inhibitors. ERKs also
contribute somewhat to collagenase regulation, although inhibition of
this pathway only modestly decreased MMP expression.
Previous reports suggest that p38 might play an important role in
phorbol ester-induced type IV collagenase production by a squamous cell
carcinoma cell line (Simon et al., 1998
). Additional studies indicated
that intact JNK1 and ERK signaling pathways are also required for
maximal stimulation (Gum et al., 1997
). Also, multiple MAPK families
appear to regulate collagenase expression in some cultured fibroblasts
(Reunanen et al., 1998
). In contrast with our studies with FLS,
induction of collagenase and stromelysin gene expression in cultured
endothelial cells was almost completely blocked by
1 µM SB 203580 (Ridley et al., 1997
). Hence, the function of the individual MAPK
pathways in MMP gene activation appears to depend on the cell type,
culture conditions, and specific MMP examined. Our data suggest that
ERK can contribute to collagenase gene expression and that JNK plays
the most important regulatory role. In addition, we can not rule out a
combined role of p38 and JNK because SB 203580 also inhibits p38 at the
concentrations used to inhibit the latter. However, p38 alone can not
account for collagenase induction by IL-1 in FLS.
The effects of the SB 203580 on collagenase led us to evaluate its
effect on IL-1-induced AP-1 binding activity. As demonstrated previously, IL-1 markedly increased AP-1 activity in nuclear extracts of FLS (Minden et al., 1994
). Concentrations of SB 203580 that inhibit
JNK2 and c-Raf also suppressed AP-1 activation in IL-1 stimulated
synoviocytes. Of course, the EMSA assays only demonstrate AP-1 binding
activity and can not provide information on the phosphorylation status
of this transcription factor. Nevertheless, these data suggest that
JNK2 regulates AP-1 activation in RA cells. SB 203580 had no effect on
NF-kB activation, indicating that it was not toxic to FLS at the
concentrations tested.
Activation of AP-1 and MMPs likely plays an important role in RA, an
inflammatory disease marked by synovial hyperplasia and progressive
bone and cartilage destruction (Firestein, 1996
). Nuclear
extracts from RA synovium contain significantly more AP-1 binding
activity than OA, and synovial AP-1 binding increases very early in the
course of murine collagen-induced arthritis (Asahara et al., 1997
; Han
et al., 1998
). The collagenase gene, which is regulated by AP-1, is
overexpressed in the intimal lining of RA synovium compared with OA
(McCachren et al., 1990
; Firestein et al., 1991
). FLS in the intimal
lining are the major source of MMPs in RA, and IL-1 is among the most
potent inducers of collagenase and AP-1 in these cells.
Increased activation of JNK in RA synoviocytes suggests this signal transduction pathway can participate in the pathogenesis of RA. The observation that JNK is activated in RA synovium suggests a potential mechanism for increased AP-1 and collagenase expression compared with OA. This process could contribute to the highly destructive nature of rheumatoid synovium. Therefore, a selective JNK inhibitor could be a useful therapeutic approach to RA.
| |
Footnotes |
|---|
Accepted for publication June 24, 1999.
Received for publication March 16, 1999.
Send reprint requests to: Dr. Gary S. Firestein, Division of Rheumatology, Allergy, and Immunology, University of California at San Diego School of Medicine 0656, 9500 Gilman Dr., La Jolla, CA 92093-0656. E-mail gfirestein{at}ucsd.edu
| |
Abbreviations |
|---|
RA, rheumatoid arthritis; FLS, fibroblast-like synoviocytes; MAPK, mitogen-activated protein kinase; OA, osteoarthritis; IL-1, interleukin-1; AP-1, activator protein-1; JNK, Jun N-terminal kinase; ERK, extracellular signal-regulated kinases; DMEM, Dulbecco's modified Eagle's medium; PMA, phorbol myristate acetate; TNF, tumor necrosis factor; RT, reverse transcriptase; PCR, polymerase chain reaction; SSPE, saline-sodium phosphate-EDTA; EMSA, electrophoretic mobility shift assay; MMP, matrix metalloproteinase.
| |
References |
|---|
|
|
|---|
and TNF-
on HLA-DR expression, proliferation, collagenase production, and GM-CSF production by rheumatoid arthritis synoviocytes.
J Clin Invest
86:
1790-1798.
(IL-1
) in human fibroblasts and BC-8701 breast cancer cells.
J Cell Biochem
66:
322-336[Medline].
stimulates AP-1 activity through prolonged activation of the c-Jun kinase.
J Biol Chem
269:
26396-26401This article has been cited by other articles:
![]() |
T. Yoshizawa, D. Hammaker, S. E. Sweeney, D. L. Boyle, and G. S. Firestein Synoviocyte Innate Immune Responses: I. Differential Regulation of Interferon Responses and the JNK Pathway by MAPK Kinases J. Immunol., September 1, 2008; 181(5): 3252 - 3258. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Thalhamer, M. A. McGrath, and M. M. Harnett MAPKs and their relevance to arthritis and inflammation Rheumatology, April 1, 2008; 47(4): 409 - 414. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Katsuma, K. Mita, and T. Shimada ERK- and JNK-Dependent Signaling Pathways Contribute to Bombyx mori Nucleopolyhedrovirus Infection J. Virol., December 15, 2007; 81(24): 13700 - 13709. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zer, G. Sachs, and J. M. Shin Identification of genomic targets downstream of p38 mitogen-activated protein kinase pathway mediating tumor necrosis factor-{alpha} signaling Physiol Genomics, October 19, 2007; 31(2): 343 - 351. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Kunisch, M. Gandesiri, R. Fuhrmann, A. Roth, R. Winter, and R. W Kinne Predominant activation of MAP kinases and pro-destructive/pro-inflammatory features by TNF {alpha} in early-passage synovial fibroblasts via TNF receptor-1: failure of p38 inhibition to suppress matrix metalloproteinase-1 in rheumatoid arthritis Ann Rheum Dis, August 1, 2007; 66(8): 1043 - 1051. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Xu, Y. He, X. Yang, L. Liang, Z. Zhan, Y. Ye, X. Yang, F. Lian, and L. Sun Anti-malarial agent artesunate inhibits TNF-{alpha}-induced production of proinflammatory cytokines via inhibition of NF-{kappa}B and PI3 kinase/Akt signal pathway in human rheumatoid arthritis fibroblast-like synoviocytes Rheumatology, June 1, 2007; 46(6): 920 - 926. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Olferiev, E. Masuda, S. Tanaka, M. C. Blank, and L. Pricop The Role of Activating Protein 1 in the Transcriptional Regulation of the Human FCGR2B Promoter Mediated by the -343 G -> C Polymorphism Associated with Systemic Lupus Erythematosus J. Biol. Chem., January 19, 2007; 282(3): 1738 - 1746. [Abstract] [Full Text] [PDF] |
||||
![]() |
S E Sweeney and G S Firestein Mitogen activated protein kinase inhibitors: where are we now and where are we going? Ann Rheum Dis, November 1, 2006; 65(suppl_3): iii83 - iii88. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Inoue, D. Hammaker, D. L. Boyle, and G. S. Firestein Regulation of p38 MAPK by MAPK Kinases 3 and 6 in Fibroblast-Like Synoviocytes J. Immunol., April 1, 2005; 174(7): 4301 - 4306. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Chaturvedi and D. K. Sarkar Involvement of Protein Kinase C-Dependent Mitogen-Activated Protein Kinase p44/42 Signaling Pathway for Cross-Talk between Estradiol and Transforming Growth Factor-{beta}3 in Increasing Basic Fibroblast Growth Factor in Folliculostellate Cells Endocrinology, February 1, 2004; 145(2): 706 - 715. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Hammaker, D. L. Boyle, M. Chabaud-Riou, and G. S. Firestein Regulation of c-Jun N-Terminal Kinase by MEKK-2 and Mitogen-Activated Protein Kinase Kinase Kinases in Rheumatoid Arthritis J. Immunol., February 1, 2004; 172(3): 1612 - 1618. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Pillinger, P. B. Rosenthal, S. N. Tolani, B. Apsel, V. Dinsell, J. Greenberg, E. S. L. Chan, P. F. Gomez, and S. B. Abramson Cyclooxygenase-2-Derived E Prostaglandins Down-Regulate Matrix Metalloproteinase-1 Expression in Fibroblast-Like Synoviocytes via Inhibition of Extracellular Signal-Regulated Kinase Activation J. Immunol., December 1, 2003; 171(11): 6080 - 6089. [Abstract] [Full Text] [PDF] |
||||
![]() |
D Hammaker, S Sweeney, and G S Firestein Signal transduction networks in rheumatoid arthritis Ann Rheum Dis, November 1, 2003; 62(90002): ii86 - 89. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Perlman, K. Bradley, H. Liu, S. Cole, E. Shamiyeh, R. C. Smith, K. Walsh, S. Fiore, A. E. Koch, G. S. Firestein, et al. IL-6 and Matrix Metalloproteinase-1 Are Regulated by the Cyclin-Dependent Kinase Inhibitor p21 in Synovial Fibroblasts J. Immunol., January 15, 2003; 170(2): 838 - 845. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. M. Morel, C. C. Park, K. Zhu, P. Kumar, J. H. Ruth, and A. E. Koch Signal Transduction Pathways Involved in Rheumatoid Arthritis Synovial Fibroblast Interleukin-18-induced Vascular Cell Adhesion Molecule-1 Expression J. Biol. Chem., September 13, 2002; 277(38): 34679 - 34691. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yamanishi, D. L. Boyle, M. Clark, R. A. Maki, M. D. Tortorella, E. C. Arner, and G. S. Firestein Expression and Regulation of Aggrecanase in Arthritis: The Role of TGF-{beta} J. Immunol., February 1, 2002; 168(3): 1405 - 1412. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Deon, S. Ahmed, K. Tai, N. Scaletta, C. Herrero, I.-H. Lee, A. Krause, and L. B. Ivashkiv Cross-Talk Between IL-1 and IL-6 Signaling Pathways in Rheumatoid Arthritis Synovial Fibroblasts J. Immunol., November 1, 2001; 167(9): 5395 - 5403. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Cheng, I. Zhizhin, R. L. Perlman, and D. Mangoura Prolactin-induced Cell Proliferation in PC12 Cells Depends on JNK but Not ERK Activation J. Biol. Chem., July 21, 2000; 275(30): 23326 - 23332. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||