JPET Assistant Professor of Medicine (Clinician-Educator)

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Barclay, T. B.
Right arrow Articles by Morgan, E. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Barclay, T. B.
Right arrow Articles by Morgan, E. T.

Vol. 290, Issue 3, 1250-1257, September 1999

Modulation of Cytochrome P-450 Gene Expression in Endotoxemic Mice Is Tissue Specific and Peroxisome Proliferator-Activated Receptor-alpha Dependent1

Thomas B. Barclay, Jeffrey M. Peters, Marion B. Sewer, Luc Ferrari , Frank J. Gonzalez and Edward T. Morgan

Department of Pharmacology, Emory University, Atlanta, Georgia (T.B.B., M.B.S., L.F., E.T.M.); Laboratory of Metabolism, National Cancer Institute, National Institutes of Health, Bethesda, Maryland (J.M.P., F.J.G.); and Centre du Medicament, Université de Nancy I, Nancy, France (L.F.)


    Abstract
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Administration of the bacterial endotoxin lipopolysaccharide (LPS) causes induction of cytochrome P-450 (CYP) 4A mRNAs in rat liver and kidney. Because induction of the CYP4A subfamily by chemicals requires peroxisome proliferator-activated receptor-alpha (PPARalpha ), we determined whether CYP4A induction by LPS also requires PPARalpha by comparing the responses of PPARalpha -null (-/-) and wild-type (+/+) mice. Renal expression of CYP4A10, CYP4A14, and acyl-CoA oxidase was induced by LPS treatment in (+/+) mice, and these effects were absent in the (-/-) mice. In contrast, hepatic expression of CYP4A10 was down-regulated in the (+/+) animals, and no significant induction of acyl-CoA oxidase or CYP4A14 was detected in liver. Expression of the peroxisomal bifunctional enzyme was not significantly affected by LPS treatment. These results indicate that PPARalpha is activated in mouse kidney after LPS treatment and that this leads to modulation of some PPARalpha -regulated genes. However, the species and tissue specificity of these effects suggest that inflammatory pathways may modulate the induction via PPARalpha . Mice pair fed with LPS-treated mice showed no induction of renal CYP4A10 or CYP4A14, indicating that renal CYP4A induction during endotoxemia is not due to hypophagia. Down-regulation of CYP2A5, CYP2C29, and CYP3A11 by LPS was attenuated or blocked in the (-/-) mice, suggesting a role for PPARalpha in CYP down-regulation as well. Finally, we found that clofibrate caused an acute induction of two hepatic acute-phase mRNAs that was only partially dependent on PPARalpha .


    Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Inflammatory agents such as bacterial endotoxin (lipopolysaccharide; LPS) can affect both the mRNA and protein levels of various isoforms of the cytochrome P-450 (CYP) family (Stanley et al., 1988). In LPS-treated rats, hepatic CYP4A subfamily mRNAs are induced, whereas mRNA and protein levels of CYP2E1, CYP2C11, and CYP3A2 are decreased (Sewer et al., 1996b). In the kidneys of rats treated with either LPS or particulate irritants, expression of both CYP4A and CYP2E1 mRNAs is induced (Sewer et al., 1996a). The CYP4A family is also induced by peroxisome proliferators, a structurally diverse class of compounds that cause several effects in the liver including hepatomegaly, increased peroxisomal beta -oxidation, proliferation of parenchymal peroxisomes, and hepatocarcinogenesis (Gonzalez et al., 1998). These effects of peroxisome proliferators are mediated by the peroxisome proliferator-activated receptor-alpha (PPARalpha ) (Gonzalez et al., 1998). PPARalpha is a member of the nuclear hormone receptor superfamily, which requires another dimerization partner, retinoid X receptor (RXR), for gene activation (Issemann et al., 1993). Target genes of PPARalpha include those encoding peroxisomal and mitochondrial beta -oxidation enzymes, CYP4A subfamily enzymes, and fatty acid binding proteins (Aoyama et al., 1998; Gonzalez et al., 1998). Recently, PPARalpha -null (-/-) mice have been developed, and these animals are refractory to the effects of peroxisome proliferators, including induction of CYP4A or peroxisomal and mitochondrial fatty acid beta -oxidation enzymes (Lee et al., 1995; Aoyama et al., 1998).

PPARalpha has been implicated in inflammatory pathways. Mediators of inflammation such as arachidonate (Issemann et al., 1993) and hydroxyeicosatetraenoic acids (Yu et al., 1995) are activators of PPARs. Leukotriene B4-induced inflammation is prolonged in (-/-) mice (Devchand et al., 1996), and peroxisome proliferators can suppress the expression of negative acute-phase genes (Motojima et al., 1997; Corton et al., 1998). PPARalpha ligands inhibit induction of cyclooxygenase 2 and prostaglandin production in human aortic smooth muscle cells and reduce the plasma concentrations of interleukin-6 and acute-phase proteins in hyperlipidemic patients (Staels et al., 1998). Conversely, peroxisome proliferators induce cyclooxygenase 2 expression in immortalized mouse liver cells (Ledwith et al., 1997).

The objective of this study was to investigate whether the induction of the CYP4A subfamily mRNA and protein by LPS treatment was mediated by PPARalpha . This was done by comparing the responses to LPS in wild-type and PPAR (-/-) mice. Our results indicate that endotoxin causes a tissue-specific induction of CYP4A10 and CYP4A14 in mouse kidney and that this effect is dependent on a functional PPARalpha . Another PPAR-responsive gene, the beta -oxidation enzyme acyl-CoA oxidase (ACO), was induced by LPS, providing further evidence for activation of PPARalpha during inflammation.

    Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Animals and Treatments. All procedures were approved by the Institutional Animal Care and Use Committee of Emory University. In the experiments to determine the role of PPARalpha in CYP regulation, groups of four female 9- to 11-week-old wild-type (-/-) or (+/+) mice (F5 Sv/129) homozygous for a disruption in the ligand-binding domain of the PPARalpha gene were used (Lee et al., 1995). Animals were housed in group cages containing three to five animals per cage and provided food and water ad libitum unless otherwise indicated. Animals were given a single i.p. injection of either 1 mg/kg of chromatographically purified Escherichia coli LPS, serotype 0127:B8 (Sigma Chemical Co., St. Louis, MO) dissolved in sterile 0.9% saline, 40 mg/kg of clofibrate (Sigma) dissolved in corn oil (Wesson), or 0.9% saline in a volume of 0.1 ml. Animals were sacrificed 24 h after injection by CO2 asphyxiation before collection of organs.

In the experiments to examine the effects of hypophagia, female C57/BL6 mice (9-11 weeks old; Charles River Laboratories, Wilmington, MA) were divided into three groups of nine mice, each cage containing three mice. Mice in the first and second groups were injected with 1 mg/kg of LPS or sterile saline, respectively, and their food intakes were recorded every 6 h. Mice in the third group were injected with saline the following day and fed every 6 h with an amount equal to the mean intake of the LPS-treated groups for the corresponding period. Mice from all three groups were injected at 8:00 AM and sacrificed either 12 or 24 h after injection.

Microsome and RNA Preparation. Livers and kidneys were collected from mice, and total RNA was prepared from fresh tissues according to the method of Chomczynski and Sacchi (1987). Samples were stored at -80°C until analysis. RNA concentrations were determined by absorbance at 260 nm.

Northern Blots. RNA was fractionated on a 1% agarose gel electrophoresis in the presence of 5% formaldehyde and transferred to nylon MagnaGraph transfer membrane filters (Micron Separations, Inc., Westboro, MA). Blots were prehybridized, hybridized, and washed according to previously described procedures (Sewer et al., 1996b). To control for RNA loading and transfer artifacts, Northern blots were normalized to the content of glyceraldehyde 3-phosphate dehydrogenase (GAP) mRNA with a cDNA probe (Morgan et al., 1994). The amount of probe bound to the filter was quantitated with a Molecular Dynamics (Sunnyvale, CA) 445si PhosphorImager and ImageQuant software.

cDNA and Oligonucleotide Probes. The cDNA probes for rat CYP4A1, ACO, and bifunctional enzyme (BIEN) were described previously (Lee et al., 1995). The nomenclature system for the CYPs analyzed in this article has been published previously (Nelson et al., 1996). Fibrinogen beta  cDNA was donated by Dr. Gerald Fuller (University of Alabama at Birmingham, Birmingham, AL). Oligonucleotide probes for mouse CYP genes were designed by selecting candidate probes with minimum homology to closely related genes via multiple sequence alignment. Lack of identity to other sequences was confirmed by searching the GenEMBL rodent database with the FastA program (University of Wisconsin GCG package).

cDNA probes were labeled with the Megaprime random nonamer labeling kit (Amersham, Arlington Heights, IL) and [alpha -32P]dCTP. All blots probed with cDNA were hybridized at 42°C and washed at 55°C. Oligonucleotide probes were labeled with T4 polynucleotide kinase and [gamma -32P]ATP. Hybridization and washing conditions for the CYP4A oligonucleotide probes were as described previously (Sewer et al., 1996b). The general conditions for washing and hybridization of blots with the other oligonucleotide probes were as described before (Morgan et al., 1994). All hybridizations and final washes were done at 45°C, except for CYP2A5, which was hybridized at 52°C and washed at 55°C, and CYP4A14, which was hybridized at 45°C and washed at room temperature. The oligonucleotide sequences used and their Genbank accession numbers are: CYP4A10---acaatg- cctgggacaggtgagtagagcctt nt 1146-1175 of X69296; CYP4A14---tctgctcacagatattactggtggatagag nt 1229-1258 of Y11640; CYP2C29---ggccaggccctctccagcacaaatccgttt nt 1301-1330 of D17674; CYP3A11---tgtccgatgttcttagacactgcctttctg nt 1631-1660 of X60452; CYP2A5---cttggtccaccagagcttccttgactgcct nt 351-380 of M19319; and alpha 1-acid glycoprotein (AGP)---cggagttcagagagctgagttcatgcctgg nt 648-677 of M27008.

Statistical Analysis. Statistical analyses were performed with the Quick Statistica package (StatSoft, Inc., Tulsa, OK). One-way ANOVA and the Student-Newman-Keuls test were used to determine differences among treatment groups. In cases where the variances of the experimental groups were not equivalent, the Mann-Whitney U test was used instead. The null hypothesis was rejected at P < .05.

    Results
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Effects of Endotoxin on CYP4A Expression in the Mouse. We previously found that LPS treatment of Fischer 344 rats induced CYP4A2 and CYP4A3 mRNAs in both liver and kidney and CYP4A1 in liver (Sewer et al., 1996a). The effect of LPS on expression of CYP4A mRNAs in mice has not been reported. Three CYP4a genes have been reported in mice: CYP4A10 and CYP4A14 mRNAs are expressed in the livers and kidneys of male and female mice (Heng et al., 1997), whereas CYP4A12 mRNA is male specific (Bell et al., 1993). Therefore, for this study in female mice, we measured the expression of CYP4A10 and CYP4A14 mRNAs. All of the relative mRNA measurements in this article are presented relative to GAP. Essentially identical results were obtained when the signals were normalized to the content of 18S rRNA (not shown), validating the use of GAP as a control.

In contrast to the induction of CYP4A mRNAs in the rat, we found that CYP4A10 mRNA was significantly reduced (to 20% of control levels) in (+/+) mouse liver by treatment with LPS (Fig. 1). In (-/-) mice, the level of CYP4A10 mRNA in the control group was reduced (P < .05) to below the limit of accurate measurement, such that it was impossible to observe whether there was any further decrease on treatment with LPS. As a control, we examined the hepatic expression of CYP4A10 mRNA 24 h after a single injection of clofibrate. This treatment caused a PPARalpha -dependent induction of CYP4A10 mRNA in (+/+) mice (Fig. 1), in agreement with previous findings via chronic clofibrate treatment (Lee et al., 1995).


View larger version (51K):
[in this window]
[in a new window]
 
Fig. 1.   Effects of endotoxin on CYP4A10 mRNA expression. Northern blots of RNA from liver and kidney of mice treated with saline (control), LPS, or clofibrate (Clof) were probed with an oligonucleotide complementary to CYP4A10. All values are normalized to the GAP mRNA signal and are expressed as a percentage of the control group mean. The third sample of the LPS-treated (+/+) group in liver gave a very low signal on several blots with different probes and was omitted from analysis of this and all other blots. Numbers represent the mean ± S.E. of each group. *P < .05, significantly different from respective control group.

In contrast to the findings in the liver, we found that CYP4A10 mRNA was significantly induced in the mouse kidney to 324 and 291% of control levels by treatment with LPS or clofibrate, respectively (Fig. 1). In (-/-) mice, basal CYP4A10 expression was lower than in (+/+) mice (P < .05), and there were no detectable changes due to treatment with LPS or clofibrate (Fig. 1).

The effect of LPS on expression of CYP4A14 in the livers and kidneys of (+/+) and (-/-) mice was similar to those observed with CYP4A10 (Fig. 2). However, the basal expression of CYP4A14 in the livers of both (+/+) and (-/-) mice was below the level of detection, so that it was not possible to detect any further decrease in liver after LPS treatment. CYP4A14 expression in (+/+) mouse kidney was induced by LPS or clofibrate treatment (Fig. 2). No effect of either LPS or clofibrate was observed in the kidneys of (-/-) mice. Similar results were obtained when the liver and kidney RNA Northern blots shown in Fig. 1 were probed with the rat CYP4A1 cDNA (data not shown).


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 2.   Effects of endotoxin on CYP4A14 mRNA expression. Northern blots of RNA from liver and kidney of mice treated with saline (control), LPS, or clofibrate were probed with an oligonucleotide complementary to CYP4A14. All values are normalized to the GAP mRNA signal and are expressed as a percentage of the mean of the clofibrate-treated group. Numbers represent the mean ± S.E. of each group. n.d., values below detection limit, less than three times background value. *P < .05, significantly different from respective control group.

Induction of Peroxisomal beta -Oxidation Genes by Endotoxin Treatment. During treatment with clofibrate and other peroxisome proliferators, hepatocytes undergo several prototypical changes in gene expression, including induction of the mRNAs for the peroxisomal beta -oxidation enzymes ACO, BIEN, and 3-ketoacyl coenzyme A thiolase. Induction of the genes encoding these enzymes by peroxisome proliferators is abolished in the PPARalpha (-/-) mouse (Lee et al., 1995). Because we found that the induction of CYP4A10 by LPS in mouse kidney is also regulated by PPARalpha , we investigated the effects of LPS treatment on the expression of genes encoding beta -oxidation enzymes.

In the kidneys of (+/+) mice, ACO was induced to 293 and 142% of control levels by LPS or a single dose of clofibrate, respectively, and these effects were not found in (-/-) mice (Fig. 3). There was no significant effect of LPS on ACO expression in the liver. BIEN expression in liver and kidney was up-regulated about 13- and 3-fold, respectively, by a single dose of clofibrate in (+/+) mice but was not significantly affected by LPS (Fig. 3). The levels of both ACO and BIEN mRNAs in the livers and kidneys of control (-/-) animals tended to be lower than in (+/+) animals, but this was only significant (P < .05) for BIEN expression in the liver. Treatment with either clofibrate or LPS had no effect in (-/-) mice (Fig. 3)


View larger version (72K):
[in this window]
[in a new window]
 
Fig. 3.   Effects of endotoxin on mRNA expression of ACO and peroxisomal bifunctional enzyme. Northern blots of RNA from liver and kidney of mice treated with saline (control), LPS, or clofibrate were probed with cDNA probes for ACO or BIEN. All values were normalized to the GAP mRNA signal and are expressed as a percentage of the control group mean. Numbers represent the mean ± S.E. of each group. *P < .05, significantly different from respective control group.

Down-Regulation of CYPs. Because PPARalpha is activated during LPS-induced inflammation, it was of interest to determine whether PPARalpha could also be involved in down-regulation of CYP expression during inflammation. Therefore, we examined the hepatic expression of CYP2A5, CYP2C29, and CYP3A11. Basal levels of CYP2A5 and CYP3A11 mRNAs were lower in the (-/-) than in the (+/+) group (Fig. 4). Treatment of (+/+) mice with LPS resulted in decreases in CYP2A5, CYP2C29, and CYP3A11 mRNAs to less than 2, 20, and 15% of control values, respectively (Fig. 4). Clofibrate treatment also caused lower levels of these mRNAs, to a lesser degree. The down-regulation of CYP2A5 and CYP2C29 by LPS or clofibrate was attenuated but not abolished in (-/-) mice. Neither LPS nor clofibrate had an effect on CYP3A11 expression in the (-/-) mice (Fig. 4).


View larger version (83K):
[in this window]
[in a new window]
 
Fig. 4.   Involvement of PPARalpha in the down-regulation of CYPs by endotoxin. Northern blots of RNA from liver of mice treated with saline (control), LPS, or clofibrate were probed with an oligonucleotide complementary to CYP2A5, CYP2C29, or CYP3A11. All values are normalized to the GAP mRNA signal and are expressed as a percentage of the control group mean. Numbers represent the mean ± S.E. of each group. *P < .05, significantly different from respective control group.

Induction of Acute-Phase Genes by Clofibrate. To determine the efficacy of the LPS treatment, we examined its effect on the acute-phase genes fibrinogen and AGP in the liver (Fig. 5). These are prototypic acute-phase proteins, whose expression in inflammation is thought to be regulated mainly by interleukin-6 (fibrinogen) and interleukins-1 and -6 (AGP) (Baumann and Gauldie, 1990). In (+/+) mice, hepatic expression of both mRNAs was induced by LPS treatment as expected. However, fibrinogen mRNA was also significantly induced by clofibrate treatment. The response of fibrinogen and AGP mRNAs to LPS and clofibrate was similar in (+/+) and (-/-) mice (Fig. 5).


View larger version (55K):
[in this window]
[in a new window]
 
Fig. 5.   Effects of endotoxin and clofibrate on mRNA expression of acute-phase genes. Northern blots of RNA from liver of mice treated with saline (control), LPS, or clofibrate were probed with an oligonucleotide complementary to AGP or a cDNA complementary to fibrinogen. All values are normalized to the GAP mRNA signal and are expressed as a percentage of the control group mean. Numbers represent the mean ± S.E. of each group. *P < .05, significantly different from respective control group.

Role of LPS-Induced Hypophagia in Induction of CYP4A by Endotoxin. Endotoxin treatment causes hypophagia in mice (Kozak et al., 1994), and fasting is known to induce CYP4A expression in rodents (Imaoka et al., 1990). We found that 24 h of fasting caused a significant induction of CYP4A10 mRNA in mouse liver and kidney, without affecting CYP2C29, CYP3A11, or CYP2A5 (in kidney, the induction was similar to that caused by endotoxin; data not shown). However, fasting is not a good model for endotoxin-induced hypophagia, because LPS-treated mice eat about 20% as much as control animals (Kozak et al., 1994). To discover whether the induction of CYP4A mRNA in mouse kidney could be caused by endotoxin-induced hypophagia, we measured the food intake of LPS-treated mice and pair fed a saline-injected group with the LPS-treated animals. As shown in Table 1, saline-injected mice consumed about 25% of their total daily intake in the daytime (8:00 AM to 8:00 PM). LPS-injected mice consumed about 30% that of the control mice over the entire 24-h period, and only 24% of their food intake was in the first 12 h. In contrast to LPS treatment, pair feeding did not induce CYP4A10 or CYP4A14 in the kidney and even produced a slight decrease in CYP4A14 expression (Table 2). Similarly, hypophagia was not responsible for the down-regulation of CYP mRNAs by LPS in the liver, because the pair feeding had no effect on CYP3A11 and induced CYP4A10, CYP4A14, CYP2C29, and CYP2A5 mRNAs (Table 2). The data in Table 2 are from animals sacrificed 24 h after initiation of treatment. Qualitatively similar effects of LPS and pair feeding were seen for all parameters when analyzed at 12 h (data not shown).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1
Food intake in saline- and LPS-treated mice

Mice were housed in groups of three per cage. Animals in the saline- and LPS-treated groups were given free access to food, and food intake of each cage was measured at 6-h intervals. Mice in the pair-fed group were fed at the same intervals as the LPS group to approximate the eating pattern of the treated mice. All animals had free access to water. Food intake values are means of six cages (n = 18 mice) for the 8:00 AM to 2:00 PM and 2:00 to 8:00 PM periods and three cages (n = 9) for the 8:00 PM to 2:00 AM, 2:00 to 8:00 AM, and 24-h (total) periods. Values in the LPS/saline column are ratios of the mean food intake of the two groups.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2
Effect of LPS-induced hypophagia on liver and kidney CYP mRNA expression

Mice were treated with LPS and pair fed as described in Table 1. Numbers represent the mean ± S.E. of each group. The number of animals is given in parentheses. There were nine animals in each experimental group: some samples were omitted from analyses because of Northern blot artifacts in the area of the sample or because the value was >2 S.D. from the group mean.

    Discussion
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The aims of this study were to determine whether inflammation causes an induction of CYP4A mRNA expression in the mouse and whether the effect was dependent on PPARalpha . We found that CYP4A10 and CYP4A14 expression are induced in mouse kidney after LPS treatment and that these effects are PPARalpha dependent. The most reasonable explanation of this result would be that the transcriptional activity of PPARalpha is activated in mouse kidney during the response to LPS, and this interpretation is supported by the finding that another PPARalpha -regulated gene, ACO, is also induced by LPS treatment. Whereas a significant effect of LPS treatment on BIEN expression was not detected, the results with this enzyme are also consistent with the hypothesis. Because, as noted, arachidonic acid, prostaglandins, leukotrienes, and hydroxyeicosatetraenoic acid are potent activators of PPARs (Yu et al., 1995), it is reasonable to hypothesize that one or more of these compounds, or perhaps another unidentified endogenous compound that is generated during an inflammatory response, contribute to the observed effects.

Because endotoxin is a lipopolysaccharide, the lipid moiety of LPS rather than the inflammation associated with LPS administration could be responsible for activation of PPARalpha -dependent gene expression. Endotoxin is deacylated in the liver, with the subsequent production of 3-hydroxytetradecaenoic, hexadecaenoic, and dodecaenoic acids (Fox et al., 1996). These fatty acids are potential ligands for PPARalpha (Issemann et al., 1993). However, it is unlikely that the lipid moiety of LPS underlies PPARalpha activation, because the single dose of endotoxin used here is two orders of magnitude lower than the daily doses of fatty acids that have been reported to induce CYP4As in rats in a chronic treatment protocol (Göttlicher et al., 1993).

Fasting induces CYP4A activity and protein levels in rat liver (Orellana et al., 1992) and kidney (Imaoka et al., 1990). Moreover, Kroetz et al. (1998) recently showed that induction of the CYP4A subfamily as a result of fasting is regulated through PPARalpha . LPS treatment of mice reduces food intake and stimulates weight loss in a dose-dependent manner (Kozak et al., 1994), but the weight loss is mainly because of factors other than hypophagia (Kozak et al., 1994). Our results show that the induction of renal CYP4A in the mouse and the down-regulation of several hepatic CYP mRNAs are not caused by hypophagia. Thus, PPAR-dependent induction of CYP4A may be caused by other metabolic effects of endotoxemia. For instance, LPS injection stimulates hepatic fatty acid synthesis within hours of injection and causes later increases in serum triglycerides and cholesterol that appear to be mediated by tumor necrosis factor (Memon et al., 1993).

In contrast to the kidney, we found that LPS treatment resulted in lower levels of CYP4A10 mRNA in the liver and did not induce CYP4A14 mRNA. The tissue specificity of this effect could be explained by the activation of Kupffer cells, which are present in liver but not in kidney, by LPS. The resulting high local concentrations of cytokines and interferons in the vicinity of the hepatocyte (Geller et al., 1994) may oppose any inductive effect caused by PPAR activators. In support of this theory, Knickle et al. (1992) found that treatment of rats with an interferon inducer attenuated the induction of CYP4A mRNA by clofibrate. Cytokines can also suppress induction of CYP4A in cultured fetal rat hepatocytes, and this is accompanied by down-regulation of PPARalpha expression (Parmentier et al., 1997). Another plausible mechanism is that other signaling pathways, activated by cytokines, may interact with PPARalpha . For instance, cytokine-activated transcription factors such as nuclear factor-kappa B, activator protein-1, or signal transducer and activator of transcription-3 could interact directly with PPAR to modulate its activity. PPARalpha cotransfection attenuated the transcriptional activation of an nuclear factor-kappa B-responsive promoter in a ligand-dependent manner (Staels et al., 1998): if these transcription factors were mutually antagonistic, it could explain the down-regulation of CYP4A10 by LPS in liver.

The possible reasons for the species differences in the responses of hepatic CYP4A mRNAs to LPS are less obvious. CYP4A10 and CYP4A14 are induced in mouse kidney but not in liver, in contrast to the F344 rat, in which CYP4A mRNAs are induced in both tissues (Sewer et al., 1996a). It is likely that species differences in induction of CYP4A by LPS treatment are due to genetically controlled factors affecting the general response to LPS or the generation of PPAR ligands during inflammation.

Constitutive expression of genes encoding peroxisomal enzymes (e.g., ACO and BIEN), microsomal CYP4A enzymes, and basal levels of peroxisomes are similar between male (-/-) and (+/+) mice on a mixed genetic background (C57BL/6N × Sv/129) (Lee et al., 1995). These results are consistent with another study that used purebred male Sv/129 mice (Aoyama et al., 1998). In contrast, our study shows that the levels of CYP4A10, ACO, and BIEN mRNAs in purebred female Sv/129 (-/-) mice are significantly lower than in (+/+) mice, suggesting that in female mice, a low level of constitutive activation by PPARalpha occurs. The apparent discrepancy could be due to inherent differences between sexes, because there are significant differences in the phenotype between male and female (-/-) and (+/+) mice (Costet et al., 1998; Djouadi et al., 1998).

Another novel finding of this study is that expression of the mRNA encoding the hepatic acute-phase gene, fibrinogen, is induced by the peroxisome proliferator clofibrate. In contrast, Corton et al. (1998) recently reported that expression of fibrinogen mRNA was suppressed by peroxisome proliferators. This disparity could be attributed to several possibilities. In this study, the acute effect of clofibrate (24 h) was examined, whereas Corton et al. (1998) used chronic treatment (1-13 weeks) with either diethylhexyl phthalate or WY-14,643. PPAR-dependent gene expression can be influenced by protein-protein interactions with coactivators and/or corepressors (Dowell et al., 1997). Thus, differences in the levels of coactivators and/or corepressors could explain why acute activation of PPARalpha by clofibrate causes increases in fibrinogen mRNA, whereas chronic exposure results in decreases in this mRNA. Clearly, further work is needed to identify the mechanisms underlying this difference. Peroxisome proliferators are known to activate Kupffer cells, resulting in stimulation of tumor necrosis factor-alpha production in the liver (Rose et al., 1998). This suggests that the release of inflammatory cytokines by Kupffer cells after clofibrate treatment could contribute to the increase in acute-phase proteins. Whether the PPARalpha is required for Kupffer cell activation by peroxisome proliferators has not been reported. In this study, the acute induction of fibrinogen mRNA by clofibrate occurred through a PPARalpha -independent mechanism. In contrast, subsequent chronic down-regulation clearly requires the receptor (Corton et al., 1998).

The down-regulation of multiple CYPs that occurs during inflammation can be mimicked by the treatment with inflammatory cytokines in vivo and in vitro (hepatocyte cultures; Morgan, 1997). This study examined the effect of LPS and peroxisome proliferator treatment on CYP mRNA expression in (-/-) mice. LPS and clofibrate administration caused decreases in mRNAs encoding CYP2A5, CYP2C29, and CYP3A11, effects that were attenuated or blocked in the PPARalpha (-/-) mice. The results with clofibrate are consistent with the observations that peroxisome proliferator-induced down-regulation of CYPs (Corton et al., 1998) and other genes, including apolipoproteins A-I and C-III (Motojima et al., 1997; Peters et al., 1997), requires the PPARalpha . However, the results with LPS suggest that the PPARalpha is also implicated in the down-regulation of CYPs during inflammation. Because the effects of LPS on CYP2C29 and CYP2A5 expression were not completely absent in the PPARalpha (-/-) mice, it is likely that both PPARalpha -dependent and PPARalpha -independent pathways are involved in the down-regulation of these CYPs.

Our study confirms the hypothesis that PPARalpha was involved in the induction of CYP4A during endotoxemia. More surprising was the finding that PPARalpha appears to have a role in CYP down-regulation in this model as well. This work adds to the growing body of information on the relationship between peroxisome proliferation and inflammation. We show here that not only is inflammation associated with PPAR activation, but peroxisome proliferators activate acute-phase gene expression. The exact role of PPAR in pathology and homeostasis of the inflammatory response remains to be determined.

    Acknowledgments

The excellent technical assistance of Qi Chen is gratefully acknowledged.

    Footnotes

Accepted for publication April 27, 1999.

Received for publication December 18, 1998.

1 This work was supported by Grant GM-46897 from the National Institutes of Health (to E.T.M.). A preliminary report was presented at the 10th International Symposium on Cytochrome P-450, Biochemistry, Biophysics, and Molecular Biology, San Francisco, California, August 1997.

Send reprint requests to: Dr. Edward T. Morgan, Department of Pharmacology, Emory University, Atlanta, GA 30322. E-mail: etmorga{at}bimcore.emory.edu

    Abbreviations

LPS, lipopolysaccharide; ACO, acyl-CoA oxidase; AGP, alpha 1-acid glycoprotein; BIEN, peroxisomal bifunctional enzyme enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase; CYP, cytochrome P-450; GAP, glyceraldehyde 3-phosphate dehydrogenase; PPAR, peroxisome proliferator-activated receptor; RXR, retinoid X receptor.

    References
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References


0022-3565/99/2903-1250$03.00/0
THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS
Copyright © 1999 by U.S. Government



This article has been cited by other articles:


Home page
J. Nutr.Home page
T. Mori, H. Kondo, T. Hase, I. Tokimitsu, and T. Murase
Dietary Fish Oil Upregulates Intestinal Lipid Metabolism and Reduces Body Weight Gain in C57BL/6J Mice
J. Nutr., December 1, 2007; 137(12): 2629 - 2634.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
J. S. Petrick and C. D. Klaassen
Importance of Hepatic Induction of Constitutive Androstane Receptor and Other Transcription Factors That Regulate Xenobiotic Metabolism and Transport
Drug Metab. Dispos., October 1, 2007; 35(10): 1806 - 1815.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
E. A. Hanniman, G. Lambert, Y. Inoue, F. J. Gonzalez, and C. J. Sinal
Apolipoprotein A-IV is regulated by nutritional and metabolic stress: involvement of glucocorticoids, HNF-4{alpha}, and PGC-1{alpha}
J. Lipid Res., November 1, 2006; 47(11): 2503 - 2514.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
H. Kondo, Y. Minegishi, Y. Komine, T. Mori, I. Matsumoto, K. Abe, I. Tokimitsu, T. Hase, and T. Murase
Differential regulation of intestinal lipid metabolism-related genes in obesity-resistant A/J vs. obesity-prone C57BL/6J mice
Am J Physiol Endocrinol Metab, November 1, 2006; 291(5): E1092 - E1099.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
F. C. Kupper, E. Gaquerel, E.-M. Boneberg, S. Morath, J.-P. Salaun, and P. Potin
Early events in the perception of lipopolysaccharides in the brown alga Laminaria digitata include an oxidative burst and activation of fatty acid oxidation cascades
J. Exp. Bot., June 1, 2006; 57(9): 1991 - 1999.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
T. A. Richardson, M. Sherman, L. Antonovic, S. S. Kardar, H. W. Strobel, D. Kalman, and E. T. Morgan
HEPATIC AND RENAL CYTOCHROME P450 GENE REGULATION DURING CITROBACTER RODENTIUM INFECTION IN WILD-TYPE AND TOLL-LIKE RECEPTOR 4 MUTANT MICE
Drug Metab. Dispos., March 1, 2006; 34(3): 354 - 360.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
T. A. Richardson, M. Sherman, D. Kalman, and E. T. Morgan
EXPRESSION OF UDP-GLUCURONOSYLTRANSFERASE ISOFORM mRNAS DURING INFLAMMATION AND INFECTION IN MOUSE LIVER AND KIDNEY
Drug Metab. Dispos., March 1, 2006; 34(3): 351 - 353.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
T. A. Richardson and E. T. Morgan
Hepatic Cytochrome P450 Gene Regulation during Endotoxin-Induced Inflammation in Nuclear Receptor Knockout Mice
J. Pharmacol. Exp. Ther., August 1, 2005; 314(2): 703 - 709.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
S. Teng and M. Piquette-Miller
The Involvement of the Pregnane X Receptor in Hepatic Gene Regulation during Inflammation in Mice
J. Pharmacol. Exp. Ther., February 1, 2005; 312(2): 841 - 848.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
H. t. Dieck, F. Doring, D. Fuchs, H.-P. Roth, and H. Daniel
Transcriptome and Proteome Analysis Identifies the Pathways That Increase Hepatic Lipid Accumulation in Zinc-Deficient Rats
J. Nutr., February 1, 2005; 135(2): 199 - 205.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S.-W. Kim, K. Park, E. Kwak, E. Choi, S. Lee, J. Ham, H. Kang, J. M. Kim, S. Y. Hwang, Y.-Y. Kong, et al.
Activating Signal Cointegrator 2 Required for Liver Lipid Metabolism Mediated by Liver X Receptors in Mice
Mol. Cell. Biol., May 15, 2003; 23(10): 3583 - 3592.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
J. Pan, Q. Xiang, S. Ball, J. Scatina, J. Kao, and J.-Y. Hong
Lipopolysaccharide-Mediated Modulation of Cytochromes P450 in Stat1 Null Mice
Drug Metab. Dispos., April 1, 2003; 31(4): 392 - 397.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
G. J. Pass, W. Becker, R. Kluge, K. Linnartz, L. Plum, K. Giesen, and H.-G. Joost
Effect of Hyperinsulinemia and Type 2 Diabetes-Like Hyperglycemia on Expression of Hepatic Cytochrome P450 and Glutathione S-Transferase Isoforms in a New Zealand Obese-Derived Mouse Backcross Population
J. Pharmacol. Exp. Ther., August 1, 2002; 302(2): 442 - 450.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. E. Akiyama, C. J. Nicol, C. Fievet, B. Staels, J. M. Ward, J. Auwerx, S. S. T. Lee, F. J. Gonzalez, and J. M. Peters
Peroxisome Proliferator-activated Receptor-alpha Regulates Lipid Homeostasis, but Is Not Associated with Obesity. STUDIES WITH CONGENIC MOUSE LINES
J. Biol. Chem., October 12, 2001; 276(42): 39088 - 39093.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
X. Cui, H. Kawashima, T. B. Barclay, J. M. Peters, F. J. Gonzalez, E. T. Morgan, and H. W. Strobel
Molecular Cloning and Regulation of Expression of Two Novel Mouse CYP4F Genes: Expression in Peroxisome Proliferator-Activated Receptor alpha -Deficient Mice upon Lipopolysaccharide and Clofibrate Challenges
J. Pharmacol. Exp. Ther., April 13, 2001; 296(2): 542 - 550.
[Abstract] [Full Text]


Home page
Drug Metab. Dispos.Home page
E. T. Morgan
Regulation of Cytochrome P450 by Inflammatory Mediators: Why and How?
Drug Metab. Dispos., March 1, 2001; 29(3): 207 - 212.
[Abstract] [Full Text]


Home page
Drug Metab. Dispos.Home page
S. R. Mitchell, M. B. Sewer, S. S. Kardar, and E. T. Morgan
Characterization of Cyp4a Induction in Rat Liver by Inflammatory Stimuli: Dependence on Sex, Strain, and Inflammation-Evoked Hypophagia
Drug Metab. Dispos., January 1, 2001; 29(1): 17 - 22.
[Abstract] [Full Text]


Home page
J. Pharmacol. Exp. Ther.Home page
K. W. Renton and T. E. Nicholson
Hepatic and Central Nervous System Cytochrome P450 Are Down-Regulated during Lipopolysaccharide-Evoked Localized Inflammation in Brain
J. Pharmacol. Exp. Ther., August 1, 2000; 294(2): 524 - 530.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
A. P. Beigneux, A. H. Moser, J. K. Shigenaga, C. Grunfeld, and K. R. Feingold
The Acute Phase Response Is Associated with Retinoid X Receptor Repression in Rodent Liver
J. Biol. Chem., May 19, 2000; 275(21): 16390 - 16399.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Barclay, T. B.
Right arrow Articles by Morgan, E. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Barclay, T. B.
Right arrow Articles by Morgan, E. T.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition