![]() |
|
|
Vol. 290, Issue 3, 1250-1257, September 1999
Dependent1
Department of Pharmacology, Emory University, Atlanta, Georgia (T.B.B., M.B.S., L.F., E.T.M.); Laboratory of Metabolism, National Cancer Institute, National Institutes of Health, Bethesda, Maryland (J.M.P., F.J.G.); and Centre du Medicament, Université de Nancy I, Nancy, France (L.F.)
| |
Abstract |
|---|
|
|
|---|
Administration of the bacterial endotoxin lipopolysaccharide (LPS)
causes induction of cytochrome P-450 (CYP) 4A mRNAs in rat liver
and kidney. Because induction of the CYP4A subfamily by chemicals
requires peroxisome proliferator-activated receptor-
(PPAR
), we
determined whether CYP4A induction by LPS also requires PPAR
by
comparing the responses of PPAR
-null (
/
) and wild-type (+/+)
mice. Renal expression of CYP4A10, CYP4A14, and acyl-CoA oxidase was
induced by LPS treatment in (+/+) mice, and these effects were absent
in the (
/
) mice. In contrast, hepatic expression of CYP4A10 was
down-regulated in the (+/+) animals, and no significant induction of
acyl-CoA oxidase or CYP4A14 was detected in liver. Expression of the
peroxisomal bifunctional enzyme was not significantly affected by LPS
treatment. These results indicate that PPAR
is activated in mouse
kidney after LPS treatment and that this leads to modulation of some
PPAR
-regulated genes. However, the species and tissue specificity of
these effects suggest that inflammatory pathways may modulate the
induction via PPAR
. Mice pair fed with LPS-treated mice showed no
induction of renal CYP4A10 or CYP4A14, indicating that renal CYP4A
induction during endotoxemia is not due to hypophagia. Down-regulation
of CYP2A5, CYP2C29, and CYP3A11 by LPS was attenuated or blocked in the
(
/
) mice, suggesting a role for PPAR
in CYP
down-regulation as well. Finally, we found that clofibrate caused an
acute induction of two hepatic acute-phase mRNAs that was only
partially dependent on PPAR
.
| |
Introduction |
|---|
|
|
|---|
Inflammatory
agents such as bacterial endotoxin (lipopolysaccharide; LPS) can affect
both the mRNA and protein levels of various isoforms of the cytochrome
P-450 (CYP) family (Stanley et al., 1988
). In LPS-treated rats, hepatic
CYP4A subfamily mRNAs are induced, whereas mRNA and protein levels of
CYP2E1, CYP2C11, and CYP3A2 are decreased (Sewer et al., 1996b
). In the
kidneys of rats treated with either LPS or particulate irritants,
expression of both CYP4A and CYP2E1 mRNAs is induced (Sewer et al.,
1996a
). The CYP4A family is also induced by peroxisome proliferators, a
structurally diverse class of compounds that cause several effects in
the liver including hepatomegaly, increased peroxisomal
-oxidation, proliferation of parenchymal peroxisomes, and hepatocarcinogenesis (Gonzalez et al., 1998
). These effects of peroxisome proliferators are
mediated by the peroxisome proliferator-activated receptor-
(PPAR
) (Gonzalez et al., 1998
). PPAR
is a member of the nuclear hormone receptor superfamily, which requires another dimerization partner, retinoid X receptor (RXR), for gene activation
(Issemann et al., 1993
). Target genes of PPAR
include those encoding
peroxisomal and mitochondrial
-oxidation enzymes, CYP4A subfamily
enzymes, and fatty acid binding proteins (Aoyama et al., 1998
; Gonzalez et al., 1998
). Recently, PPAR
-null (
/
) mice have been developed, and these animals are refractory to the effects of peroxisome proliferators, including induction of CYP4A or peroxisomal and mitochondrial fatty acid
-oxidation enzymes (Lee et al., 1995
; Aoyama et al., 1998
).
PPAR
has been implicated in inflammatory pathways. Mediators of
inflammation such as arachidonate (Issemann et al., 1993
) and
hydroxyeicosatetraenoic acids (Yu et al., 1995
) are activators of
PPARs. Leukotriene B4-induced inflammation
is prolonged in (
/
) mice (Devchand et al., 1996
), and peroxisome
proliferators can suppress the expression of negative acute-phase genes
(Motojima et al., 1997
; Corton et al., 1998
). PPAR
ligands inhibit
induction of cyclooxygenase 2 and prostaglandin production in human
aortic smooth muscle cells and reduce the plasma concentrations of
interleukin-6 and acute-phase proteins in hyperlipidemic patients
(Staels et al., 1998
). Conversely, peroxisome proliferators induce
cyclooxygenase 2 expression in immortalized mouse liver cells (Ledwith
et al., 1997
).
The objective of this study was to investigate whether the induction of
the CYP4A subfamily mRNA and protein by LPS treatment was mediated by
PPAR
. This was done by comparing the responses to LPS in wild-type
and PPAR (
/
) mice. Our results indicate that endotoxin causes a
tissue-specific induction of CYP4A10 and CYP4A14 in mouse kidney and
that this effect is dependent on a functional PPAR
. Another
PPAR-responsive gene, the
-oxidation enzyme acyl-CoA oxidase (ACO),
was induced by LPS, providing further evidence for activation of
PPAR
during inflammation.
| |
Materials and Methods |
|---|
|
|
|---|
Animals and Treatments.
All procedures were approved by the
Institutional Animal Care and Use Committee of Emory University. In the
experiments to determine the role of PPAR
in CYP regulation, groups
of four female 9- to 11-week-old wild-type (
/
) or (+/+) mice
(F5 Sv/129) homozygous for a disruption in the
ligand-binding domain of the PPAR
gene were used (Lee et al., 1995
).
Animals were housed in group cages containing three to five animals per
cage and provided food and water ad libitum unless otherwise indicated.
Animals were given a single i.p. injection of either 1 mg/kg of
chromatographically purified Escherichia coli LPS, serotype
0127:B8 (Sigma Chemical Co., St. Louis, MO) dissolved in sterile 0.9%
saline, 40 mg/kg of clofibrate (Sigma) dissolved in corn oil (Wesson),
or 0.9% saline in a volume of 0.1 ml. Animals were sacrificed 24 h after injection by CO2 asphyxiation before
collection of organs.
Microsome and RNA Preparation.
Livers and kidneys were
collected from mice, and total RNA was prepared from fresh tissues
according to the method of Chomczynski and Sacchi (1987)
. Samples were
stored at
80°C until analysis. RNA concentrations were
determined by absorbance at 260 nm.
Northern Blots.
RNA was fractionated on a 1% agarose gel
electrophoresis in the presence of 5% formaldehyde and transferred to
nylon MagnaGraph transfer membrane filters (Micron Separations, Inc.,
Westboro, MA). Blots were prehybridized, hybridized, and washed
according to previously described procedures (Sewer et al., 1996b
). To
control for RNA loading and transfer artifacts, Northern blots were
normalized to the content of glyceraldehyde 3-phosphate dehydrogenase
(GAP) mRNA with a cDNA probe (Morgan et al., 1994
). The amount of probe bound to the filter was quantitated with a Molecular Dynamics (Sunnyvale, CA) 445si PhosphorImager and ImageQuant software.
cDNA and Oligonucleotide Probes.
The cDNA probes for rat
CYP4A1, ACO, and bifunctional enzyme (BIEN) were described previously
(Lee et al., 1995
). The nomenclature system for the CYPs analyzed in
this article has been published previously (Nelson et al., 1996
).
Fibrinogen
cDNA was donated by Dr. Gerald Fuller (University of
Alabama at Birmingham, Birmingham, AL). Oligonucleotide probes for
mouse CYP genes were designed by selecting candidate probes with
minimum homology to closely related genes via multiple sequence
alignment. Lack of identity to other sequences was confirmed by
searching the GenEMBL rodent database with the FastA program
(University of Wisconsin GCG package).
-32P]dCTP. All blots probed with cDNA were
hybridized at 42°C and washed at 55°C. Oligonucleotide probes were
labeled with T4 polynucleotide kinase and
[
-32P]ATP. Hybridization and washing
conditions for the CYP4A oligonucleotide probes were as described
previously (Sewer et al., 1996b
acaatg-
cctgggacaggtgagtagagcctt nt 1146-1175 of X69296;
CYP4A14
tctgctcacagatattactggtggatagag nt 1229-1258 of Y11640;
CYP2C29
ggccaggccctctccagcacaaatccgttt nt 1301-1330 of D17674;
CYP3A11
tgtccgatgttcttagacactgcctttctg nt 1631-1660 of X60452;
CYP2A5
cttggtccaccagagcttccttgactgcct nt 351-380 of M19319; and
1-acid glycoprotein
(AGP)
cggagttcagagagctgagttcatgcctgg nt 648-677 of M27008.
Statistical Analysis. Statistical analyses were performed with the Quick Statistica package (StatSoft, Inc., Tulsa, OK). One-way ANOVA and the Student-Newman-Keuls test were used to determine differences among treatment groups. In cases where the variances of the experimental groups were not equivalent, the Mann-Whitney U test was used instead. The null hypothesis was rejected at P < .05.
| |
Results |
|---|
|
|
|---|
Effects of Endotoxin on CYP4A Expression in the Mouse.
We
previously found that LPS treatment of Fischer 344 rats induced CYP4A2
and CYP4A3 mRNAs in both liver and kidney and CYP4A1 in liver (Sewer et
al., 1996a
). The effect of LPS on expression of CYP4A mRNAs in mice has
not been reported. Three CYP4a genes have been
reported in mice: CYP4A10 and CYP4A14 mRNAs are expressed in the livers
and kidneys of male and female mice (Heng et al., 1997
), whereas
CYP4A12 mRNA is male specific (Bell et al., 1993
). Therefore, for this
study in female mice, we measured the expression of CYP4A10 and CYP4A14
mRNAs. All of the relative mRNA measurements in this article are
presented relative to GAP. Essentially identical results were obtained
when the signals were normalized to the content of 18S rRNA (not
shown), validating the use of GAP as a control.
/
) mice, the level of CYP4A10
mRNA in the control group was reduced (P < .05) to
below the limit of accurate measurement, such that it was impossible to
observe whether there was any further decrease on treatment with LPS.
As a control, we examined the hepatic expression of CYP4A10 mRNA
24 h after a single injection of clofibrate. This treatment caused
a PPAR
-dependent induction of CYP4A10 mRNA in (+/+) mice (Fig. 1),
in agreement with previous findings via chronic clofibrate treatment
(Lee et al., 1995
|
/
) mice, basal CYP4A10 expression was lower than in (+/+)
mice (P < .05), and there were no detectable changes
due to treatment with LPS or clofibrate (Fig. 1).
The effect of LPS on expression of CYP4A14 in the livers and kidneys of
(+/+) and (
/
) mice was similar to those observed with CYP4A10 (Fig.
2). However, the basal expression of
CYP4A14 in the livers of both (+/+) and (
/
) mice was below the
level of detection, so that it was not possible to detect any further decrease in liver after LPS treatment. CYP4A14 expression in (+/+) mouse kidney was induced by LPS or clofibrate treatment (Fig. 2). No
effect of either LPS or clofibrate was observed in the kidneys of
(
/
) mice. Similar results were obtained when the liver and kidney
RNA Northern blots shown in Fig. 1 were probed with the rat CYP4A1 cDNA
(data not shown).
|
Induction of Peroxisomal
-Oxidation Genes by Endotoxin
Treatment.
During treatment with clofibrate and other peroxisome
proliferators, hepatocytes undergo several prototypical changes in gene expression, including induction of the mRNAs for the peroxisomal
-oxidation enzymes ACO, BIEN, and 3-ketoacyl coenzyme A thiolase. Induction of the genes encoding these enzymes by peroxisome
proliferators is abolished in the PPAR
(
/
) mouse (Lee et al.,
1995
). Because we found that the induction of CYP4A10 by LPS in mouse
kidney is also regulated by PPAR
, we investigated the effects of LPS treatment on the expression of genes encoding
-oxidation enzymes.
/
) mice (Fig.
3). There was no significant effect of
LPS on ACO expression in the liver. BIEN expression in liver and kidney
was up-regulated about 13- and 3-fold, respectively, by a single dose
of clofibrate in (+/+) mice but was not significantly affected by LPS
(Fig. 3). The levels of both ACO and BIEN mRNAs in the livers and
kidneys of control (
/
) animals tended to be lower than in (+/+)
animals, but this was only significant (P < .05) for
BIEN expression in the liver. Treatment with either clofibrate or LPS
had no effect in (
/
) mice (Fig. 3)
|
Down-Regulation of CYPs.
Because PPAR
is activated during
LPS-induced inflammation, it was of interest to determine whether
PPAR
could also be involved in down-regulation of CYP expression
during inflammation. Therefore, we examined the hepatic expression of
CYP2A5, CYP2C29, and CYP3A11. Basal levels of CYP2A5 and CYP3A11 mRNAs
were lower in the (
/
) than in the (+/+) group (Fig.
4). Treatment of (+/+) mice with LPS
resulted in decreases in CYP2A5, CYP2C29, and CYP3A11 mRNAs to less
than 2, 20, and 15% of control values, respectively (Fig. 4).
Clofibrate treatment also caused lower levels of these mRNAs, to a
lesser degree. The down-regulation of CYP2A5 and CYP2C29 by LPS or
clofibrate was attenuated but not abolished in (
/
) mice. Neither
LPS nor clofibrate had an effect on CYP3A11 expression in the (
/
)
mice (Fig. 4).
|
Induction of Acute-Phase Genes by Clofibrate.
To determine the
efficacy of the LPS treatment, we examined its effect on the
acute-phase genes fibrinogen and AGP in the liver (Fig.
5). These are prototypic acute-phase
proteins, whose expression in inflammation is thought to be regulated
mainly by interleukin-6 (fibrinogen) and interleukins-1 and -6 (AGP)
(Baumann and Gauldie, 1990
). In (+/+) mice, hepatic expression of both mRNAs was induced by LPS treatment as expected. However, fibrinogen mRNA was also significantly induced by clofibrate treatment. The response of fibrinogen and AGP mRNAs to LPS and clofibrate was similar
in (+/+) and (
/
) mice (Fig. 5).
|
Role of LPS-Induced Hypophagia in Induction of CYP4A by
Endotoxin.
Endotoxin treatment causes hypophagia in mice (Kozak et
al., 1994
), and fasting is known to induce CYP4A expression in rodents (Imaoka et al., 1990
). We found that 24 h of fasting caused a significant induction of CYP4A10 mRNA in mouse liver and kidney, without affecting CYP2C29, CYP3A11, or CYP2A5 (in kidney, the induction
was similar to that caused by endotoxin; data not shown). However,
fasting is not a good model for endotoxin-induced hypophagia, because
LPS-treated mice eat about 20% as much as control animals (Kozak et
al., 1994
). To discover whether the induction of CYP4A mRNA in mouse
kidney could be caused by endotoxin-induced hypophagia, we measured the
food intake of LPS-treated mice and pair fed a saline-injected group
with the LPS-treated animals. As shown in Table
1, saline-injected mice consumed about
25% of their total daily intake in the daytime (8:00 AM to 8:00 PM).
LPS-injected mice consumed about 30% that of the control mice over the
entire 24-h period, and only 24% of their food intake was in the first 12 h. In contrast to LPS treatment, pair feeding did not induce CYP4A10 or CYP4A14 in the kidney and even produced a slight decrease in
CYP4A14 expression (Table 2). Similarly,
hypophagia was not responsible for the down-regulation of CYP mRNAs by
LPS in the liver, because the pair feeding had no effect on CYP3A11 and
induced CYP4A10, CYP4A14, CYP2C29, and CYP2A5 mRNAs (Table 2). The data in Table 2 are from animals sacrificed 24 h after initiation of
treatment. Qualitatively similar effects of LPS and pair feeding were
seen for all parameters when analyzed at 12 h (data not shown).
|
|
| |
Discussion |
|---|
|
|
|---|
The aims of this study were to determine whether inflammation
causes an induction of CYP4A mRNA expression in the mouse and whether
the effect was dependent on PPAR
. We found that CYP4A10 and CYP4A14
expression are induced in mouse kidney after LPS treatment and that
these effects are PPAR
dependent. The most reasonable explanation of
this result would be that the transcriptional activity of PPAR
is
activated in mouse kidney during the response to LPS, and this
interpretation is supported by the finding that another PPAR
-regulated gene, ACO, is also induced by LPS treatment. Whereas a significant effect of LPS treatment on BIEN expression was not detected, the results with this enzyme are also consistent with the
hypothesis. Because, as noted, arachidonic acid, prostaglandins, leukotrienes, and hydroxyeicosatetraenoic acid are potent activators of
PPARs (Yu et al., 1995
), it is reasonable to hypothesize that one or
more of these compounds, or perhaps another unidentified endogenous
compound that is generated during an inflammatory response, contribute
to the observed effects.
Because endotoxin is a lipopolysaccharide, the lipid moiety of LPS
rather than the inflammation associated with LPS administration could
be responsible for activation of PPAR
-dependent gene expression. Endotoxin is deacylated in the liver, with the subsequent production of
3-hydroxytetradecaenoic, hexadecaenoic, and dodecaenoic acids (Fox et
al., 1996
). These fatty acids are potential ligands for PPAR
(Issemann et al., 1993
). However, it is unlikely that the lipid moiety
of LPS underlies PPAR
activation, because the single dose of
endotoxin used here is two orders of magnitude lower than the daily
doses of fatty acids that have been reported to induce CYP4As in rats
in a chronic treatment protocol (Göttlicher et al., 1993
).
Fasting induces CYP4A activity and protein levels in rat liver
(Orellana et al., 1992
) and kidney (Imaoka et al., 1990
). Moreover, Kroetz et al. (1998)
recently showed that induction of the CYP4A subfamily as a result of fasting is regulated through PPAR
.
LPS treatment of mice reduces food intake and stimulates weight loss in
a dose-dependent manner (Kozak et al., 1994
), but the weight loss is
mainly because of factors other than hypophagia (Kozak et al., 1994
).
Our results show that the induction of renal CYP4A in the mouse and the
down-regulation of several hepatic CYP mRNAs are not caused by
hypophagia. Thus, PPAR-dependent induction of CYP4A may be caused by
other metabolic effects of endotoxemia. For instance, LPS injection
stimulates hepatic fatty acid synthesis within hours of injection and
causes later increases in serum triglycerides and cholesterol that
appear to be mediated by tumor necrosis factor (Memon et al., 1993
).
In contrast to the kidney, we found that LPS treatment resulted in
lower levels of CYP4A10 mRNA in the liver and did not induce CYP4A14
mRNA. The tissue specificity of this effect could be explained by the
activation of Kupffer cells, which are present in liver but not in
kidney, by LPS. The resulting high local concentrations of cytokines
and interferons in the vicinity of the hepatocyte (Geller et al., 1994
)
may oppose any inductive effect caused by PPAR activators. In support
of this theory, Knickle et al. (1992)
found that treatment of rats with
an interferon inducer attenuated the induction of CYP4A mRNA by
clofibrate. Cytokines can also suppress induction of CYP4A in cultured
fetal rat hepatocytes, and this is accompanied by down-regulation of
PPAR
expression (Parmentier et al., 1997
). Another plausible
mechanism is that other signaling pathways, activated by cytokines, may
interact with PPAR
. For instance, cytokine-activated transcription
factors such as nuclear factor-
B, activator protein-1, or signal
transducer and activator of transcription-3 could interact
directly with PPAR to modulate its activity. PPAR
cotransfection
attenuated the transcriptional activation of an nuclear
factor-
B-responsive promoter in a ligand-dependent manner (Staels et
al., 1998
): if these transcription factors were mutually antagonistic,
it could explain the down-regulation of CYP4A10 by LPS in liver.
The possible reasons for the species differences in the responses of
hepatic CYP4A mRNAs to LPS are less obvious. CYP4A10 and CYP4A14 are
induced in mouse kidney but not in liver, in contrast to the F344 rat,
in which CYP4A mRNAs are induced in both tissues (Sewer et al., 1996a
).
It is likely that species differences in induction of CYP4A by LPS
treatment are due to genetically controlled factors affecting the
general response to LPS or the generation of PPAR ligands during inflammation.
Constitutive expression of genes encoding peroxisomal enzymes (e.g.,
ACO and BIEN), microsomal CYP4A enzymes, and basal levels of
peroxisomes are similar between male (
/
) and (+/+) mice on a mixed
genetic background (C57BL/6N × Sv/129) (Lee et al., 1995
). These
results are consistent with another study that used purebred male
Sv/129 mice (Aoyama et al., 1998
). In contrast, our study shows that
the levels of CYP4A10, ACO, and BIEN mRNAs in purebred female Sv/129
(
/
) mice are significantly lower than in (+/+) mice, suggesting
that in female mice, a low level of constitutive activation by PPAR
occurs. The apparent discrepancy could be due to inherent differences
between sexes, because there are significant differences in the
phenotype between male and female (
/
) and (+/+) mice (Costet et
al., 1998
; Djouadi et al., 1998
).
Another novel finding of this study is that expression of the mRNA
encoding the hepatic acute-phase gene, fibrinogen, is induced by the
peroxisome proliferator clofibrate. In contrast, Corton et al. (1998)
recently reported that expression of fibrinogen mRNA was suppressed by
peroxisome proliferators. This disparity could be attributed to several
possibilities. In this study, the acute effect of clofibrate (24 h) was
examined, whereas Corton et al. (1998)
used chronic treatment (1-13
weeks) with either diethylhexyl phthalate or WY-14,643. PPAR-dependent
gene expression can be influenced by protein-protein interactions with
coactivators and/or corepressors (Dowell et al., 1997
). Thus,
differences in the levels of coactivators and/or corepressors could
explain why acute activation of PPAR
by clofibrate causes increases
in fibrinogen mRNA, whereas chronic exposure results in decreases in
this mRNA. Clearly, further work is needed to identify the mechanisms
underlying this difference. Peroxisome proliferators are known to
activate Kupffer cells, resulting in stimulation of tumor necrosis
factor-
production in the liver (Rose et al., 1998
). This suggests
that the release of inflammatory cytokines by Kupffer cells after
clofibrate treatment could contribute to the increase in acute-phase
proteins. Whether the PPAR
is required for Kupffer cell activation
by peroxisome proliferators has not been reported. In this study, the
acute induction of fibrinogen mRNA by clofibrate occurred through a PPAR
-independent mechanism. In contrast, subsequent chronic
down-regulation clearly requires the receptor (Corton et al., 1998
).
The down-regulation of multiple CYPs that occurs during inflammation
can be mimicked by the treatment with inflammatory cytokines in vivo
and in vitro (hepatocyte cultures; Morgan, 1997
). This study examined
the effect of LPS and peroxisome proliferator treatment on CYP mRNA
expression in (
/
) mice. LPS and clofibrate administration caused
decreases in mRNAs encoding CYP2A5, CYP2C29, and CYP3A11, effects that
were attenuated or blocked in the PPAR
(
/
) mice. The results
with clofibrate are consistent with the observations that peroxisome
proliferator-induced down-regulation of CYPs (Corton et al., 1998
) and
other genes, including apolipoproteins A-I and C-III (Motojima et al.,
1997
; Peters et al., 1997
), requires the PPAR
. However, the results
with LPS suggest that the PPAR
is also implicated in the
down-regulation of CYPs during inflammation. Because the effects of LPS
on CYP2C29 and CYP2A5 expression were not completely absent in the
PPAR
(
/
) mice, it is likely that both PPAR
-dependent and
PPAR
-independent pathways are involved in the down-regulation of
these CYPs.
Our study confirms the hypothesis that PPAR
was involved in the
induction of CYP4A during endotoxemia. More surprising was the finding
that PPAR
appears to have a role in CYP down-regulation in this
model as well. This work adds to the growing body of information on the
relationship between peroxisome proliferation and inflammation. We show
here that not only is inflammation associated with PPAR activation, but
peroxisome proliferators activate acute-phase gene expression. The
exact role of PPAR in pathology and homeostasis of the inflammatory
response remains to be determined.
| |
Acknowledgments |
|---|
The excellent technical assistance of Qi Chen is gratefully acknowledged.
| |
Footnotes |
|---|
Accepted for publication April 27, 1999.
Received for publication December 18, 1998.
1 This work was supported by Grant GM-46897 from the National Institutes of Health (to E.T.M.). A preliminary report was presented at the 10th International Symposium on Cytochrome P-450, Biochemistry, Biophysics, and Molecular Biology, San Francisco, California, August 1997.
Send reprint requests to: Dr. Edward T. Morgan, Department of Pharmacology, Emory University, Atlanta, GA 30322. E-mail: etmorga{at}bimcore.emory.edu
| |
Abbreviations |
|---|
LPS, lipopolysaccharide;
ACO, acyl-CoA oxidase;
AGP,
1-acid glycoprotein;
BIEN, peroxisomal bifunctional
enzyme enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase;
CYP, cytochrome P-450;
GAP, glyceraldehyde 3-phosphate dehydrogenase;
PPAR, peroxisome proliferator-activated receptor;
RXR, retinoid X receptor.
| |
References |
|---|
|
|
|---|
(PPAR
).
J Biol Chem
273:
5678-5684
-leukotriene B4 pathway to inflammation control.
Nature (Lond)
384:
39-43[Medline].
B activation and subsequent cytokine production.
Biochem Biophys Res Commun
225:
134-140[Medline].
.
J Natl Cancer Inst
90:
1702-1709
controls the hepatic CYP4A induction adaptive response to starvation and diabetes.
J Biol Chem
273:
31582-31589.
isoform of the peroxisome proliferator-activated receptor gene in mice results in abolishment of the pleiotropic effects of peroxisome proliferators.
Mol Cell Biol
15:
3012-3022[Abstract].
mediates peroxisome proliferator-induced transcriptional repression of nonperoxisomal gene expression in mouse.
Biochem Biophys Res Commun
230:
155-158[Medline].
, interleukin-6, and dexamethasone in cultured fetal rat hepatocytes.
Biochem Pharmacol
54:
889-898[Medline].
-deficient mice.
J Biol Chem
272:
27307-27312
but not by PPAR
activators.
Nature (Lond)
393:
790-793[Medline].This article has been cited by other articles:
![]() |
T. Mori, H. Kondo, T. Hase, I. Tokimitsu, and T. Murase Dietary Fish Oil Upregulates Intestinal Lipid Metabolism and Reduces Body Weight Gain in C57BL/6J Mice J. Nutr., December 1, 2007; 137(12): 2629 - 2634. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Petrick and C. D. Klaassen Importance of Hepatic Induction of Constitutive Androstane Receptor and Other Transcription Factors That Regulate Xenobiotic Metabolism and Transport Drug Metab. Dispos., October 1, 2007; 35(10): 1806 - 1815. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Hanniman, G. Lambert, Y. Inoue, F. J. Gonzalez, and C. J. Sinal Apolipoprotein A-IV is regulated by nutritional and metabolic stress: involvement of glucocorticoids, HNF-4{alpha}, and PGC-1{alpha} J. Lipid Res., November 1, 2006; 47(11): 2503 - 2514. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kondo, Y. Minegishi, Y. Komine, T. Mori, I. Matsumoto, K. Abe, I. Tokimitsu, T. Hase, and T. Murase Differential regulation of intestinal lipid metabolism-related genes in obesity-resistant A/J vs. obesity-prone C57BL/6J mice Am J Physiol Endocrinol Metab, November 1, 2006; 291(5): E1092 - E1099. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. C. Kupper, E. Gaquerel, E.-M. Boneberg, S. Morath, J.-P. Salaun, and P. Potin Early events in the perception of lipopolysaccharides in the brown alga Laminaria digitata include an oxidative burst and activation of fatty acid oxidation cascades J. Exp. Bot., June 1, 2006; 57(9): 1991 - 1999. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Richardson, M. Sherman, L. Antonovic, S. S. Kardar, H. W. Strobel, D. Kalman, and E. T. Morgan HEPATIC AND RENAL CYTOCHROME P450 GENE REGULATION DURING CITROBACTER RODENTIUM INFECTION IN WILD-TYPE AND TOLL-LIKE RECEPTOR 4 MUTANT MICE Drug Metab. Dispos., March 1, 2006; 34(3): 354 - 360. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Richardson, M. Sherman, D. Kalman, and E. T. Morgan EXPRESSION OF UDP-GLUCURONOSYLTRANSFERASE ISOFORM mRNAS DURING INFLAMMATION AND INFECTION IN MOUSE LIVER AND KIDNEY Drug Metab. Dispos., March 1, 2006; 34(3): 351 - 353. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Richardson and E. T. Morgan Hepatic Cytochrome P450 Gene Regulation during Endotoxin-Induced Inflammation in Nuclear Receptor Knockout Mice J. Pharmacol. Exp. Ther., August 1, 2005; 314(2): 703 - 709. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Teng and M. Piquette-Miller The Involvement of the Pregnane X Receptor in Hepatic Gene Regulation during Inflammation in Mice J. Pharmacol. Exp. Ther., February 1, 2005; 312(2): 841 - 848. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. t. Dieck, F. Doring, D. Fuchs, H.-P. Roth, and H. Daniel Transcriptome and Proteome Analysis Identifies the Pathways That Increase Hepatic Lipid Accumulation in Zinc-Deficient Rats J. Nutr., February 1, 2005; 135(2): 199 - 205. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-W. Kim, K. Park, E. Kwak, E. Choi, S. Lee, J. Ham, H. Kang, J. M. Kim, S. Y. Hwang, Y.-Y. Kong, et al. Activating Signal Cointegrator 2 Required for Liver Lipid Metabolism Mediated by Liver X Receptors in Mice Mol. Cell. Biol., May 15, 2003; 23(10): 3583 - 3592. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pan, Q. Xiang, S. Ball, J. Scatina, J. Kao, and J.-Y. Hong Lipopolysaccharide-Mediated Modulation of Cytochromes P450 in Stat1 Null Mice Drug Metab. Dispos., April 1, 2003; 31(4): 392 - 397. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Pass, W. Becker, R. Kluge, K. Linnartz, L. Plum, K. Giesen, and H.-G. Joost Effect of Hyperinsulinemia and Type 2 Diabetes-Like Hyperglycemia on Expression of Hepatic Cytochrome P450 and Glutathione S-Transferase Isoforms in a New Zealand Obese-Derived Mouse Backcross Population J. Pharmacol. Exp. Ther., August 1, 2002; 302(2): 442 - 450. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Akiyama, C. J. Nicol, C. Fievet, B. Staels, J. M. Ward, J. Auwerx, S. S. T. Lee, F. J. Gonzalez, and J. M. Peters Peroxisome Proliferator-activated Receptor-alpha Regulates Lipid Homeostasis, but Is Not Associated with Obesity. STUDIES WITH CONGENIC MOUSE LINES J. Biol. Chem., October 12, 2001; 276(42): 39088 - 39093. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Cui, H. Kawashima, T. B. Barclay, J. M. Peters, F. J. Gonzalez, E. T. Morgan, and H. W. Strobel Molecular Cloning and Regulation of Expression of Two Novel Mouse CYP4F Genes: Expression in Peroxisome Proliferator-Activated Receptor alpha -Deficient Mice upon Lipopolysaccharide and Clofibrate Challenges J. Pharmacol. Exp. Ther., April 13, 2001; 296(2): 542 - 550. [Abstract] [Full Text] |
||||
![]() |
E. T. Morgan Regulation of Cytochrome P450 by Inflammatory Mediators: Why and How? Drug Metab. Dispos., March 1, 2001; 29(3): 207 - 212. [Abstract] [Full Text] |
||||
![]() |
S. R. Mitchell, M. B. Sewer, S. S. Kardar, and E. T. Morgan Characterization of Cyp4a Induction in Rat Liver by Inflammatory Stimuli: Dependence on Sex, Strain, and Inflammation-Evoked Hypophagia Drug Metab. Dispos., January 1, 2001; 29(1): 17 - 22. [Abstract] [Full Text] |
||||
![]() |
K. W. Renton and T. E. Nicholson Hepatic and Central Nervous System Cytochrome P450 Are Down-Regulated during Lipopolysaccharide-Evoked Localized Inflammation in Brain J. Pharmacol. Exp. Ther., August 1, 2000; 294(2): 524 - 530. [Abstract] [Full Text] |
||||
![]() |
A. P. Beigneux, A. H. Moser, J. K. Shigenaga, C. Grunfeld, and K. R. Feingold The Acute Phase Response Is Associated with Retinoid X Receptor Repression in Rodent Liver J. Biol. Chem., May 19, 2000; 275(21): 16390 - 16399. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||