![]() |
|
|
Vol. 288, Issue 2, 671-678, February 1999
The R. W. Johnson Pharmaceutical Research Institute Spring House, Pennsylvania (B.P.D., W.C., R.J.S., A.L.D., C.K.D., L.dG., P.A.G.); General Atomics Court, San Diego, California (W.F., K.N.); and Department of Immunology, The Scripps Research Institute, La Jolla, California (R.D.Y.)
| |
Abstract |
|---|
|
|
|---|
We developed mice deficient in protease-activated receptor-2 (PAR-2) or
PAR-1 to explore the pathophysiological functions of these receptors.
In this report, we evaluated mean arterial pressure and heart rate (HR)
changes in response to PAR-1 or PAR-2 activation in anesthetized
wild-type (WT), PAR-1-deficient (PAR-1-/-), and
PAR-2-deficient (PAR-2-/-) mice. In WT mice, TFLLRNPNDK, a
PAR-1 selective activating peptide, caused hypotension and HR decreases
at 1 µmol/kg. TFLLRNPNDK also caused secondary hypertension following
L-NAME pretreatment. These responses were absent in
PAR-1
/
mice. In WT mice, SLIGRL, a PAR-2 selective
activating peptide, caused hypotension without changing HR at 0.3 µmol/kg. SLIGRL did not induce hypertension following
N
-nitrol-arginine-methyl ester-HCl
(L-NAME). The response to SLIGRL was absent in
PAR-2-/- mice. SFLLRN, a nonselective receptor activating
peptide caused hypotension and HR decreases in WT mice at 0.3 µmol/kg, as well as secondary hypertension following
L-NAME. SFLLRN still induced hypotension in
PAR-1
/
mice, but HR decrease and secondary hypertension
following L-NAME were absent. The hypotensive and
bradycardic responses to SFLLRN and TFLLRNPNDK in
PAR-2
/
mice were accentuated compared with WT mice. By
using mouse strains deficient in either PAR-1 or PAR-2, we confirmed
the in vivo specificity of TFLLRNPNDK and SLIGRL as respective
activating peptides for PAR-1 and PAR-2, and the distinct hemodynamic
responses mediated by activation of PAR-1 or PAR-2. Moreover, the
accentuated response to PAR-1 activation in PAR-2-deficient mice
suggests a compensatory response and potential receptor cross-talk.
| |
Introduction |
|---|
|
|
|---|
Protease-activated
receptors belong to a novel emerging family of seven-transmembrane, G
protein-coupled receptors that are activated by proteolysis. Because
proteases are common enzymes in organisms and receptor activation is
catalytic, such receptors represent an efficient means to modulate
cellular responses. Thus far, only four receptors belonging to this
family have been described. The thrombin receptor or protease-activated
receptor-1 (PAR-1) is cleaved and activated by
-thrombin (Vu et al.,
1991
) and mediates several cellular functions of thrombin such as
induction of platelet aggregation (Vu et al., 1991
), stimulation of
cell proliferation (McNamara et al., 1993
), and modulation of vascular
tone (Muramatsu et al., 1992
; Ku and Zaleski, 1993
). Since the
identification of PAR-1, three receptor homologs designated PAR-2,
PAR-3, and PAR-4 have been identified. PAR-3 and PAR-4 are distinct
proteolytically activated receptors for
-thrombin (Ishihara et al.,
1997
; Kahn et al., 1998
). PAR-2 was serendipitously identified by
homology cloning of a mouse genomic library (Nystedt et al., 1994
).
Unlike PAR-1, PAR-3, and PAR-4, the physiologic activator of PAR-2 has not been identified. This has made elucidation of its potential physiologic or pathophysiologic roles more difficult. In vitro studies
show that trypsin cleaves the extracellular amino terminus of PAR-2 to
generate a tethered ligand and activate the receptor (Nystedt et al.,
1994
), analogous to PAR-1. Given the expression of PAR-2 in stomach and
intestine (Nystedt et al., 1994
, 1995
), as well as the synthesis and
secretion of trypsin in the gastrointestinal tract, trypsin activation
of PAR-2 has been suggested to play a role in gastrointestinal
pathophysiology (Kong et al., 1997
). However, trypsin is unlikely to
represent the physiologic agonist for PAR-2 in the vascular compartment
and most extracellular spaces because of the absence of trypsin at
these sites. Tryptase has also been reported to activate PAR-2 and may
be a more likely proteolytic activator of PAR-2 (Corvera et al., 1997
;
Fox et al., 1997
; Mirza et al., 1997
; Molino et al., 1997a
). Because
mast cells release tryptase as part of an inflammatory response and PAR-2 is up-regulated by several inflammatory mediators such as tumor
necrosis factor-
and interleukin-1, PAR-2 has been suggested to
participate in inflammatory responses (Nystedt et al., 1996
; Corvera et
al., 1997
). PAR-2 is expressed in vascular endothelial cells, where it
mediates proliferation (Mirza et al., 1997
) and nitric oxide release
(Saifeddine et al., 1996
), and in vascular smooth muscle cells
(Saifeddine et al., 1996
), where it appears to induce proliferation
(Bono et al., 1997
). Moreover, the accumulation of mast cells in human
atherosclerotic lesions (Kaartinen et al., 1994
; Jeziorska et al.,
1997
) may activate these vascular PAR-2 receptors, suggesting a
potential role for this receptor in vascular injury and inflammatory responses.
An alternative approach to defining physiological functions of
protease-activated receptors involves assessing the responses to
receptor activation. Specific receptor activating peptides activate the
receptor by mimicking the tethered peptide activating sequence
contained within the receptor (Vu et al., 1991
; Nystedt et al., 1994
).
This approach has revealed several functions of PAR-2 activation
including vasodilatation of isolated vascular preparations (Saifeddine
et al., 1996
), vasodilatation of coronary vasculature in isolated
perfused hearts (Haertlein et al., 1996
), and stimulation of
contraction in isolated gastric tissue (Saifeddine et al., 1996
). In
addition, evidence in rats (Hwa et al., 1996
; Emilsson et al., 1997
)
and mice (Cheung et al., 1998
) have shown that activation of PAR-2
decreases arterial pressure, presumably as a result of arterial
vasodilatation. This in vivo response is similar to that caused by
PAR-1 activation in vivo. However, the PAR-1 response is more complex,
consisting of an initial arterial pressure decrease followed by an
arterial pressure increase (Cheung et al., 1998
). This hemodynamic
profile is consistent with isolated vascular tissue studies showing
that
-thrombin and PAR-1 receptor activating peptides induce both
vasodilatation and vasoconstriction (Muramatsu et al., 1992
; Ku and
Zaleski, 1993
).
Differentiation of the specific PAR-1 and PAR-2 responses using
receptor activating peptides is compromised because these peptides may
not be selective (Blackhart et al., 1996
). Moreover, these peptides may
also activate as yet unidentified protease-activated receptors or
elicit other responses not meditated by protease-activated receptors.
Therefore, we developed and used mice deficient in PAR-2 or PAR-1 to
define the specific cardiovascular responses mediated by PAR-2 and
PAR-1 activation in vivo and the specificity of these receptor
activating peptides. Arterial pressure and heart rate (HR) responses to
i.v. infused SLIGRL, a PAR-2 selective peptide, TFLLRNPNDK, a PAR-1
selective activating peptide, and SFLLRN, a PAR-1 and PAR-2 receptor
activating peptide, were assessed in wild type (WT) and PAR-1- and
PAR-2-deficient mice.
| |
Materials and Methods |
|---|
|
|
|---|
Generation of PAR-1- and PAR-2-Deficient Mice
A 129/simian virus mouse genomic DNA fragment [~14 kilobases (kb)] containing the PAR-2 gene was cloned and characterized by restriction mapping. A 1.3-kb EcoRI-HindIII fragment of the PAR-2 gene was prepared by polymerase chain reaction (PCR) using oligonucleotides 5'-GCATACACATCTGCAGACCAG-3' and 5'-GCTGGTCTCAGAT TCCTTAAG-3' and was placed 5' of the neomycin-resistant gene cassette in the targeting construct. A 5.5-kb SalI-EcoRI DNA fragment covering part of exon 2 and the 3' flanking region of the PAR-2 gene was placed 3' of the neo cassette (Fig. 1A). A herpes simplex virus thymidine kinase gene cassette was also placed at the 3' end of the construct for negative selection (Fig. 1A). The construct DNA was introduced into E14 embryonic stem (ES) cells by electroporation. Transfected ES cells were subjected to drug selection using 400 µg/ml of G418 (Geneticin; Gibco/BRL, Gaithersburg, MD) and 2 µM gancyclovir (Cytosin; Syntex Corp, Palo Alto, CA). ES cells with the targeted gene were detected by PCR using the PAR-2 gene-specific oligonucleotide 5'-GTCCTCTTAACCGATGAGC CCTCTC-3' and the neomycin-specific oligonucleotide 5'-TACCCGGTAGAATTG ACCTGCAG-3'. Targeted ES cell clones were injected into C57BL/6 blastocysts. Chimeras were bred with C57BL/6J mice and germline transmission was obtained. PAR-2 heterozygous mice were bred and offspring were genotyped using PCR analyses of tail DNA (Fig. 1B) with the following 5'-3' primers: mPAR-2 WT upper, CTTGTCGCCCTCTGCCTGTCG; mPAR-2 WT lower, GCCACTGTTAGCCGGTTA GGATGC; and mPAR-2 neomycin-specific upper, GTGGGGGTGGGGTGGG ATTAGATA.
|
To confirm absence of PAR-2 RNA, RNA was isolated from kidney and small
intestine of PAR-2+/+,
PAR-2+/
, and PAR-2
/
mice, poly A selected (Gibco/BRL) and used for Northern blot analyses
as previously described (Darrow et al., 1996
). A 432-basepair PAR-2
probe corresponding to nucleotides 154 to 585 of the murine PAR-2
coding sequence 23 was radiolabeled by random primer incorporation of
32P dCTP (Gibco/BRL). Northern blots were
subsequently probed with human
-actin sequences (Clontech, Palo
Alto, CA) for normalization (Fig. 1C).
The gene for the thrombin receptor (PAR-1) was disrupted in mice by
homologous recombination as described previously (Darrow et al., 1996
).
Animal Preparation
All procedures involving the use of animals were performed in
accordance with the Guide for the Care and Use of Laboratory Animals
(1996) and the Animal Care and Use Committee, The R.W. Johnson
Pharmaceutical Research Institute. A total of 32 male mice, 16 normal
WT, 8 homozygous PAR-1-deficient mice
(PAR-1
/
), and 8 homozygous PAR-2-deficient
mice (PAR-2
/
) were used. Three mice
heterozygous for each receptor (PAR-1+/
and
PAR-2 +/
) were also studied. However, the
cardiovascular responses of these heterozygotes was indistinguishable
from WT and therefore are not discussed in detail in this report.
Mice with different genotypes were evaluated randomly, with the investigator unaware of genotype. Mice, at least 4 months old and weighing 30 to 35 g, were initially anesthetized with isoflurane (1.25%). A tracheal cannula (PE-90) was implanted via a midline cervical incision. Using a rodent respirator (Harvard Apparatus, South Natick, MA), mice were ventilated with 95% O2/5% CO2 containing 0.75% isoflurane at a tidal volume of 0.2 ml and 140 breaths/min. Body temperature was maintained at 38°C with a heating lamp and a proportional temperature controller (Yellows Springs Instrument, Yellow Springs, OH). Subdermal needle electrodes were inserted for recording lead II electrocardiogram. A Teflon catheter (AWG30 tubing) tapered at one end and filled with saline containing heparin (10 U/ml) was inserted into the right carotid artery and advanced to the thoracic aorta. The catheter was attached to a Statham P50 pressure transducer (Spectramed, Oxnard, CA) for recording arterial blood pressure. Another catheter, constructed from Micro-Renathane MRE-033 tubing (Braintree Scientific, Inc. Braintree, MA), was inserted into the right jugular vein for administration of drugs and peptides. Arterial pressure and ECG signals were displayed on a Gould chart recorder and digitized and analyzed with a Po-Ne-Mah HD5/16/SW Cardiovascular Analysis System (Gould Instruments, Valley View, OH). Systolic, diastolic and mean arterial pressures (MAP), as well as HR, were measured continuously throughout the study. The preparation was allowed to stabilize for at least 30 to 60 min before the start of the experiment.
Chemicals and Peptides
Receptor activating peptides, SLIGRL-NH2,
SFLLRN-NH2, and
TFLLRNPNDK-NH2, were synthesized at the R.W.
Johnson Pharmaceutical Research Institute, San Diego, CA.
N
-Nitro-L-arginine-methyl ester-HCl (L-NAME;
Alexis Corporation, San Diego, CA) and receptor activating peptides
were dissolved in saline and infused into the jugular vein. To deliver
doses of peptides and compounds accurately and in a small volume, each
dose was prepared in a 4-µl volume and then loaded into the venous
catheter containing 15 µl of saline. Fifty microliters of saline was
then infused over 1 min using an infusion pump (model 55-111, Harvard Apparatus).
Experimental Protocol
Following control measurements,
SFLLRN-NH2, a PAR-1 and PAR-2 activating peptide,
was administered as an i.v. bolus infusion at 0.3 µmol/kg. Arterial
pressure and HR were monitored for 15 min.
SLIGRL-NH2, a selective PAR-2 activating peptide,
was then infused i.v. at 0.3 µmol/kg and the response monitored for
15 min. Then, TFLLRNPNDK-NH2, a receptor
activating peptide that, unlike SFLLRN, is selective for PAR-1, was
administered in a similar fashion at 1 µmol/kg in the same mouse.
Fifteen minutes following the final peptide infusion,
L-NAME, an inhibitor of nitric oxide synthesis, was infused
i.v. at 30 mg/kg as a bolus. Five minutes after L-NAME
administration, SFLLRN-NH2,
SLIGRL-NH2, and
TFLLRNPNDK-NH2 were administered at the same
doses as described above. In three PAR-1
/
and
three PAR-2
/
mice, higher doses of the
respective receptor activating peptides, TFLLRNPNDK (10 µmol/kg) or
SLIGRL (3 µmol/kg), were tested. In addition, in three WT and three
PAR-2-deficient mice, the response to acetylcholine (1 µg/kg) and
angiotensin (0.1 µg/kg) was evaluated before the start of the
receptor activating peptide studies.
Data Analysis
Arterial pressure and ECG signals were acquired at an analog-to-digital sampling rate of 250 Hz. MAP and HR were determined over a 5-s sampling interval every 5 s. Baseline values were determined by averaging the measurements for 20 s before each treatment. All data are expressed as mean ± S.E. Statistical significance of the differences in the maximum responses in WT and PAR-2 and PAR-1 mice was determined using one-way ANOVA and Dunnet's test. P values less than 0.05 were considered statistically significant.
| |
Results |
|---|
|
|
|---|
Characterization of PAR-2-Deficient Mice
Matings of heterozygous pairs of mice were carried out through
four cycles. Litter size ranged from 6 to 12 offspring. Of 419 mice
analyzed, 28.4% were WT (+/+), 54.9% were heterozygous (+/
), and
16.7% were homozygous (
/
), which represents a significant variation (p < .005) from the expected Mendelian ratio
(25:50:25). Furthermore, 20.0% of all PAR-2
/
mice were either stillborn or found dead within 48 h of birth in
comparison to 8.4% and 6.4% of PAR-2+/+ and
+/
mice, respectively (p < .005). Five pups from each genotype, which died within 48 h of
birth, were analyzed for anatomical and histological defects. No
abnormalities were observed in any of these mice. The cause of this
mortality is currently unknown. The remaining animals proceeded to
maturity apparently without incident. Surviving
PAR-2
/
mice appeared normal upon gross
anatomical and histological analysis. In addition, mating of
PAR-2
/
males with
PAR-2
/
females resulted in normal litter size
and offspring.
In contrast, matings between PAR-1
/
mice
occurred less frequently and generally produced much smaller
litter sizes, as has been previously reported (Connolly et al., 1996
;
Darrow et al., 1996
).
Baseline Hemodynamic Parameters in PAR-2-Deficient Mice
Baseline arterial pressure and HR were not significantly different
in PAR-1- and PAR-2-deficient mice compared with WT mice (Table
1). Baseline arterial pressure and HR
following L-NAME were also not significantly different in
PAR-1- and PAR-2-deficient mice compared with WT mice (Table 1). In
addition, the hypotensive response to acetylcholine (1 µg/kg) and the
hypertensive response to angiotensin (0.1 µg/kg) was not different in
three WT mice (
17 ± 2 and +23 ± 10 mm Hg, respectively)
and three PAR-2-deficient mice (
23 ± 5 and +30 ± 8 mm Hg,
respectively). The lack of effect of PAR-1 deficiency on responses to
angiotensin and acetylcholine have been reported previously using a
slightly different protocol (Darrow et al., 1996
).
|
Hemodynamic Responses to Receptor Activating Peptides in PAR-2- and PAR-1-Deficient Mice
Effects of SLIGRL.
SLIGRL (0.3 µmol/kg), a selective PAR-2
receptor activating peptide, was used to assess the loss of PAR-2
receptor function. Recent studies have shown that i.v. SLIGRL causes a
marked, dose-dependent hypotension in normal anesthetized mice without
affecting HR (Cheung et al., 1998
). The duration of the hypotensive
response to SLIGRL tended to be somewhat greater than that caused by
PAR-1 activation. The present results confirm this profile in WT mice
(Fig. 2, left and Fig. 5). However, three
of the eight WT mice had a brief period of increased HR. Pretreatment
with L-NAME, an inhibitor of nitric oxide
synthesis, reduced the duration of the hypotensive response without
affecting the maximum decrease in arterial pressure. SLIGRL did not
affect HR following L-NAME treatment (data not shown).
|
/
mice before
or after L-NAME (Fig. 2, right and Fig. 5). In three PAR-2
/
mice, a 10-fold higher dose of SLIGRL
(3 µmol/kg) had no effect on arterial pressure (data not shown).
These results confirm the lack of expression of PAR-2 in the
receptor-deficient mice and demonstrate that the hypotensive response
to SLIGRL is due exclusively to activation of PAR-2. The response to
SLIGRL in PAR-1
/
mice was similar to that in
WT mice, including a slight increase in HR (Fig. 2, middle).
Effects of TFLLRNPNDK.
TFLLRNPNDK is a selective PAR-1
receptor activating peptide (Blackhart et al., 1996
). As was shown
previously (Cheung et al., 1998
) and confirmed in the present studies,
PAR-1 activation with TFLLRNPNDK in anesthetized WT mice causes a
biphasic response consisting of transient hypotension followed by a
rapid return to baseline (Fig. 3, left
and Fig. 5). After L-NAME treatment, the transient
hypotension is followed by a small but consistent hypertensive
response. Also, as was documented previously (Cheung et al., 1998
), the
arterial pressure response is accompanied by an immediate but transient
decrease in HR (Figs. 3 and 5). In the present studies this bradycardia
was relatively small and followed by a brief period of increased HR.
Although the HR decrease was not significantly different from that in
PAR-1
/
mice, in which the response was absent, previous
studies have shown that higher doses of TFLLRNPNDK result in consistent
and marked HR decreases (Cheung et al., 1998
).
|
/
mice (Fig. 3, middle and Fig. 5). In
three PAR-1
/
mice, a 10-fold higher dose of
TFLLRNPNDK (10 µmol/kg) had no effect on arterial pressure or HR
(data not shown). In PAR-2
/
mice, the
arterial pressure response to TFLLRNPNDK, as well as the transient
HR decrease, was qualitatively similar to that in WT mice except that
the magnitude of the hypotensive response and transient HR decrease was
significantly greater (Fig. 3, right and Fig. 5). The hypertensive
response to TFLLRNPNDK following L-NAME in
PAR-2
/
mice was not different from WT.
Effects of SFLLRN.
SFLLRN is a PAR-1 receptor activating
peptide derived from the six amino-terminal amino acids of the human
PAR-1 tethered ligand. This peptide has been shown to cause a biphasic
arterial pressure response and transient HR decrease in anesthetized
mice similar to that induced by TFLLRNPNDK (Cheung et al., 1998
). This profile is confirmed in the present studies (Fig.
4, left and Fig.
5). The HR response is relatively small,
but our previous studies showed that higher SFLLRN doses produce
significantly greater reductions in HR. (Cheung et al., 1998
). Although
SFLLRN activates PAR-1, it is now known to also activate PAR-2
(Blackhart et al., 1996
). Thus, the hypotensive response to SFLLRN in
PAR-1
/
mice is not completely inhibited compared with
the response in WT mice (Fig. 4, middle and Fig. 5). As expected, the
SFLLRN-induced hypertensive response following L-NAME as
well as transient HR decrease, which are mediated exclusively by PAR-1
activation, were completely absent in PAR-1
/
mice. In
PAR-2
/
mice, SFLLRN caused hypotension, transient HR
decrease, and delayed hypertension following L-NAME similar
to that induced in WT mice (Fig. 4, right and Fig. 5). However, like
TFLLRNPNDK, SFLLRN-induced hypotension and transient HR reduction were
significantly greater in PAR-2
/
mice. The hypertensive
response to SFLLRN in PAR-2
/
mice was not affected.
|
|
| |
Discussion |
|---|
|
|
|---|
Using mouse strains deficient in PAR-1 or PAR-2, we confirmed the
specific vascular responses to PAR-1 or PAR-2 receptor activation in
vivo: PAR-2 activation results exclusively in hypotension without consistent changes in HR. The hypotension is presumably mediated by
vasodilatation. In contrast, PAR-1 activation induces both an initial
hypotensive response and HR decrease followed by hypertension. These
changes in arterial pressure reflect both a vasodilatation and
vasoconstrictor response. Furthermore, the accentuated PAR-1 response
in PAR-2
/
mice suggests possible compensatory
changes in PAR-1 expression or intracellular signaling, or other
changes downstream from PAR-1 receptor activation.
Our previous studies in WT anesthetized mice (Cheung et al., 1998
)
documented the nature of these distinct receptor-specific responses by
evaluating the hemodynamic dose responses to i.v. TFLLRNPNDK and
SLIGRL, specific receptor activating peptides for PAR-1 and PAR-2,
respectively. However, these studies could not exclude the possibility
that TFLLRNPNDK or SLIGRL might have other actions not involving PAR-1
or PAR-2. PAR-3 and PAR-4, two recently identified protease-activated
thrombin receptors (Ishihara et al., 1997
; Kahn et al., 1998
), do not
appear to be activated in vitro by SFLLRN or SLIGRL. However, their
identification presents the possibility that activation of an as yet
unidentified protease-activated receptor may contribute to in vivo
responses to TFLLRNPNDK and SLIGRL. Moreover, the receptor activating
peptides may have other actions not involving protease-activated
receptors. The present studies, by revealing the complete absence of
hemodynamic actions of SLIGRL in PAR-2-deficient mice and the complete
absence of hemodynamic actions of TFLLRNPNDK in PAR-1-deficient mice,
provide direct evidence for the specificity of these receptor
activating peptides in vivo and confirm the nature of the hemodynamic
responses to PAR-1 and PAR-2 activation.
Our studies also report, for the first time, the successful
disruption of the PAR-2 gene in mice. Normal liter sizes of
heterozygous and homozygous matings, normal progression to maturity,
and normal gross anatomical and histological appearances of
PAR-2
/
mice suggests a lack of obvious impact
of PAR-2 deficiency on normal development and physiology. This result
is in contrast to previous studies of PAR-1-deficient mice in which
partial embryonic lethality was noted (Connolly et al., 1996
; Darrow et
al., 1996
). However, surviving PAR-1-deficient mice proceeded to
maturity and showed no gross anatomical or histological changes
(Connolly et al., 1996
; Darrow et al., 1996
). The lack of obvious
phenotype in PAR-1- or PAR-2-deficient mice may result from
compensatory responses that minimize the impact of PAR-2 or PAR-1
deficiency in development and normal physiology. The consequences of
PAR-2 deficiency may only be revealed in various pathological states and in response to pathological stimuli. These possibilities will require further testing of PAR-2
/
and
PAR-1
/
mice using various models of pathology.
The accentuated response to PAR-1 activation in
PAR-2
/
mice may be a manifestation of a
compensatory response to the PAR-2 receptor deficiency. For example,
PAR-1 expression may be increased in PAR-2-deficient mice. However, we
have no evidence for this at this time. Studies in human endothelial
cells have shown that PAR-1-specific antisense oligonucleotides reduce
the thrombin response but not the PAR-2 response (Mirza et al., 1996
).
Although the converse experiment was not done, this finding suggests
that the receptors are not linked in some way and do not require
coexpression for their activity. However, activation of PAR-2 resulted
in desensitization of both PAR-1 and PAR-2 (Mirza et al., 1996
).
Moreover, PAR-1 desensitization was associated with receptor
internalization (Mirza et al., 1996
). These results suggest receptor
"cross-talk" between PAR-1 and PAR-2. With respect to the present
findings, it is possible that a continuous low level of PAR-2
activation in vivo results in a certain rate of PAR-1 internalization.
When PAR-2 is not expressed, tonic internalization rate is reduced,
resulting in a greater expression of PAR-1. However, this hypothesis is
highly speculative. The exaggerated response is not likely to be a
result of overall alteration in vascular responsiveness because
baseline arterial pressure and HR were not different in
PAR-2
/
mice, and the arterial pressure
responses to angiotensin and acetylcholine were not altered in
PAR-2
/
mice compared with WT mice. It is
interesting that the hypertensive component of the PAR-1 response is
not increased in PAR-2-deficient mice. This may appear inconsistent
with the suggestion of up-regulation of PAR-1 in PAR-2-deficient mice.
However, the hypertensive component is relatively small, such that
small changes in this response may be difficult to detect or may be
masked by the opposing, more marked hypotensive actions of PAR-1
activation. It is also possible that the altered PAR-1 response does
not involve changes at the receptor level but rather, may result from
changes downstream from receptor activation such as intracellular
signaling or alteration in the expression or activity of other
mediators or receptors. Thus, alteration of autonomic regulation may
also play a role, because the response to PAR-1 activation in vivo
appears to have a significant vagal component (Damiano et al., 1996
;
Cheung et al., 1998
).
The enhanced response to PAR-1 activation in
PAR-2
/
mice suggests overlap in the
physiological and pathophysiological roles of PAR-1 and PAR-2. There
are a number of examples of expression of PAR-1 and PAR-2 in the same
cell type mediating similar functions. These include, for example,
stimulation of endothelial proliferation (Mirza et al., 1996
),
vasodilatation through release of nitric oxide from endothelial cells
(Ku and Zaleski, 1993
; Tesfamariam et al., 1993
; Saifeddine et al.,
1996
), induction of vascular smooth muscle cell proliferation (McNamara
et al., 1993
; Bono et al., 1997
) and stimulation of contraction of
isolated gastric smooth muscle (Yang et al., 1992
; Saifeddine et al.,
1996
). However, there are also several examples of divergence in the
expression and functions of PAR-1 and PAR-2. Only PAR-1 is found on
platelets, where it mediates thrombin-induced platelet aggregation
(D'Andrea et al., 1998
; Vu et al., 1991
). Endothelial cells express
both PAR-1 and PAR-2 but only PAR-2 is up-regulated by inflammatory mediators such as tumor necrosis factor-
and interleukin-1
(Nystedt et al., 1996
). In human keratinocytes, both PAR-1 and PAR-2
induce intracellular calcium transients (Santulli et al., 1995
).
However, PAR-1 activation in keratinocytes leads to stimulation of cell growth, whereas PAR-2 activation inhibits cell growth (Derian et al.,
1997
). Both PAR-1 and PAR-2 are expressed in vascular smooth muscle,
where their activation leads to intracellular calcium transients (Bono
et al., 1997
), but only PAR-1 activation leads to vascular smooth
muscle contraction (Muramatsu et al., 1992
; Ku and Zaleski, 1993
; Alani
et al., 1995
; Hwa et al., 1996
). The latter is the probable basis for
the in vivo hypertensive response to PAR-1 activation but not PAR-2
activation documented in our studies. Differences in protease
selectivity also suggest diverging roles for PAR-1 and PAR-2 (Molino et
al., 1997b
). The degree to which PAR-1 and PAR-2 regulation and
function are linked will require further investigation.
In conclusion, by using mouse strains deficient in either PAR-1 or PAR-2, we have confirmed the in vivo specificity of TFLLRNPNDK and SLIGRL, the receptor activating peptides for PAR-1 and PAR-2, respectively. The results also confirm the distinct hemodynamic responses mediated by activation of PAR-1 and PAR-2 in vivo. However, the apparent accentuation of some PAR-1 responses in PAR-2-deficient mice suggests a possible relationship between the functions of these two receptors. Like PAR-1 deficiency, PAR-2 deficiency does not appear to have obvious phenotypic effects. Thus, the potential consequences of either PAR-1 or PAR-2 deficiency may only be revealed in various pathological states. Our results support the further use of the selective receptor activating peptides as well as receptor-deficient mouse models for investigation of the physiological and pathophysiological roles of PAR-1 and PAR-2.
| |
Acknowledgments |
|---|
We thank Julie Culver, Michelle Courtney, Carol Burns, and the Laboratory Animal Medicine department for animal breeding and care and Kenway Hoey for the synthesis of all peptides used in this study.
| |
Footnotes |
|---|
Accepted for publication September 11, 1998.
Received for publication May 22, 1998.
Send reprint requests to: Bruce P. Damiano, Drug Discovery, R.W. Johnson Pharmaceutical Research Institute, Spring House, PA 19477. E-mail: bdamiano{at}prius.jnj.com
| |
Abbreviations |
|---|
PAR-1, protease-activated receptor-1;
PAR-2
protease-activated receptor-2, MAP, mean arterial pressure;
HR, heart
rate;
L-NAME, N
-nitro-L-arginine-methyl ester-HCl.
| |
References |
|---|
|
|
|---|
- or
-tryptases.
Blood
90:
3914-3922
Molecular characterization and evidence for functional coupling to the thrombin receptor.
J Clin Invest
97:
1705-1714[Medline].
development of bioassays for structure-activity studies.
Life Sci.
51:
1325-1332[Medline].
This article has been cited by other articles:
![]() |
M. Xue, M. D. Hollenberg, A. Demchuk, and V. W. Yong Relative Importance of Proteinase-Activated Receptor-1 Versus Matrix Metalloproteinases in Intracerebral Hemorrhage-Mediated Neurotoxicity in Mice Stroke, June 1, 2009; 40(6): 2199 - 2204. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Niessen, C. Furlan-Freguia, J. A. Fernandez, L. O. Mosnier, F. J. Castellino, H. Weiler, H. Rosen, J. H. Griffin, and W. Ruf Endogenous EPCR/aPC-PAR1 signaling prevents inflammation-induced vascular leakage and lethality Blood, March 19, 2009; 113(12): 2859 - 2866. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Laukkarinen, E. R. Weiss, G. J. D. van Acker, M. L. Steer, and G. Perides Protease-activated Receptor-2 Exerts Contrasting Model-specific Effects on Acute Experimental Pancreatitis J. Biol. Chem., July 25, 2008; 283(30): 20703 - 20712. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Moraes, R. Martin, J. D. Plumb, E. Vachon, C. M. Cameron, A. Danesh, D. J. Kelvin, W. Ruf, and G. P. Downey Role of PAR2 in murine pulmonary pseudomonal infection Am J Physiol Lung Cell Mol Physiol, February 1, 2008; 294(2): L368 - L377. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Jiang, A. Zatta, H. Kin, N. Wang, J. G. Reeves, J. Mykytenko, J. Deneve, Z.-Q. Zhao, R. A. Guyton, and J. Vinten-Johansen PAR-2 activation at the time of reperfusion salvages myocardium via an ERK1/2 pathway in in vivo rat hearts Am J Physiol Heart Circ Physiol, November 1, 2007; 293(5): H2845 - H2852. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Afkhami-Goli, F. Noorbakhsh, A. J. Keller, N. Vergnolle, D. Westaway, J. H. Jhamandas, P. Andrade-Gordon, M. D. Hollenberg, H. Arab, R. H. Dyck, et al. Proteinase-Activated Receptor-2 Exerts Protective and Pathogenic Cell Type-Specific Effects in Alzheimer's Disease J. Immunol., October 15, 2007; 179(8): 5493 - 5503. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Knecht, G. S. Cottrell, S. Amadesi, J. Mohlin, A. Skaregarde, K. Gedda, A. Peterson, K. Chapman, M. D. Hollenberg, N. Vergnolle, et al. Trypsin IV or Mesotrypsin and p23 Cleave Protease-activated Receptors 1 and 2 to Induce Inflammation and Hyperalgesia J. Biol. Chem., September 7, 2007; 282(36): 26089 - 26100. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ahamed, F. Niessen, T. Kurokawa, Y. K. Lee, G. Bhattacharjee, J. H. Morrissey, and W. Ruf Regulation of macrophage procoagulant responses by the tissue factor cytoplasmic domain in endotoxemia Blood, June 15, 2007; 109(12): 5251 - 5259. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Uusitalo-Jarvinen, T. Kurokawa, B. M. Mueller, P. Andrade-Gordon, M. Friedlander, and W. Ruf Role of Protease Activated Receptor 1 and 2 Signaling in Hypoxia-Induced Angiogenesis Arterioscler. Thromb. Vasc. Biol., June 1, 2007; 27(6): 1456 - 1462. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. McLaughlin, M. M. Patterson, and A. B. Malik Protease-activated receptor-3 (PAR3) regulates PAR1 signaling by receptor dimerization PNAS, March 27, 2007; 104(13): 5662 - 5667. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hirano The Roles of Proteinase-Activated Receptors in the Vascular Physiology and Pathophysiology Arterioscler. Thromb. Vasc. Biol., January 1, 2007; 27(1): 27 - 36. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Li, T. Nakagawa, N. Koyama, X. Wang, J. Jin, Y. Mizuno-Horikawa, J. Gu, E. Miyoshi, I. Kato, K. Honke, et al. Down-regulation of trypsinogen expression is associated with growth retardation in {alpha}1,6-fucosyltransferase-deficient mice: attenuation of proteinase-activated receptor 2 activity Glycobiology, October 1, 2006; 16(10): 1007 - 1019. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Leger, L. Covic, and A. Kuliopulos Protease-Activated Receptors in Cardiovascular Diseases Circulation, September 5, 2006; 114(10): 1070 - 1077. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Paria, A. M. Bair, J. Xue, Y. Yu, A. B. Malik, and C. Tiruppathi Ca2+ Influx Induced by Protease-activated Receptor-1 Activates a Feed-forward Mechanism of TRPC1 Expression via Nuclear Factor-{kappa}B Activation in Endothelial Cells J. Biol. Chem., July 28, 2006; 281(30): 20715 - 20727. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Holzhausen, L. C. Spolidorio, R. P. Ellen, M.-C. Jobin, M. Steinhoff, P. Andrade-Gordon, and N. Vergnolle Protease-Activated Receptor-2 Activation: A Major Role in the Pathogenesis of Porphyromonas gingivalis Infection Am. J. Pathol., April 1, 2006; 168(4): 1189 - 1199. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Noorbakhsh, S. Tsutsui, N. Vergnolle, L. A. Boven, N. Shariat, M. Vodjgani, K. G. Warren, P. Andrade-Gordon, M. D. Hollenberg, and C. Power Proteinase-activated receptor 2 modulates neuroinflammation in experimental autoimmune encephalomyelitis and multiple sclerosis J. Exp. Med., February 21, 2006; 203(2): 425 - 435. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Roviezzo, M. Bucci, V. Brancaleone, A. Di Lorenzo, P. Geppetti, S. Farneti, L. Parente, G. Lungarella, S. Fiorucci, and G. Cirino Proteinase-Activated Receptor-2 Mediates Arterial Vasodilation in Diabetes Arterioscler. Thromb. Vasc. Biol., November 1, 2005; 25(11): 2349 - 2354. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Noorbakhsh, N. Vergnolle, J. C. McArthur, C. Silva, M. Vodjgani, P. Andrade-Gordon, M. D. Hollenberg, and C. Power Proteinase-Activated Receptor-2 Induction by Neuroinflammation Prevents Neuronal Death during HIV Infection J. Immunol., June 1, 2005; 174(11): 7320 - 7329. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Moshal, N. Tyagi, B. Henderson, A. V. Ovechkin, and S. C. Tyagi Protease-activated receptor and endothelial-myocyte uncoupling in chronic heart failure Am J Physiol Heart Circ Physiol, June 1, 2005; 288(6): H2770 - H2777. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Riewald and W. Ruf Protease-activated Receptor-1 Signaling by Activated Protein C in Cytokine-perturbed Endothelial Cells Is Distinct from Thrombin Signaling J. Biol. Chem., May 20, 2005; 280(20): 19808 - 19814. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sharma, X. Tao, A. Gopal, B. Ligon, P. Andrade-Gordon, M. L. Steer, and G. Perides Protection against acute pancreatitis by activation of protease-activated receptor-2 Am J Physiol Gastrointest Liver Physiol, February 1, 2005; 288(2): G388 - G395. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. McGuire, M. Saifeddine, C. R. Triggle, K. Sun, and M. D. Hollenberg 2-Furoyl-LIGRLO-amide: A Potent and Selective Proteinase-Activated Receptor 2 Agonist J. Pharmacol. Exp. Ther., June 1, 2004; 309(3): 1124 - 1131. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mackman Role of Tissue Factor in Hemostasis, Thrombosis, and Vascular Development Arterioscler. Thromb. Vasc. Biol., June 1, 2004; 24(6): 1015 - 1022. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ahamed and W. Ruf Protease-activated Receptor 2-dependent Phosphorylation of the Tissue Factor Cytoplasmic Domain J. Biol. Chem., May 28, 2004; 279(22): 23038 - 23044. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Napoli, F de Nigris, J L Wallace, M D Hollenberg, G Tajana, G De Rosa, V Sica, and G Cirino Evidence that protease activated receptor 2 expression is enhanced in human coronary atherosclerotic lesions J. Clin. Pathol., May 1, 2004; 57(5): 513 - 516. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. S. OSSOVSKAYA and N. W. BUNNETT Protease-Activated Receptors: Contribution to Physiology and Disease Physiol Rev, April 1, 2004; 84(2): 579 - 621. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kawabata, S. Kubo, Y. Nakaya, T. Ishiki, R. Kuroda, F. Sekiguchi, N. Kawao, and H. Nishikawa Distinct roles for protease-activated receptors 1 and 2 in vasomotor modulation in rat superior mesenteric artery Cardiovasc Res, March 1, 2004; 61(4): 683 - 692. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Pawlinski, B. Pedersen, G. Schabbauer, M. Tencati, T. Holscher, W. Boisvert, P. Andrade-Gordon, R. D. Frank, and N. Mackman Role of tissue factor and protease-activated receptors in a mouse model of endotoxemia Blood, February 15, 2004; 103(4): 1342 - 1347. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kataoka, J. R. Hamilton, D. D. McKemy, E. Camerer, Y.-W. Zheng, A. Cheng, C. Griffin, and S. R. Coughlin Protease-activated receptors 1 and 4 mediate thrombin signaling in endothelial cells Blood, November 1, 2003; 102(9): 3224 - 3231. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Major, R. J. Santulli, C. K. Derian, and P. Andrade-Gordon Extracellular Mediators in Atherosclerosis and Thrombosis: Lessons From Thrombin Receptor Knockout Mice Arterioscler. Thromb. Vasc. Biol., June 1, 2003; 23(6): 931 - 939. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Robin, R. Kharbanda, P. Mclean, R. Campbell, and P. Vallance Protease-Activated Receptor 2-Mediated Vasodilatation in Humans In Vivo: Role of Nitric Oxide and Prostanoids Circulation, February 25, 2003; 107(7): 954 - 959. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. McGuire, J. Dai, P. Andrade-Gordon, C. R. Triggle, and M. D. Hollenberg Proteinase-Activated Receptor-2 (PAR2): Vascular Effects of a PAR2-Derived Activating Peptide via a Receptor Different than PAR2 J. Pharmacol. Exp. Ther., December 1, 2002; 303(3): 985 - 992. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Cenac, A.-M. Coelho, C. Nguyen, S. Compton, P. Andrade-Gordon, W. K. MacNaughton, J. L. Wallace, M. D. Hollenberg, N. W. Bunnett, R. Garcia-Villar, et al. Induction of Intestinal Inflammation in Mouse by Activation of Proteinase-Activated Receptor-2 Am. J. Pathol., November 1, 2002; 161(5): 1903 - 1915. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rahman, A. L. True, K. N. Anwar, R. D. Ye, T. A. Voyno-Yasenetskaya, and A. B. Malik G{alpha}q and G{beta}{gamma} Regulate PAR-1 Signaling of Thrombin-Induced NF-{kappa}B Activation and ICAM-1 Transcription in Endothelial Cells Circ. Res., September 6, 2002; 91(5): 398 - 405. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. F. Milia, M. B. Salis, T. Stacca, A. Pinna, P. Madeddu, M. Trevisani, P. Geppetti, and C. Emanueli Protease-Activated Receptor-2 Stimulates Angiogenesis and Accelerates Hemodynamic Recovery in a Mouse Model of Hindlimb Ischemia Circ. Res., August 23, 2002; 91(4): 346 - 352. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Napoli, F. De Nigris, C. Cicala, J. L. Wallace, G. Caliendo, M. Condorelli, V. Santagada, and G. Cirino Protease-activated receptor-2 activation improves efficiency of experimental ischemic preconditioning Am J Physiol Heart Circ Physiol, June 1, 2002; 282(6): H2004 - H2010. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Camerer, H. Kataoka, M. Kahn, K. Lease, and S. R. Coughlin Genetic Evidence That Protease-activated Receptors Mediate Factor Xa Signaling in Endothelial Cells J. Biol. Chem., May 3, 2002; 277(18): 16081 - 16087. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. McLean, D. Aston, D. Sarkar, and A. Ahluwalia Protease-Activated Receptor-2 Activation Causes EDHF-Like Coronary Vasodilation: Selective Preservation in Ischemia/Reperfusion Injury: Involvement of Lipoxygenase Products, VR1 Receptors, and C-Fibers Circ. Res., March 8, 2002; 90(4): 465 - 472. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E Cuffe, M. Bertog, S. Velazquez-Rocha, O. Dery, N. Bunnett, and C. Korbmacher Basolateral PAR-2 receptors mediate KCl secretion and inhibition of Na+ absorption in the mouse distal colon J. Physiol., February 15, 2002; 539(1): 209 - 222. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Fiorucci, A. Mencarelli, B. Palazzetti, E. Distrutti, N. Vergnolle, M. D. Hollenberg, J. L. Wallace, A. Morelli, and G. Cirino Proteinase-activated receptor 2 is an anti-inflammatory signal for colonic lamina propria lymphocytes in a mouse model of colitis PNAS, November 20, 2001; 98(24): 13936 - 13941. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Macfarlane, M. J. Seatter, T. Kanke, G. D. Hunter, and R. Plevin Proteinase-Activated Receptors Pharmacol. Rev., June 1, 2001; 53(2): 245 - 282. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. VOGEL, X. GAO, D. MEHTA, R. D. YE, T. A. JOHN, P. ANDRADE-GORDON, C. TIRUPPATHI, and A. B. MALIK Abrogation of thrombin-induced increase in pulmonary microvascular permeability in PAR-1 knockout mice Physiol Genomics, December 18, 2000; 4(2): 137 - 145. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Lindner, M. L. Kahn, S. R. Coughlin, G. R. Sambrano, E. Schauble, D. Bernstein, D. Foy, A. Hafezi-Moghadam, and K. Ley Delayed Onset of Inflammation in Protease-Activated Receptor-2-Deficient Mice J. Immunol., December 1, 2000; 165(11): 6504 - 6510. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Napoli, C. Cicala, J. L. Wallace, F. de Nigris, V. Santagada, G. Caliendo, F. Franconi, L. J. Ignarro, and G. Cirino From the Cover: Protease-activated receptor-2 modulates myocardial ischemia-reperfusion injury in the rat heart PNAS, March 28, 2000; 97(7): 3678 - 3683. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Vergnolle Proteinase-Activated Receptor-2-Activating Peptides Induce Leukocyte Rolling, Adhesion, and Extravasation In Vivo J. Immunol., November 1, 1999; 163(9): 5064 - 5069. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Raza, L. C. Nehring, S. D. Shapiro, and L. A. Cornelius Proteinase-activated Receptor-1 Regulation of Macrophage Elastase (MMP-12) Secretion by Serine Proteinases J. Biol. Chem., December 22, 2000; 275(52): 41243 - 41250. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Napoli, F. De Nigris, C. Cicala, J. L. Wallace, G. Caliendo, M. Condorelli, V. Santagada, and G. Cirino Protease-activated receptor-2 activation improves efficiency of experimental ischemic preconditioning Am J Physiol Heart Circ Physiol, June 1, 2002; 282(6): H2004 - H2010. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. McLean, D. Aston, D. Sarkar, and A. Ahluwalia Protease-Activated Receptor-2 Activation Causes EDHF-Like Coronary Vasodilation: Selective Preservation in Ischemia/Reperfusion Injury: Involvement of Lipoxygenase Products, VR1 Receptors, and C-Fibers Circ. Res., March 8, 2002; 90(4): 465 - 472. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||