JPET Assistant Professor of Medicine (Clinician-Educator)

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kawabata, A.
Right arrow Articles by Hollenberg, M. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kawabata, A.
Right arrow Articles by Hollenberg, M. D.

Vol. 288, Issue 1, 358-370, January 1999

Evaluation of Proteinase-Activated Receptor-1 (PAR1) Agonists and Antagonists Using a Cultured Cell Receptor Desensitization Assay: Activation of PAR2 by PAR1-Targeted Ligands

Atsufumi Kawabata2 , Mahmoud Saifeddine, Bahjat Al-Ani, Lorraine Leblond and Morley D. Hollenberg

Endocrine Research Group (A.K., M.S., B.A-A., M.D.H.), Department of Pharmacology and Therapeutics (M.D.H.) and Department of Medicine (M.D.H.), The University of Calgary, Faculty of Medicine, Calgary, Alberta, Canada; and BioChem Therapeutic Inc. (L.L.), Laval, Quebec, Canada


    Abstract
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

We developed a calcium signaling-based assay, using cultured human embryonic kidney cells (HEK), that evaluates simultaneously, the activation/desensitization or blockade of the proteinase-activated receptors, PAR1 and PAR2. Using this assay, we analyzed the actions of a number of previously described putative PAR1-targeted peptide agonists and antagonists. We found that most of the previously described PAR1-targeted agents can also activate/desensitize PAR2, and most of these peptides can also activate a calcium signaling pathway in a target cell that possesses PAR2 along with PAR1. Furthermore, we used this assay to develop a PAR1 receptor-activating probe [Ala-parafluoroPhe-Arg-Cha-Cit-Tyr-NH2 (Cit-NH2)], which displays a high degree of specificity for PAR1 over PAR2, and we used the assay to quantitate the ability of trypsin to disarm the activation of PAR1 by thrombin. The abilities of the PAR1-targeted agents to desensitize or block PAR1 in the HEK cell assay were compared with their activities in a human platelet aggregation assay. Our data illustrate the usefulness of the HEK cell assay for evaluating the PAR1/PAR2 selectivity of PAR-activating agonists. The PAR1-selective agonist that we developed using the assay should prove useful for studying the effects of selectively activating PAR1 in vivo.


    Introduction
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The G-protein-coupled receptors stimulated by thrombin (proteinase-activated receptor-1: PAR1) or by trypsin (PAR2) are activated by the proteolytic unmasking of anchored N-terminal cryptic receptor-activating sequences (SLIGKV and SLIGRL for human and rodent PAR2; SFLLR and SFFLR for human and rodent PAR1) (Vu et al., 1991; Coughlin et al., 1992; Nystedt et al., 1994, 1995; Al-Ani et al., 1995; Böhm et al., 1996; Saifeddine et al., 1996). The G-protein-coupled receptors for thrombin are distinct from the GPIb/IX-V platelet binding site for thrombin, which may also play a role in thrombin action (Harmon and Jamieson, 1986; Jamieson, 1997). Strikingly, short synthetic peptides based on these revealed N-terminal activating sequences of the G-protein-coupled PARs (so-called PAR1- or PAR2-activating peptides, or PAR-APs) can, in isolation, activate either PAR1 or PAR2 (Vu et al., 1991; Nystedt et al., 1994; Hollenberg et al., 1996, 1997). The PAR2-activating peptides, derived from either the human (SLIGKV-NH2) or rodent (SLIGRL-NH2) receptor sequences, can mimic the action of trypsin in activating PAR2, but they are unable to activate the PAR1 thrombin receptor because of a lack of an essential aromatic amino acid substituent at position 2 of the activating peptide (Hollenberg et al., 1993; Natarajan et al., 1995). In contrast, thrombin receptor-activating peptides derived from the human PAR1 receptor sequence (e.g., SFLLR-NH2) have been observed by us and by others to activate both PAR1 and PAR2 (Blackhart et al., 1996; Hollenberg et al., 1997). Nonetheless, we and others have shown that peptides such as TFLLR-NH2 (TF-NH2) (Hollenberg et al., 1997) or TFLLRNPNDK-NH2 (Blackhart et al., 1996) can selectively activate PAR1 but not PAR2. One approach to evaluating the selectivity (or lack thereof) of agents targeted to either PAR1 or PAR2 has employed a xenopus oocyte receptor expression system, in which only one of the two receptors are expressed (Blackhart et al., 1996). As an alternative approach, we have used a receptor desensitization paradigm, employing an intact contractile tissue bioassay to illustrate, for instance, the selective activation of PAR2 but not PAR1 by the PAR2 -AP, SLIGRL-NH2 (Saifeddine et al., 1996). We sought to extend the receptor-desensitization paradigm for use with a cultured cell system, in which an intracellular calcium signal rather than a contractile response might be used as an index of receptor activation. Furthermore, we reasoned that, provided receptor cross-desensitization did not occur, it would be advantageous to assess PAR-targeted ligands in a cell that expressed both receptors. With both receptors present in the same cell, the selectivity or nonselectivity of a variety of compounds that would affect PAR1 and/or PAR2 could be efficiently evaluated in a single experiment. To this end, we developed a calcium-signaling assay, employing cultured human embryonic kidney cells (HEK293) in which the action of PAR1 and PAR2 agonists and antagonists could be evaluated simultaneously. Using this assay, we expected to evaluate the PAR1/PAR2 selectivity of the compounds listed in Table 1. Many of these agents have been previously described either as potent thrombin-receptor ligands (Feng et al., 1995) or as thrombin (PAR1) receptor antagonists (Doorbar and Winter, 1994; Seiler et al., 1995; Bernatowicz et al., 1996). We also wished to evaluate the PAR1/PAR2 selectivity of the originally-described thrombin receptor-activating peptides SFLLRNPNDKYEPF-NH2 (SF14-NH2) and SFLLR-NH2(SF-NH2) (so-called TRAPs: Vu et al., 1991; Hollenberg et al., 1992; Hui et al., 1992; Sabo et al., 1992; Scarborough et al., 1992; Vassallo et al., 1992; Chao et al., 1993).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1
Compounds evaluated for PAR1/PAR2 selectivity

    Materials and Methods
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Cell Culture and Fluorescence Measurements. Human embryonic kidney cells (HEK293) that express the SV40 T-antigen were kindly provided by Dr. Jonathan Lytton, University of Calgary, Faculty of Medicine, Calgary, AB Canada. Cells were propagated without the use of trypsin at 37oC under an atmosphere of 5% CO2 in room air in 80 cm2 T-flasks using Dulbecco's minimal medium supplemented with 10% v/v fetal calf serum. Confluent cell monolayers to be used for calcium-signaling measurements were rinsed free of growth medium and disaggregated with calcium-free isotonic phosphate-buffered saline. Disaggregated cells were pelleted by centrifugation and were resuspended in 1 ml Dulbecco's minimal medium /10% fetal calf serum for loading with the calcium indicator, fluo-3 (Molecular Probes Inc., Eugene, OR) at a final concentration of 22 µM (25 µg/ml) of fluo-3 acetoxymethyl (AM) ester. Indicator uptake was allowed to proceed for 20-25 min at room temperature in the presence of 0.25 mM sulfinpyrazone, after which cells were washed two times by centrifugation and resuspension with the buffer described below, so as to remove excess dye. Cells loaded with fluo-3 were then resuspended to yield a stock suspension of about 6 × 106 cells/ml in a buffer, pH 7.4, of the following composition: NaCl (150 mm), KCl (3 mM), CaCl2 (1.5 mM), HEPES (20 mM), glucose (10 mM), and sulfinpyrazone (0.25 mM). Fluorescence measurements, reflecting elevations of intracellular calcium, were conducted at 24oC, using a Perkin-Elmer fluorescence spectrophotometer, with an excitation wavelength of 480 nM and an emission recorded at 530 nM. Cell suspensions (about 2 ml at a concentration of approximately 3 × 105 cells/ml) were maintained in suspension in a stirred (magnetic flea bar) thermostatted plastic cuvette (total volume 4 ml), and peptide stock solutions were added directly to the cuvette to monitor peptide-induced changes in fluorescence. To construct concentration-effect curves for fluorescence yield, the signals caused by a test peptide were expressed as a percentage (% A23187) of the fluorescence peak height yielded by replicate cell suspensions, when treated with 2 µM of ionphore, A23187 (Sigma, St. Louis, MO). This concentration of A23187 was at the plateau of its concentration-effect curve for a fluorescence response. Under the assay conditions, we established by high performance liquid chromatography analysis (as in the past, Tay-Uyboco et al., 1995) that peptide degradation did not occur, and we determined that the presence of proteinase inhibitors (e.g., amastatin) did not potentiate the action of peptides in the assay.

Peptides and Other Reagents. All peptides were synthesized by solid phase methods at the Peptide Synthesis Facility, The University of Calgary, Faculty of Medicine, Calgary, AB Canada, (Director, Dr. D. McMaster), or were provided through the courtesy of Dr. L. Leblond, via the peptide synthesis facility at BioChem Therapeutic, Laval, PQ Canada. The composition and purity of all peptides were confirmed by high performance liquid chromatography analysis, mass spectral analysis, and amino acid analysis. Stock solutions, prepared in 25 mM HEPES buffer pH 7.4, were analyzed by quantitative amino acid analysis to verify peptide concentrations and purity. Thapsigargin (TG) was from Sigma (St. Louis, MO).

Evaluation of Receptor Desensitization and Cross-Desensitization of PAR1 and PAR2 The receptor desensitization assay made use of the principle that repeated exposure of a tissue to an agonist that is receptor-selective leads to a diminution/desensitization of the receptor's response to that agonist, but not to the tissue's response to a second agonist, which activates a distinct receptor system. The desensitization approach that we employed previously to demonstrate the independent activation of PAR1 and PAR2 in a gastric longitudinal muscle strip bioassay (Saifeddine et al., 1996) was expanded upon, using the calcium signal yielded by receptor activation in HEK cells as an index of agonist activity. The key to the analysis of the PAR1-targeted ligands that we evaluated in this study lies in the use of the PAR1-selective agonist, TF-NH2 and the PAR2-selective agonist, SLIGRL-NH2 (SL-NH2). In the desensitization protocol described in detail in the following paragraph, both of these receptor-selective agonists were used at concentrations in the mid-range of their concentration-effect curves (10-30 µM). These concentrations selectively activate either PAR1 (TF-NH2) or PAR2 (SL-NH2). At these concentrations of receptor-selective agonists, the pretreatment of cells with any test compound that activated/desensitized or blocked one of the receptors would result in a diminution of the calcium signal subsequently generated by adding the receptor-selective agonist (TF-NH2 or SL-NH2) cumulatively, without removing the test compound from the cuvette.

Before evaluating the effects of the putative PAR1-targeted reagents, each fluo-3-loaded HEK cell suspension was first assessed for the fluorescence response to the PAR1- and PAR2-selective agonists, TF-NH2 (10 µM) and SL-NH2 (30 µM). Only preparations yielding a fluorescence response to TF-NH2 and SL-NH2 that was at least 60% of the response caused by the addition of 2 µM A23187 were used for an extensive assay. This concentration of the ionophore (2 µM) was at the plateau of its concentration-effect curve. After quantitating a "standardized" fluorescence response to each of the receptor-selective agonists, the following protocol was used to evaluate the actions of the test compounds we wished to study for their effect on either PAR1 or PAR2. 1) The test compound of interest was first added to a cell suspension, and the calcium signal generated (peak height) was recorded. 2) The fluorescence signal was allowed to return to baseline (e.g., see Fig. 1), and exactly 10 min thereafter (a time required for the refilling of intracellular calcium stores), a standard concentration of either TF-NH2 (10 µM) or SL-NH2 (30 µM) was added to the cuvette in the continued presence of the test compound. 3) Immediately thereafter, the response of a fresh cell suspension to the same standard concentration of either TF-NH2 or SL-NH2 was monitored. The diminution of the fluorescence response to the standard concentration of either TF-NH2 (10 µM) or SL-NH2, (30 µM), caused by the earlier addition of the test compound, served as an indicator of the test compound's ability to block/desensitize either PAR1 (TF-NH2 signal) or PAR2 (SL-NH2 signal) respectively. The ability of any test compound to desensitize or block either PAR1 or PAR2 was expressed as a residual percentage (% control) of the fluorescence signal caused by either the PAR1-selective (TF-NH2) or PAR2-selective (SL-NH2) agonist in the presence of a test compound, relative to the signal measured for either PAR1 (TF-NH2) or PAR2 (SL-NH2) activation in the absence of test compound. In this manner, with a single assay series, concentration-effect curves were constructed for each individual test compound for their ability to: 1) cause a Ca++ signal in HEK cells, 2) desensitize or block PAR1, and 3) desensitize or block PAR2. In a similar manner, by varying the time of addition of TG, after the earlier addition of an agonist that yielded a strong fluorescence signal (e.g., lysophosphatadic acid, TF-NH2,or SL-NH2), it was possible to assess, albeit indirectly, the time course of the refilling of intracellular calcium stores that could be mobilized by agonist action.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1.   Homologous desensitization of PAR1 by thrombin and PAR2 by trypsin, as well as lack of heterologous desensitization either of PAR2 by PAR1 activation due to thrombin or Cit-NH2, or of PAR1 by SL-NH2. HEK cell suspensions were first exposed twice to receptor-desensitizing concentrations of thrombin (Thr, bullet , 10 U/ml or 100 nM, to desensitize PAR1: tracings A and C), trypsin (black-square, 5 U/ml or 10 nM, to desensitize PAR2: tracing B), Cit-NH2 (black-diamond , 10 µM to desensitize PAR1: tracing D), or SL-NH2 (, 100 µM, to desensitize PAR2: tracings E and F), with continuous recording of the fluorescence tracing (E530). At 10 min after the addition of the first agonist to the cuvette, a test concentration of the second agonist was added (e.g., thrombin, followed by a test concentration of the PAR1-AP, Cit-NH2: tracing A). The fluorescence signal caused by the sequential addition of the test compound after receptor-specific desensitization was compared with the signal caused by the same concentration of test compound without earlier desensitization of the cells (right-hand portion of tracings A to F.)

Preparation of HEK Cell RNA and Detection of PAR1, PAR2, and PAR3 mRNA by the Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR). HEK cell monolayers were grown to confluence, and total RNA was prepared using the TRI-reagent (Molecular Research Center, Cincinnati, OH). The RNA was reverse transcribed (RT) with a first strand cDNA synthesis kit using pd(N)6 primer (Pharmacia LKB Biotechnology, Uppsala, Sweden) according to manufacturers recommendations at 37oC for 60 min; 3 µl of this solution was used with primer pairs targeted to human (h)PAR1, PAR2, and PAR3. For (h)PAR1, the primer pairs were: forward primer, PAR1 F:5' AAAAGCTTCCCGCTCATTTTTTCTCAGGAA 3', and reverse primer PAR1 R: 5' GGGAATTCAATCGGTGCCGGAGAAGT3'. For (h)PAR2, the primer pairs were: forward primer, PAR2 F:5' CACCACCTGTCACGATGTGCT3' and reverse primer, (h)PAR2 R: 5`CCCGGGCTCAGTAGGAGGTTTTAACAC3'. For (h)PAR3, the primer pairs were: forward primer, PAR3 F: 5'TTT(T/G)TCAT(A/C)CTGAAGCAGGA3'; and for the reverse primer, PAR3 R: 5'CTATTTTGTAAGGTAAGCAG3'. The signal yielded by the three sets of PAR primer pairs were normalized to the polymerase chain reaction (PCR) signal generated concurrently by an actin primer pair (Watson et al., 1992) that spanned an actin intron: forward primer: 5'CGT GGG CCG CCC TAG GCA CCA3'; reverse primer: 5'TTG GCC TTA GGG TTC AGG GGG3'. The detection of an intron-free 243 base-pair product using this primer pair can confirm the absence of DNA-derived intron sequences in the RT product obtained from tissue RNA. Routinely, amplification was obtained using 2.5 units of Taq DNA polymerase (Promega, Madison, WI) in a 10 mM Tris-HCl buffer, pH 9.0 (50 µl, final volume) containing MgCl2 (1.5 mM), KCl (50 mM), 0.1% v/v Triton X-100, and 0.2 mM each of deoxynucleotide triphosphates. The amplification reaction was allowed to proceed for 40 cycles, beginning with a 1-min denaturing period at 94°C, followed by a 1-min reannealing time at 55°C, then a 1-min primer extension period at 72°C. The PCR products were separated by 1.5% agarose gel electrophoresis and visualized by ethidium bromide. PCR products were subcloned into the pGEM-T Vector (Promega, Madison WI) for sequencing by the dideoxynucleotide chain termination method (Sanger et al., 1977), employing a T7DNA sequencing kit (Pharmcia). Sequencing was done in both the 5' and 3' directions.

Measurement of Platelet Aggregation. Washed platelets were isolated from citrate-anticoagulated plasma obtained from healthy volunteers who denied the use of nonsteroidal anti-inflammatory agents or other platelet-targeted drugs over at least the preceding 2 weeks. Washed platelet suspensions were prepared as outlined previously (Mustard et al., 1972), and aggregation was monitored by light scattering measurements done at 37°C using stirred platelet suspensions (400 µl) in a Bio Data aggregometer. Peptides in a volume of 50 µl were added directly to the stirred platelet suspension, and the degree of aggregation observed after a 3-min time period was expressed as a percentage of the maximum aggregation caused by each agonist. The use of the washed platelet suspension eliminated the need to add an aminopeptidase inhibitor (e.g., amastatin), as required for the use of platelet-rich plasma samples. Concentration-effect curves for the aggregating activity of peptides were thereby constructed, and the potency of each peptide was expressed as a concentration for which aggregation was half-maximal (EC50). To assess the activity of putative PAR1 inhibitors, each compound (in 50 µl) was added to the platelet suspension 1 min before the addition of either thrombin (in 50 µl of buffer: 0.015-0.1 U/ml, final concentration) or SFLLR-NH2, (final concentration 3 µM). The concentration of thrombin used for platelets derived from different donors was based on the minimum thrombin concentration required to cause maximal platelet aggregation. Once determined, this minimum effective thrombin concentration was used to estimate the IC50 for the putative PAR1 inhibitors.

    Results
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

RT-PCR Detection of PARs in HEK Cells. We wished to obtain a semiquantitative estimate of the abundance of PAR1 and PAR2 receptors in the HEK cells by a biochemical method. To this end, we used an RT-PCR approach, with amplimers targeted to these receptors; we also used primer pairs targeted to the more recently-described thrombin receptor, PAR3 (Ishihara et al., 1997) to assess its abundance in the HEK cells, relative to PAR1 and PAR2. Relative to the PCR signal for actin, the relative intensities of the PCR signals for the three PARs were: PAR3 > PAR2 > PAR1 (data not shown). It was not possible, with anti-receptor antibodies, to detect receptor protein for any of the PARs in the HEK cell line. Because PAR3 can be activated only by thrombin and not by a variety of receptor-derived activating peptides related to SF-NH2 or Cit-NH2 (Ishihara et al., 1997), we anticipated that the presence of PAR3 in the HEK cells would not be an interfering factor in the desensitization assay, which is described in the sections to follow.

Validation of the HEK Assay: Lack of Heterologous Receptor Cross-Desensitization and Adequacy of Calcium Stores for Repetitive Cell Activation. Before proceeding with the HEK calcium signaling assay, which depends upon the principle of homologous receptor activation/desensitization and upon a receptor-mediated elevation of intracellular Ca++, it was necessary to answer two main questions with regard to the system: 1) Did the protocol of sequential cell stimulation by one agonist/antagonist followed by another allow sufficient time for the refilling of intracellular calcium stores, such that the calcium signal yielded by the addition of the first agonist would not, simply because of inadequate calcium stores, diminish the calcium signal yielded by the sequential addition of the second agonist? 2) Even if calcium stores proved adequate, was there heterologous receptor cross-desensitization between PAR2 and PAR1 in the HEK cell system, as has been documented in the endothelial cell, wherein PAR2 activation can cross-desensitize PAR1 (Mirza et al., 1996)?

To answer the first question concerning the adequate refilling of intracellular calcium stores, after agonist stimulation, we employed two approaches. In the first approach, cells were first stimulated by a strong calcium-releasing agonist (e.g., lysophosphatidic acid, LPA) as well as by selected PAR-APs; thereafter, at timed intervals, cells were treated with TG, and the calcium signal was monitored. In HEK cells, TG caused an elevation of intracellular calcium, presumably by blocking calcium store reuptake and allowing the depletion of stored intracellular calcium. In the second approach, we used LPA to cause a strong receptor-mediated signal derived from intracellular calcium stores, followed at timed intervals by the selective activation of either PAR1 or PAR2. The question concerning PAR1/PAR2 cross-desensitization was answered by observing the calcium response caused by the sequential stimulation of PAR1 and PAR2, at increasing time intervals, with the receptor-selective agonists, TF-NH2 and SL-NH2.

Our validation study revealed the following information, which provided the basis for the desensitization assay illustrated in the following sections: 1) a time interval of 10 min was required after the addition of a single agonist to the assay cuvette to permit the refilling of calcium stores, as assessed by a TG-induced calcium signal; and 2) a time interval of at least 10 min between the sequential addition of different agonists to the assay cuvette was also required for each agonist to cause a full calcium signal. This time interval was presumably due to the time frame required for refilling the calcium stores. This presumption was supported by the observation that pretreatment of cells with TG (0.2 µM) abolished the calcium signal caused by the subsequent addition of LPA, TF-NH2, or SL-NH2 (data not shown); the omission of extracellular calcium from the suspension buffer did not diminish the fluorescence signal caused by the first addition of agonist (LPA, TF-NH2, or SL-NH2), relative to the signal observed in the routine calcium-containing (1.5 mM) medium (not shown). We therefore concluded that, for the purpose of our assay, a time period of 10 min between the cumulative addition of the first and second agonist to the assay cuvette was sufficient for the cells to replenish the agonist-sensitive calcium stores responsible for the fluorescence signal. Furthermore, our indirect approach suggested that a TG-sensitive intracellular calcium store was responsible for the fluorescence signal generated by activation of the PAR1, PAR2, and LPA receptors.

Homologous Versus Heterologous PAR Desensitization in HEK Cells. Because a cross-desensitization between PAR2 and PAR1 had been observed in human endothelial cell cultures (Mizra et al., 1996), it was important to establish in the HEK cell system that the activation of PAR1 did not simultaneously cross-desensitize PAR2 and vice versa. To deal with this issue, we first used thrombin and SL-NH2 as selective activators of PAR1 and PAR2, respectively. We then used a new PAR1-selective receptor-activating peptide (Ala-parafluoroPhe-Arg-Cha-Cit-Tyr-NH2) (Cit-NH2) as well as the previously described PAR1-selective agonist, TF-NH2 (Hollenberg et al., 1997), and the PAR2-selective agonist, SL-NH2, to assess the cross-desensitization of PAR1 and PAR2 in the HEK cell system. The principle of the desensitization assay is illustrated by the data in Fig. 1. As expected, activation of PAR1 by thrombin desensitized the subsequent HEK cell response to the selective PAR1 agonist, Cit-NH2 (tracing A, Fig. 1). Activation of PAR2 by trypsin similarly desensitized the subsequent HEK cell response to the selective PAR2 agonist, SL-NH2 (tracing B, Fig. 1). However, as shown in tracing C of Fig. 1, activation of PAR1 by thrombin did not affect the PAR2 signal caused by the PAR2-selective agonist, SL-NH2, nor did activation of the thrombin receptor by the PAR1 receptor-selective agonist, Cit-NH2, diminish the response to SL-NH2 (tracing D, Fig. 1). Furthermore, activation of PAR2 by SL-NH2 did not cause cross-desensitization of the response to thrombin; nor did PAR2 activation cross-desensitize the HEK cell response to Cit-NH2 (tracings E and F, Fig. 1). In view of the results described in the above paragraphs, we were able to arrive at the standard cross-desensitization protocol described in detail in the Materials and Methods section. The compounds that we wished to evaluate for their ability to affect either PAR1 or PAR2 are summarized in Table 1.

Selective Desensitization of PAR1 by Thrombin. Having established the working protocol for the assay of the PAR1/PAR2 selectivity of peptide agonists, we sought to deal with the following questions: 1) What type of desensitization of PAR1 and PAR2 was caused by the enzymes, thrombin (Fig. 2) and trypsin (Fig. 3)? 2) Could we obtain evidence for the activation of PAR3 in the HEK cells? 3) What was the selectivity/activity of previously described thrombin receptor antagonists (Figs. 4-8)? 4) What was the relative PAR1/PAR2 selectivity of previously described PAR1-targeted agonists (Fig. 9)? 5) What was the relative PAR1/PAR2 selectivity of the originally described thrombin receptor-activating peptides (referred to in the literature as TRAPs), SF-NH2, and SF14-NH2 (Fig. 10)? Finally, we wished to determine if the desensitization protocol that we had so far developed (see above sections) might depend on the nature of the receptor-selective agonist used to generate the standard PAR1 or PAR2 signal (steps 1 and 2 described in the preceding paragraph.) (See Fig. 11).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 2.   Concentration-Desensitization (black-triangle, ) and concentration-stimulation (bullet ) curves for thrombin-mediated activation of HEK cells. As illustrated in Fig. 2, cells were first stimulated by the addition of thrombin (concentrations ranging from 0.5-100 nM; 0.05-10 U/ml), and the magnitude of the calcium signal (% A23187, bullet ) relative to that caused by 2 µM A23187 in an aliquot of the indicator HEK cells was monitored. At 10 min after the addition of thrombin, a test concentration of either the PAR1-AP, TF-NH2 (black-triangle, 10 µM), or the PAR2-AP, SL-NH2 (, 30 µM) was added to the same cells that had been pretreated with thrombin, and the fluorescence signal caused by the second addition of agonist was monitored. The residual fluorescence signal measured after thrombin pretreatment was expressed as a percentage [% residual PAR1 (black-triangle) or PAR2 ()] of the control fluorescence signal observed by activating either PAR1 or PAR2 in HEK cell aliquots with the addition of either 10 µM TF-NH2 or 30 µM SL-NH2 to cells without thrombin pretreatment. Data points represent average values for measurements done with three or more separate cell suspensions, for which the standard errors of the mean fell within the size of the symbols shown. The figure is representative of experiments done on three or more independently grown crops of HEK cells. Thrombin pretreatment did not affect the subsequent activation of PAR2 by SL-NH2 (), but desensitized 70% of the subsequent activation of PAR1 by TF-NH2 (black-triangle).


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3.   Concentration-desensitization (black-triangle, , bullet ) and concentration-stimulation (black-square) curves for trypsin-mediated activation of HEK cells. As for thrombin (Fig. 2), HEK cell suspensions were first stimulated by the addition of trypsin (0.2-500 nM; 0.1-250 U/ml), and the calcium signal (% A23187, black-square) relative to that caused by 2 µM A23187 was measured. Following trypsin treatment, cells were exposed to either (10 nM; 1 U/ml) thrombin (bullet ) or 10 µM TF-NH2 (black-triangle) to monitor PAR1 activation, and to 30 µM SL-NH2 for activating PAR2 (). The residual fluorescence signal measured after trypsin pretreatment was expressed as a percentage [% residual PAR1 monitored by TF-NH2 (black-triangle) or thrombin (bullet ) stimulation; or % residual PAR2 monitored by SL-NH2 () stimulation] of the control fluorescence signal measured without earlier trypsin treatment, by activating PAR1 with either thrombin (bullet ) or TF-NH2 (black-triangle) and by activating PAR2 with SL-NH2 (). Values represent the means (±S. E. M., bars, except where error bars were smaller than the size of the symbols) for measurements done with three or more cell aliquots. The data are representative of experiments done with two or more separately grown crops of HEK cells.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4.   Diminished calcium signal in response to the addition of either PAR1- (black-triangle) or PAR2- () activating peptides by pretreatment of HEK cells with the putative PAR1 antagonist, Mpr-NH2. As illustrated for thrombin in Fig. 2, HEK cell suspensions were exposed first to Mpr-NH2 ( *, 1-300 µM) and the calcium signal (E530, % A23187, *), relative to 2 µM A23187, was measured. At 10minutes after the earlier addition of Mpr-NH2, the residual PAR1 (black-triangle) or PAR2- () mediated calcium fluorescence response (% control) relative to that observed in identical cell suspensions that had not been pretreated with Mpr-NH2, was monitored by the addition of either the PAR1-AP, TF-NH2 (10 µM, black-triangle) or the PAR2-AP, SL-NH2 (30 µM, ). Values represent the means (±S. E. M., bars) for measurements done with triplicate cell suspensions derived from two or more separately grown crops of HEK cells.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 5.   Desensitization of the Mpr-NH2-mediated calcium signal by desensitization of PAR2 but not by desensitization of PAR1. HEK cell suspensions were first exposed to receptor-desensitizing concentrations of either the PAR2-AP, SL-NH2 (, 100 µM, tracing A) or the PAR1-AP, TF-NH2 (black-triangle, 40 µM, tracing B). After 10 min, a test concentration of Mpr-NH2 (*, 15 µM) was added to the cell suspensions, with a continuous recording of calcium-mediated fluorescence (E530, scale for time and fluorescence shown between tracings A and B). The calcium signal caused by 15 µM Mpr-NH2 (*) in a cell suspension that had not been previously exposed to either SL-NH2 (tracing A) or TF-NH2 (tracing B) is shown to the right of each tracing. The tracings are representative of three or more independently conducted experiments with replicates derived from different HEK cell crops.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 6.   Inhibition by Met-OH of PAR1 activation by thrombin but not by TF-NH2. HEK cell suspensions were first exposed to a concentration of Met-OH (, 500 µM) above that previously reported to inhibit thrombin-mediated platelet activation (Doorbar and Winter, 1994). After 10 min, the residual PAR1-mediated calcium fluorescence signal (E530) generated by the addition of either thrombin (bullet , 5 nM; 0.5U/ml, tracing A) or the PAR1-AP, TF-NH2 (black-triangle, 2.5 µM, tracing B) was monitored. The calcium signal caused in an identical cell aliquot by the addition of either thrombin (bullet , tracing A) or TF-NH2 (black-triangle, tracing B) to cells that had not been pretreated with Met-OH is shown in the right-hand portion of each tracing. The tracings are representative of two independently conducted experiments. The scale for time and calcium signal is shown between the tracings.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 7.   Desensitization of PAR1 (black-triangle) and PAR2 () by pretreatment of HEK cells with the putative PAR1 antagonist, trans-Cinnamoyl-(f)F-R-L-R-O-NH2. As illustrated for Mpr-NH2 in Fig. 4, HEK cell suspensions were first exposed to tc-fF-NH2 (diamond , 1-400 µM) and the calcium signal thereby generated (E530) was measured as a percentage (% A23187, ) relative to 2 µM A23187. At 10 min after the earlier addition of tc-fF-NH2, the residual PAR1- (black-triangle) or PAR2- () mediated calcium fluorescence response was measured as a percentage (% control black-triangle, ) of the control fluorescence response measured upon adding the test concentrations of either the PAR1-AP, TF-NH2 (black-triangle, 10 µM), or the PAR2-AP, SL-NH2 (, 30 µM) to identical cell suspensions that had not been pretreated with tc-fF-NH2. Values represent the means for measurements done with triplicate cell suspensions (±S. E. M. smaller than size of symbols) obtained from two or more HEK cell crops.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 8.   Partial desensitization of the HEK cell calcium signal caused by tc-fF-NH2 caused by pretreatment with the PAR1- and PAR2-selective agonists, TF-NH2 and SL-NH2, as well as full desensitization by pretreatment with the nonselective PAR1/PAR2 agonist, SF-NH2. HEK cell suspensions were first pretreated twice with desensitizing concentrations of either the PAR-selective agonists, TF-NH2 (black-triangle, 40 µM for PAR1, tracing A) and SL-NH2 (, 100 µM for PAR2, tracing B) or the nonselective PAR1/PAR2 agonist, SF-NH2 (Delta , 40 µM, tracing C). After 10 min, a test concentration of tc-fF-NH2 close to its EC50 for causing a calcium signal ([star], 50 µM) was added to the cell suspension, with continuous monitoring of all the calcium fluorescence (E530). The calcium signal caused by 50 µM tc-fF-NH2 (diamond ) in the agonist-pretreated cells (left-hand set of tracings A to C) was compared with the signal caused in identical cell suspensions that had not been desensitized by agonist pretreatment (right-hand set of tracings A to C). The experiment shown is representative of measurements done with two sets of independently prepared HEK cell suspensions. The scale for time and fluorescence is shown between tracings A and B.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 9.   Desensitization of PAR1 (black-triangle) and PAR2 () by PAR1-selective agonists: concentration-desensitization curves. As illustrated for thrombin in Fig. 2, HEK cell suspensions were first exposed to different concentrations of three PAR1-selective agonists: hArg-NH2 (solid lines), Cit-NH2 (dash lines), and TF-NH2 (dash/dot lines). After 10 min, the cell suspension was challenged by the sequential addition of test concentrations of either the PAR1-selective agonist, TF-NH2 (black-triangle, 10 µM) or the PAR2-selective agonist, SL-NH2 (, 30 µM). The residual PAR1 (black-triangle) or PAR2 () calcium signal (E530) observed in the agonist-pretreated cells was measured as a percentage (% control) of the calcium signal caused by either 10 µM, TF-NH2 (black-triangle) or 30 µM, SL-NH2 () in identical cell suspensions that had not been pretreated with the PAR1-selective agonists. Values represent the means (±S.E.M., bars) for measurements done with three or more replicate cell suspensions coming from two or more independently grown HEK cell crops. Error bars smaller than the symbol size are not shown.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 10.   Desensitization of PAR1 (black-triangle) and PAR2 () by the originally described thrombin receptor-activating peptides SFLLR-NH2 and SFLLRNPNDKYEPF-NH2: concentration-desensitization curves. As illustrated for the PAR1-selective agonists in Fig. 9, concentration-desensitization curves were obtained for the ability of the originally described thrombin receptor-activating peptides, SF14-NH2 (dashed lines) and SF-NH2 (solid lines) to desensitize either PAR1 (black-triangle) or PAR2 (). Values represent the means of measurements done with triplicate cell suspensions obtained from two or more separately grown HEK cell crops; standard error bars were smaller than the symbols shown.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 11.   Concentration-desensitization curves for TF-NH2 using test concentrations of either Cit-NH2 (black-diamond , 1 µM) or TF-NH2 (black-triangle) to monitor PAR1 desensitization. As outlined for the agonists shown in Figs. 9 and 10, a concentration-desensitization curve was determined for pretreatment of HEK cell suspensions with different concentrations of TF-NH2 (0.5-40 µM), followed by monitoring the residual calcium signal (E530) yielded by the subsequent addition of a test concentration of either Cit-NH2 (black-diamond , 1 µM) or TF-NH2 (black-triangle, 10 µM). The residual PAR1-stimulated fluorescence signal (E530) observed for the two different PAR1-APs was expressed as a percentage (% control) of the signal observed upon adding either Cit-NH2 (black-diamond ) or TF-NH2 (black-triangle, 10 µM) to identical HEK cell suspensions that had not been pretreated with the different concentrations of TF-NH2 (x-axis). Values represent the means of measurements done with triplicate cell suspensions obtained from two independently grown HEK cell crops. Error bars were smaller than the symbols shown.

Our attention was focused first on questions 1 and 2, using thrombin, known as a selective activator of either PAR1 or PAR3, and trypsin, an enzyme known to activate both PAR1 and PAR2. In previous work we had established that 40 µM concentrations of either TF-NH2 or SF-NH2 were able to desensitize the HEK cell response to other PAR1-activating peptides or to thrombin (Hollenberg et al., 1997). But we had not evaluated fully the ability of increasing concentrations of thrombin to desensitize the HEK cell response to PAR-activating peptides. As shown in Fig. 2, increasing concentrations of thrombin, up to 100 nM (10 U/ml) were able selectively to desensitize the HEK cell response to the selective PAR1-activating peptide, TF-NH2 (black-triangle, Fig. 2) without affecting at all, the response to the PAR2-selective peptide, SL-NH2 (, Fig. 2). The EC50 for the ability of thrombin to generate a calcium signal in the HEK cells (about 3.3 nM: right-hand ordinate, Fig. 2) reflected the IC50 for the ability of thrombin to desensitize the cellular response to TF-NH2 (about 2.5 nM: left-hand ordinate, Fig. 2). Nonetheless, even at its plateau concentration, thrombin was not able to desensitize the response to TF-NH2 by more than 70% (black-triangle, Fig. 2).

Cross-Desensitization of PAR1 by Trypsin: Quantitative Estimate of Receptor Selectivity. In contrast with thrombin, which cannot activate PAR2, elevated concentrations of trypsin (greater than about 20 U/ml or 40 nM) can also activate PAR1 (Vu et al., 1991). Therefore, with the cross-desensitization assay, we used trypsin to illustrate quantitatively the dual specificity of its ability to activate/desensitize PAR2 at concentrations lower than about 5 U/ml (10 nM) and to activate/desensitize PAR1 at concentrations higher than about 20 U/ml (>40 nM) (Fig. 3). Although trypsin was able to desensitize almost completely the response of PAR2 to SL-NH2, (Fig. 3), this protease was not able to desensitize more than about 35% of the PAR1 response to TF-NH2 (, Fig. 3). Nonetheless, prior treatment of the cells with concentrations of trypsin that were lower than those required to desensitize the response to TF-NH2, "disarmed" completely the ability of thrombin (bullet , Fig. 3) to activate PAR1. In Fig. 3, the response of the HEK cells to trypsin, in terms of the fluo-3 calcium signal, could be the result of the combined activation of PAR1 and PAR2.

Test for Thrombin-Activated PAR3 Signaling in HEK Cells. Because PAR3 is evidently insensitive to activation by PAR-activating peptides (Ishihara et al., 1997), we reasoned that the peptide, SFLLR-NH2 (SF-NH2), which can activate/desensitize both PAR1 and PAR2 (Hollenberg et al., 1997), would be able to desensitize both PAR1 and PAR2 without activating PAR3. If at these concentrations of SF-NH2 (about 40 µM), PAR3 were not activated, we reasoned that, although a selective PAR1-activating peptide would no longer yield a calcium signal, thrombin should still be able to activate PAR3 to yield an increase in fluo-3 fluorescence. We found that, at concentrations of SF-NH2 that desensitized the HEK cell response to both TF-NH2 and SL-NH2 (i.e., both PAR1 and PAR2 were desensitized: not shown), no further fluorescence response to thrombin (10 U/ml; 100 nM) was observed. Similarly, after fully desensitizing PAR1 with Cit-NH2, thrombin (10 U/ml; 100 nM) failed to cause a fluorescence response (not shown). This concentration of thrombin (10 U/ml) would have been more than sufficient to activate PAR3 (Ishihara et al., 1997).

Relative Selectivity of Putative PAR1-Targeted Antagonists for PAR1 Compared with PAR2. Previous work had described a PAR1 receptor antagonist, Mpr-Phe-Cha-Cha-Arg-Lys-Pro-Asn-Asp-Lys-NH2 (Mpr-NH2) (Seiler et al., 1995). We assessed the PAR1/PAR2 selectivity of Mpr-NH2 using the HEK cell assay, as shown in Fig. 4. Prior treatment of HEK cells with Mpr-NH2 led to a reduction in the subsequent ability of both TF-NH2 and SL-NH2 to activate PAR1 and PAR2 respectively, with comparable IC50s for blocking or desensitizing both receptors. Mpr-NH2 was able to block PAR2 completely (, Fig. 4), but was only able to block about 60% of the HEK cell PAR1 response to TF-NH2 (black-triangle, Fig. 4).

On its own, Mpr-NH2 activated the HEK cell calcium signal, with an EC50 of about 20 µM. We wondered if the calcium-induced fluo-3 signal in response to Mpr-NH2 was due to the activation of PAR1, PAR2 or perhaps both receptors. Therefore, we assessed the ability of Mpr-NH2 to cause a fluorescence signal in HEK cells in which either PAR1 or PAR2 had previously been activated/desensitized by treatment of the cells with high concentrations of either the selective PAR1-selective agonist, TF-NH2 or the PAR2-selective agonist, SLIGRL-NH2 (SL-NH2) (Fig. 5). We observed that exposure of the HEK cells to high concentrations SL-NH2 (100 µM) abolished the calcium signal caused by Mpr-NH2, (Fig. 5A), whereas pretreatment with comparatively high concentrations of TF-NH2 (40 µM) did not affect the Mpr-NH2-induced calcium signal (Fig. 5B). These data indicated that Mpr-NH2 was an agonist only for PAR2 and not for PAR1; and that Mpr-NH2 was a PAR1 antagonist.

After evaluating the activity of the PAR1 antagonist, Mpr-NH2, we turned our attention to two other PAR1 receptor antagonists that had also been previously described: the peptide, Met-Ser-Arg-Pro-Ala-Cys-Pro-Asn-Asp-Lys-Tyr-Glu, (Met-OH), discovered by a phage display approach (Doorbar and Winter, 1994) and the peptide, trans-cinnamoyl-parafluoroPhe-Arg-Leu-Arg-NH2, which had been prepared by rational drug design (compound 76, Bernatowicz et al., 1996). In keeping with the data of Bernatowicz et al. (1996), we therefore tested the peptide, trans-cinnamoyl-parafluoroPhe-Arg-Leu-Arg-Orn-NH2 (tc-fF-NH2) as a potential PAR1 ligand along with Met-OH. Met-OH, at concentrations as high as 800 µM, showed no ability either to cause a calcium signal in the HEK cells or to affect the action of SL-NH2 in the HEK cell assay (data not shown). However, Met-OH between 400 and 800 µM was able to attenuate the calcium signal caused by 0.5 U/ml (5 nM) thrombin (70 ± 6% inhibition: average ± 1/2 range for duplicate measurements: Fig. 6, tracing A). Nonetheless, over the same concentration range, Met-OH potentiated (29 ± 3%: average ±1/2 range for duplicate measurements) rather than inhibited the action of the PAR1-activating peptide, TF-NH2, even at comparatively low concentrations of TF-NH2 (Fig. 6, tracing B).

In contrast with Met-OH, tc-fF-NH2 on its own activated a calcium signal in the HEK cells and was able to diminish the HEK cell calcium response to both the PAR1-activating peptide, TF-NH2, and the PAR2-activating peptide, SL-NH2 (Fig. 7). Unlike Mpr-NH2 (Fig. 5), the calcium signal caused by tc-fF-NH2 was diminished (but not eliminated) by pretreating the cells twice in succession with either TF-NH2 or SL-NH2 (tracings A and B, Fig. 8). Pretreating the cells with 40 µM SFLLR-NH2 (this peptide simultaneously desensitizes both PAR1 and PAR2) completely eliminated the signal generated by tc-fF-NH2 (tracing C, Fig. 8). Thus, tc-fF-NH2 was a partial agonist at both PAR1 and PAR2.

Relative Selectivity of PAR1-Targeted Agonists for PAR1 Compared with PAR2. In previous work, the peptide, Ala-parafluoroPhe-Arg-Cha-hArg-Tyr-NH2 (hArg-NH2) had been synthesized as a high potency PAR1 agonist for use as a PAR1 receptor binding probe (Feng et al., 1995; Ahn et al., 1997). In accord with these studies, we synthesized the peptide Ala-parafluoroPhe-Arg-Cha-Cit-Tyr-NH2 (Cit-NH2) as a potential alternative to hArg-NH2 for use as a PAR1 receptor binding probe; and we had already synthesized the peptide, TF-NH2, which in preliminary work appeared to be a PAR1-selective agonist (Hollenberg et al., 1997). We first assessed the relative PAR1/PAR2 specificity of hArg-NH2 and, in parallel, evaluated the receptor selectivity of Cit-NH2 and TF-NH2 (Fig. 9), although as expected, both hArg-NH2 and Cit-NH2were able to activate/desensitize PAR1, hArg-NH2 at concentrations between 2 and 40 µM was also able to activate/desensitize PAR2 by more than 60%. In contrast, Cit-NH2, at concentrations as high as 50 µM did not affect PAR2 (Fig. 9). In the HEK cell assay, the relative selectivity of Cit-NH2 for the PAR1 receptor, compared with PAR2 was about 280:1, whereas the PAR1-selectivity of hArg-NH2 was lower by about 2-fold (about 120:1, Fig. 9 and Table 2). Both hArg-NH2 and Cit-NH2 were found to be full agonists for the PAR1 receptor (not shown). In comparison with hArg-NH2 and Cit-NH2, the much simpler peptide TF-NH2, composed entirely of naturally occurring amino acids, demonstrated a PAR1/PAR2-selectivity of about 220:1 (Fig. 9 and Table 2).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2
PAR1/PAR2 Selectivity of PAR1-targeted ligands

Relative Receptor Selectivity of Receptor-Activating Peptides Derived from Human PAR1. Because many previous studies, including our own (Yang et al., 1992; Tay-Uyboco et al., 1995), have used peptides derived from the human PAR1 activating sequence as surrogates for the action of thrombin (previously termed thrombin receptor activating peptides, or TRAPs), we wished to evaluate the PAR1/PAR2 receptor selectivity of TRAPs that had been used extensively in previous work without the knowledge that such agonists could affect both PAR1 and PAR2: SFLLR-NH2 (SF-NH2) and SFLLRNPNDKYEPF-NH2 (SF14-NH2) (originally described by Vu et al., 1991). As shown in Fig. 10, both SF14-NH2 and SF-NH2 were somewhat selective for PAR1 over PAR2 (about 2- to 4-fold), but neither of the originally described TRAPs were anywhere near as PAR1-selective as hArg-NH2 (120:1), TF-NH2 (220:1), or Cit-NH2 (280:1). Table 2 summarizes the activities of all peptides studied in terms of their PAR1/PAR2 selectivity and their IC50s for attenuating the calcium signal in HEK cells caused by subsequent activation of either PAR1 (TF-NH2) or PAR2 (SL-NH2)

Evaluation of the Use of Different PAR-Selective Standard Agonists in the HEK Cell Assay. Because the desensitization assay depends primarily on the activity of the unknown compound added to the cells before the PAR-selective test compound (routinely, TF-NH2, in the PAR1 assay we have developed), the desensitization profile for a given unknown compound should not, in principle, depend on the PAR-selective receptor probe that is used to generate the standard signal (step 2 in the procedure outlined above). To test this principle, we measured the PAR1 desensitization profile for TF-NH2, (as an unknown), using either the standard concentration of TF-NH2 itself (10 µM) or, the more potent PAR1-selective agonist, Cit-NH2 (1 µM). As shown in Fig. 11, the PAR1 desensitization profile for TF-NH2 was virtually superimposable, irrespective of which selective PAR1 receptor probe was used to generate the standard calcium signal.

Activity of Peptides in a Human Platelet Aggregation Assay. We wished to compare the PAR1. selective activities of Mpr-NH2, Met-OH, tc-fF-NH2, hArg-NH2, Cit-NH2, TF-NH2, SF-NH2, and SF14-NH2 determined in the HEK cell assay, in terms of attenuating the PAR1 calcium signal (Table 2), with their activities in a platelet aggregation assay (results summarized in Table 3). Platelets do not possess PAR2, and thus the potential cross-reactivity of the peptides at PAR2 was not an issue in the platelet assay. All peptides except Mpr-NH2 (up to 20 µM) and Met-OH were platelet agonists, with EC50 s in the range of 0.1 to 10 µM (Table 3). Mpr-NH2, as previously described, proved to be an inhibitor of both thrombin-mediated and SF-NH2-mediated platelet aggregation. However, the IC50 for Mpr-NH2 depended heavily on the concentration of either thrombin or SF-NH2, which was used as a platelet agonist. For instance, at a concentration of 0.015 U/ml thrombin, the IC50 for Mpr-NH2 was 0.7 µM (Table 3), whereas at a concentration of 0.04 U/ml thrombin, the IC50 was about 6 µM (Table 2). Both Mpr-NH2 and Met-OH proved to be poor antagonists of SF-NH2 in the platelet aggregation assay (IC50 > 200 µM), and Met-OH was a weak antagonist of thrombin-mediated platelet aggregation (Table 3, and data not shown). Surprisingly, tc-fF-NH2 on its own was a weak platelet agonist, causing a reversible aggregation at concentrations up to 20 µM. At concentrations lower than 20 µM, tc-tF-NH2 was able to inhibit SF-NH2-induced platelet aggregation, with an IC50 of about 2 µM (Table 2). This inhibition, however, was observed only by adding tc-fF-NH2 to the cuvette first and by waiting until the light scattering caused by this peptide had returned to baseline, before adding the full agonist (3 µM SF-NH2 or 0.05 U/ml thrombin) that caused aggregation.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 3
Potencies of PAR1-targeted ligands in platelets and HEK cells

    Discussion
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Our data, obtained with the newly described desensitization assay, considerably extended our preliminary observations describing TF-NH2 as a PAR1-selective agonist (Hollenberg et al., 1997). The principal finding of our study was that ligands originally developed as PAR1-targeted ligands can also be seen to activate PAR2, with a greater or lesser selectivity for PAR1. The results with the PAR1 antagonist, Mpr-NH2 were particularly instructive as, with comparable potencies, this peptide proved to be an antagonist for PAR1 and full agonist for PAR2 (Figs. 4 and 5). Confirming earlier reports (Seiler et al., 1995), Mpr-NH2 was a PAR1 antagonist in the platelet, where PAR2 was absent; this compound was also an antagonist for the HEK cell PAR1 receptor. Thus, previous work in which this PAR1 antagonist or in which nonselective PAR1-APs were used to evaluate tissues such as the vascular endothelium (Lum et al., 1993; Zimmerman et al., 1994), wherein PAR1 and PAR2 coexist (Al-Ani et al., 1995), may need to be reevaluated. The data obtained with the Mpr-NH2 peptide also point to differences whereby this peptide docks with PAR1 and PAR2, on the one hand leading to receptor activation (PAR2), on the other to inhibition (PAR1).

The principle of the PAR1/PAR2 desensitization assay depends on a density of PAR1 and PAR2 receptors that is low enough so that the activation/desensitization of receptors by a test compound will diminish the calcium signal generated by the subsequent addition of the PAR-selective test compound. Thus, the assay we describe will only work efficiently for agonists if the proportion of spare receptors for the calcium signal response is low, relative to the total numbers of receptors present in the system. That our assay works suggests that the proportion of spare PAR1 and PAR2 receptors in the HEK cells is indeed appropriately low for the purposes of our new assay. However, the absolute values of the IC50s for the various test compounds obtained in the desensitization assay for interacting with either PAR1 or PAR2 must be interpreted with caution, relative to the potencies that the peptides we have studied may exhibit in other responsive systems. For instance, differences in receptor numbers between cell types could shift the concentration-effect curves to the left (higher receptor numbers) or to the right (lower receptor numbers). Nonetheless, the relative potencies within a series of compounds that interact with either PAR1 or PAR2 (or both) would be expected to be the same, irrespective of the tissue in which the compounds were assayed. It is, therefore, important to note that the relative potencies of the PAR1-targeted agonists in the PAR1 desensitization assay (hArg-NH2 > Cit-NH2 > tc-fF-NH2 sime  TF-NH2 sime  SF-NH2 > SF14-NH2) (Table 2) were in good accord with the relative EC50s of the same compounds in the platelet aggregation assay (Table 3). Because of the complex dependence of the IC50s for antagonists on the thrombin concentration in the platelet aggregation assay, a correlation with the HEK cell assay was problematic.

Verification of the ability of the HEK cell signaling assay to identify receptor-selective agonists can be seen in the data obtained with thrombin, the PAR1-selective peptide, Cit-NH2, and the PAR2-selective agonist, SL-NH2. As has been observed in previous work (Nystedt et al., 1994), thrombin is unable to activate PAR2, and SL-NH2 is unable to activate PAR1. The PAR1 selectivity of Cit-NH2 (almost 300:1) documented by our assay singles this compound out as an attractive, selective PAR1 agonist for use in studies done in vivo. Based on our previous data and on the results with TF-NH2, one can predict that the peptide Thr-parafluoroPhe-Arg-Cha-Cit-Tyr-NH2 would be an even more selective PAR1 agonist than Cit-NH2. A key to our assay was that PAR1 activation did not lead to heterologous desensitization of PAR2, nor did PAR2 activation desensitize PAR1. These data appear to conflict with the observations of Mirza and colleagues (1996), who observed heterologous desensitization between PAR1 and PAR2 receptors in cultured human endothelial cells. That this cross-desensitization did not occur between PAR1 and PAR2 in the HEK cell assay may be due to two factors. First, our assay allowed for a time period of 10 min or more between the sequential addition of agonists to permit a complete refilling of intracellular calcium stores; this time period, which was longer than that used by Mirza et al. (1996), may have also allowed for a resensitization of receptors that had been cross-desensitized via a heterologous receptor mechanism. Alternatively, the enzymes responsible for heterologous receptor desensitization in cultured human endothelial cells and the relative abundance of PAR1 and PAR2 in the endothelial cells (Mirza et al., 1996) may differ considerably in comparison with the HEK cells, so as to account for the differences in heterologous receptor desensitization. This lack of heterologous receptor cross-desensitization, not only for the PAR1/PAR2 system, but also between the LPA receptor and the PAR receptors could allow for the simultaneous evaluation of multiple members of other receptor families that might be either present in HEK cells or coexpressed in these cells via transfection.

Because the HEK cells express sufficient wild-type human PAR1 and PAR2 receptors for the assay we describe, the system is far more convenient and precise than the use of PAR1 and PAR2 transfected xenopus oocytes, as described in work that appeared during the course of our studies (Blackhart et al., 1996). Although the data obtained with the xenopus oocyte receptor expression system can complement the results we describe in this report, the variability of response of the receptor-transfected oocytes makes difficult any precise assignment of the relative magnitude of PAR1/PAR2 ligand selectivity, as is possible with the HEK cell assay (Table 2). Unfortunately, the spectrum of PAR1APs used in the oocyte expression assay (Blackhart et al., 1996) differed considerably from the compounds we studied with the HEK cell assay system, and a direct comparison of receptor selectivity was not possible. The calcium signaling assay employing the HEK cells can also be seen to complement the use of human platelets (Table 3), which represent a useful screening target for the evaluation of PAR1 agonists and antagonists, but which are devoid of PAR2 receptors. Furthermore, as opposed to the xenopus expression system, our assay was able to demonstrate simultaneously (Fig. 3) the activation/densensitization of PAR1 by trypsin (20-100 nM), as reflected by TF-NH2-mediated receptor activation and, at much lower concentrations (0.5-10 nM trypsin), the disarming of the ability of thrombin to activate PAR1, presumably by trypsin cleavage of the receptor at a site downstream from the tethered receptor-activating ligand domain. Thus, the HEK assay will also prove of value for assessing the effects of a variety of proteinases on PAR1 and PAR2 activation.

We were puzzled to observe that the peptide tc-fF-NH2 was an agonist at both PAR1 and PAR2 in the HEK cell assay (Figs. 7 and 8) and that this peptide was a partial agonist in the platelet aggregation assay, where antagonist activity could also be measured. Given the antagonist activity reported by Bernatowicz et al. (1996) for the peptide: trans-cinnamoyl-parafluoroPhe-Arg-Leu-Arg-NH2 [IC50 of about 1 µM for inhibiting PAR1AP-induced platelet aggregation: Bernatowicz et al. (1996) compound 76, Table 9] and the antagonist activity of trans-cinnamoyl-parafluoroPhe-paraguanidinoPhe-Leu-Arg-Orn-NH2 [IC50, about 50 nM for inhibiting PAR1AP-induced platelet aggregation: Bernatowicz et al. (1996), compound 88, Table 11], we expected tc-fF-NH2 to be a full antagonist. The partial agonist activity in the peptide we synthesized (tc-fF-NH2) points to the importance of the paraguanidino-phenyl group at position 3 in PAR1 antagonist peptides. Furthermore, it is possible that tc-fF-NH2 may nonspecifically desensitize the platelet to other agonists (e.g., ADP).

Finally, based on our PCR data, we expected to find evidence for the activation of PAR3 by thrombin in the HEK cell assay. Because PAR3 has been reported not to be activated by PAR-APs (Ishihara et al., 1997), we fully anticipated that the complete desensitization of PAR1 by TF-NH2 or by SF-NH2 would still allow for the sequential activation of PAR3 by thrombin. That this was not the case may be accounted for by several possibilities. First, activation of PAR1 may cross-desensitize PAR3. Second, PAR1AP, such as Cit-NH2, TF-NH2, or SF-NH2, which cannot activate PAR3, may nonetheless prove to be antagonists of the PAR3-tethered peptide. Third, PAR3 may not, as do PAR1 and PAR2, couple to the calcium signaling mechanism in HEK cells. These possibilities represent interesting topics for further study. Notwithstanding, the presumed presence of PAR3 (we were not able to assess the HEK cell content of PAR3 protein) in the HEK cells appears not to interfere with the PAR1/PAR2 desensitization assay that we have developed. We anticipate that this fluorescence-based assay will prove of considerable use for screening of PAR1- and PAR2-targeted agents in future studies, not only for peptidomimetic compounds but also for other proteases that may affect either PAR1 or PAR2.

    Acknowledgments

We thank Dr. Denis McMaster for the efficient synthesis of the peptides used for our studies and Dr. Jonathan Lytton for providing the HEK cell line used in this study. The helpful suggestions of Dr. S. Mokashi for cell culture methods are gratefully acknowledged.

    Footnotes

Accepted for publication August 12, 1998.

Received for publication March 30, 1998.

2 Present Address: Department of Pathophysiology and Therapeutics, Faculty of Pharmaceutical Sciences, Kinki University, 3-4-1 Kowakae, Higashi-Osaka 577, Japan.

1 This work was supported primarily by a Canadian Natural Sciences and Engineering Research Council/National Research Council Partnership grant in conjunction with BioChem Therapeutic, Laval PQ, with supplementary funds from a Medical Research Council of Canada operating grant to M.D.H.

Send reprint requests to: Dr. Morley D. Hollenberg, Department of Pharmacology and Therapeutics, The University of Calgary, Faculty of Medicine, 3330 Hospital Drive NW, Calgary, Alberta, Canada T2N 4N1. E-mail hollenb{at}acs.ucalgary.ca

    Abbreviations

PAR, proteinase-activated receptor; PAR-AP, proteinase-activated receptor-activating peptide; PAR1, proteinase-activated receptor-1/thrombin receptor; PAR2, proteinase-activated receptor-2/trypsin-activated receptor; PAR3, proteinase-activated receptor-3/thrombin receptor; PCR, polymerase-chain reaction; SF-NH2, SFLLR-NH2; SF14-NH2, SFLLRNPNDKYEPF-NH2; SL-NH2, SLIGRL-NH2; tc-fF-NH2, trans-cinnamoyl-parafluoroPhe-Arg-Leu-Arg-Orn-NH2; TF-NH2, TFLLR-NH2; TG, thapsigargin; TRAP, thrombin receptor-activating peptide. Amino acids are abbreviated by their one-letter or three-letter codes; Cha, cyclohexylalanine; Cit-NH2, Ala-parafluoroPhe-Arg-Cha-Cit-Tyr-NH2; hArg, homoarginine; hArg-NH2, Ala-parafluoroPhe-Arg-Cha-hArg-Tyr-NH2; HEK, human embryonic kidney cells, 293; LPA, lysophosphatidic acid; Met-OH, Met-Ser-Arg-Pro-Asn-Asp-Lys-Tyr-Glu-OH; Mpr-NH2, mercaptropropionyl-Phe-Cha-Cha-Arg-Lys-Pro-Asn-Asp-Lys-NH2; Mpr, mercaptopropionyl.

    References
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References


0022-3565/99/2881-0358$03.00/0
THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS
Copyright © 1999 by The American Society for Pharmacology and Experimental Therapeutics



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
P. Rallabhandi, Q. M. Nhu, V. Y. Toshchakov, W. Piao, A. E. Medvedev, M. D. Hollenberg, A. Fasano, and S. N. Vogel
Analysis of Proteinase-activated Receptor 2 and TLR4 Signal Transduction: A NOVEL PARADIGM FOR RECEPTOR COOPERATIVITY
J. Biol. Chem., September 5, 2008; 283(36): 24314 - 24325.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
M. D. Hollenberg, B. Renaux, E. Hyun, S. Houle, N. Vergnolle, M. Saifeddine, and R. Ramachandran
Derivatized 2-Furoyl-LIGRLO-amide, a Versatile and Selective Probe for Proteinase-Activated Receptor 2: Binding and Visualization
J. Pharmacol. Exp. Ther., August 1, 2008; 326(2): 453 - 462.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
I. J. Guthmundsdottir, N. N. Lang, N. A. Boon, C. A. Ludlam, D. J. Webb, K. A. Fox, and D. E. Newby
Role of the Endothelium in the Vascular Effects of the Thrombin Receptor (Protease-Activated Receptor Type 1) in Humans
J. Am. Coll. Cardiol., May 6, 2008; 51(18): 1749 - 1756.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Saifeddine, M. L. Seymour, Y.-P. Xiao, S. J. Compton, S. Houle, R. Ramachandran, W. K. MacNaughton, S. Simonet, C. Vayssettes-Courchay, T. J. Verbeuren, et al.
Proteinase-activated receptor-2 activating peptides: distinct canine coronary artery receptor systems
Am J Physiol Heart Circ Physiol, December 1, 2007; 293(6): H3279 - H3289.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Knecht, G. S. Cottrell, S. Amadesi, J. Mohlin, A. Skaregarde, K. Gedda, A. Peterson, K. Chapman, M. D. Hollenberg, N. Vergnolle, et al.
Trypsin IV or Mesotrypsin and p23 Cleave Protease-activated Receptors 1 and 2 to Induce Inflammation and Hyperalgesia
J. Biol. Chem., September 7, 2007; 282(36): 26089 - 26100.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
C. J. Lee, G. Mannaioni, H. Yuan, D. H. Woo, M. B. Gingrich, and S. F. Traynelis
Astrocytic control of synaptic NMDA receptors
J. Physiol., June 15, 2007; 581(3): 1057 - 1081.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
R. Ramachandran, L. R. Sadofsky, Y. Xiao, A. Botham, M. Cowen, A. H. Morice, and S. J Compton
Inflammatory mediators modulate thrombin and cathepsin-G signaling in human bronchial fibroblasts by inducing expression of proteinase-activated receptor-4
Am J Physiol Lung Cell Mol Physiol, March 1, 2007; 292(3): L788 - L798.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Vergote, G. S. Butler, M. Ooms, J. H. Cox, C. Silva, M. D. Hollenberg, J. H. Jhamandas, C. M. Overall, and C. Power
Proteolytic processing of SDF-1{alpha} reveals a change in receptor specificity mediating HIV-associated neurodegeneration
PNAS, December 12, 2006; 103(50): 19182 - 19187.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Oikonomopoulou, K. K. Hansen, M. Saifeddine, I. Tea, M. Blaber, S. I. Blaber, I. Scarisbrick, P. Andrade-Gordon, G. S. Cottrell, N. W. Bunnett, et al.
Proteinase-activated Receptors, Targets for Kallikrein Signaling
J. Biol. Chem., October 27, 2006; 281(43): 32095 - 32112.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. Xue, M. D. Hollenberg, and V. Wee Yong
Combination of Thrombin and Matrix Metalloproteinase-9 Exacerbates Neurotoxicity in Cell Culture and Intracerebral Hemorrhage in Mice
J. Neurosci., October 4, 2006; 26(40): 10281 - 10291.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Adam, K. K. Hansen, O. F. Astudillo, L. Coulon, F. Bex, X. Duhant, E. Jaumotte, M. D. Hollenberg, and A. Jacquet
The House Dust Mite Allergen Der p 1, Unlike Der p 3, Stimulates the Expression of Interleukin-8 in Human Airway Epithelial Cells via a Proteinase-activated Receptor-2-independent Mechanism
J. Biol. Chem., March 17, 2006; 281(11): 6910 - 6923.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
E. B. Kelso, J. C. Lockhart, T. Hembrough, L. Dunning, R. Plevin, M. D. Hollenberg, C. P. Sommerhoff, J. S. McLean, and W. R. Ferrell
Therapeutic Promise of Proteinase-Activated Receptor-2 Antagonism in Joint Inflammation
J. Pharmacol. Exp. Ther., March 1, 2006; 316(3): 1017 - 1024.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
E. A. Lidington, R. Steinberg, A. R. Kinderlerer, R. C. Landis, M. Ohba, A. Samarel, D. O. Haskard, and J. C. Mason
A role for proteinase-activated receptor 2 and PKC-{epsilon} in thrombin-mediated induction of decay-accelerating factor on human endothelial cells
Am J Physiol Cell Physiol, December 1, 2005; 289(6): C1437 - C1447.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Zhao, M. Morimoto, H. Dawson, J. E. Elfrey, K. B. Madden, W. C. Gause, B. Min, F. D. Finkelman, J. F. Urban Jr, and T. Shea-Donohue
Immune Regulation of Protease-Activated Receptor-1 Expression in Murine Small Intestine during Nippostrongylus brasiliensis Infection
J. Immunol., August 15, 2005; 175(4): 2563 - 2569.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. K. Hansen, P. M. Sherman, L. Cellars, P. Andrade-Gordon, Z. Pan, A. Baruch, J. L. Wallace, M. D. Hollenberg, and N. Vergnolle
A major role for proteolytic activity and proteinase-activated receptor-2 in the pathogenesis of infectious colitis
PNAS, June 7, 2005; 102(23): 8363 - 8368.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
A. Baurand, A. Eckly, B. Hechler, G. Kauffenstein, J.-L. Galzi, J.-P. Cazenave, C. Leon, and C. Gachet
Differential Regulation and Relocalization of the Platelet P2Y Receptors after Activation: A Way to Avoid Loss of Hemostatic Properties?
Mol. Pharmacol., March 1, 2005; 67(3): 721 - 733.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
M. Steinhoff, J. Buddenkotte, V. Shpacovitch, A. Rattenholl, C. Moormann, N. Vergnolle, T. A. Luger, and M. D. Hollenberg
Proteinase-Activated Receptors: Transducers of Proteinase-Mediated Signaling in Inflammation and Immune Response
Endocr. Rev., February 1, 2005; 26(1): 1 - 43.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. C. Buresi, N. Vergnolle, K. A. Sharkey, C. M. Keenan, P. Andrade-Gordon, G. Cirino, D. Cirillo, M. D. Hollenberg, and W. K. MacNaughton
Activation of proteinase-activated receptor-1 inhibits neurally evoked chloride secretion in the mouse colon in vitro
Am J Physiol Gastrointest Liver Physiol, February 1, 2005; 288(2): G337 - G345.
[Abstract] [Full Text] [PDF]


Home page
NeuroscientistHome page
T. Rohatgi, F. Sedehizade, K. G. Reymann, and G. Reiser
Protease-Activated Receptors in Neuronal Development, Neurodegeneration, and Neuroprotection: Thrombin as Signaling Molecule in the Brain
Neuroscientist, December 1, 2004; 10(6): 501 - 512.
[Abstract] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
J. J. McGuire, M. Saifeddine, C. R. Triggle, K. Sun, and M. D. Hollenberg
2-Furoyl-LIGRLO-amide: A Potent and Selective Proteinase-Activated Receptor 2 Agonist
J. Pharmacol. Exp. Ther., June 1, 2004; 309(3): 1124 - 1131.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
B. Al-Ani, K. K. Hansen, and M. D. Hollenberg
Proteinase-Activated Receptor-2: Key Role of Amino-Terminal Dipeptide Residues of the Tethered Ligand for Receptor Activation
Mol. Pharmacol., January 1, 2004; 65(1): 149 - 156.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
Y. V. Kim, F. Di Cello, C. S. Hillaire, and K. S. Kim
Differential Ca2+ signaling by thrombin and protease-activated receptor-1-activating peptide in human brain microvascular endothelial cells
Am J Physiol Cell Physiol, January 1, 2004; 286(1): C31 - C42.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
A. Zhao and T. Shea-Donohue
PAR-2 agonists induce contraction of murine small intestine through neurokinin receptors
Am J Physiol Gastrointest Liver Physiol, October 1, 2003; 285(4): G696 - G703.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
P. J. O'Brien, H. Koi, S. Parry, L. F. Brass, J. F. Strauss III, L.-P. Wang, J. E. Tomaszewski, and L. K. Christenson
Thrombin Receptors and Protease-Activated Receptor-2 in Human Placentation: Receptor Activation Mediates Extravillous Trophoblast Invasion in Vitro
Am. J. Pathol., October 1, 2003; 163(4): 1245 - 1254.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Colognato, J. R. Slupsky, M. Jendrach, L. Burysek, T. Syrovets, and T. Simmet
Differential expression and regulation of protease-activated receptors in human peripheral monocytes and monocyte-derived antigen-presenting cells
Blood, October 1, 2003; 102(7): 2645 - 2652.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. C. Chin, N. Vergnolle, W. K. MacNaughton, J. L. Wallace, M. D. Hollenberg, and A. G. Buret
Proteinase-activated receptor 1 activation induces epithelial apoptosis and increases intestinal permeability
PNAS, September 16, 2003; 100(19): 11104 - 11109.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
D. Darmoul, V. Gratio, H. Devaud, T. Lehy, and M. Laburthe
Aberrant Expression and Activation of the Thrombin Receptor Protease-Activated Receptor-1 Induces Cell Proliferation and Motility in Human Colon Cancer Cells
Am. J. Pathol., May 1, 2003; 162(5): 1503 - 1513.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
B. Al-Ani and M. D. Hollenberg
Selective Tryptic Cleavage at the Tethered Ligand Site of the Amino Terminal Domain of Proteinase-Activated Receptor-2 in Intact Cells
J. Pharmacol. Exp. Ther., March 1, 2003; 304(3): 1120 - 1128.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. W. Klarenbach, A. Chipiuk, R. C. Nelson, M. D. Hollenberg, and A. G. Murray
Differential Actions of PAR2 and PAR1 in Stimulating Human Endothelial Cell Exocytosis and Permeability: The Role of Rho-GTPases
Circ. Res., February 21, 2003; 92(3): 272 - 278.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
J. J. McGuire, J. Dai, P. Andrade-Gordon, C. R. Triggle, and M. D. Hollenberg
Proteinase-Activated Receptor-2 (PAR2): Vascular Effects of a PAR2-Derived Activating Peptide via a Receptor Different than PAR2
J. Pharmacol. Exp. Ther., December 1, 2002; 303(3): 985 - 992.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. D. Hollenberg
PARs in the stars: proteinase-activated receptors and astrocyte function. Focus on "Thrombin (PAR-1)-induced proliferation in astrocytes via MAPK involves multiple signaling pathways"
Am J Physiol Cell Physiol, November 1, 2002; 283(5): C1347 - C1350.
[Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
H. Wang, J. J. Ubl, R. Stricker, and G. Reiser
Thrombin (PAR-1)-induced proliferation in astrocytes via MAPK involves multiple signaling pathways
Am J Physiol Cell Physiol, November 1, 2002; 283(5): C1351 - C1364.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
M. C. BURESI, A. G. BURET, M. D. HOLLENBERG, and W. K. MacNAUGHTON
Activation of proteinase-activated receptor 1 stimulates epithelial chloride secretion through a unique MAP kinase- and cyclo-oxygenase-dependent pathway
FASEB J, October 1, 2002; 16(12): 1515 - 1525.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
B. Al-Ani, S. J. Wijesuriya, and M. D. Hollenberg
Proteinase-Activated Receptor 2: Differential Activation of the Receptor by Tethered Ligand and Soluble Peptide Analogs
J. Pharmacol. Exp. Ther., September 1, 2002; 302(3): 1046 - 1054.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
G. R. Stenton, O. Nohara, R. E. Dery, H. Vliagoftis, M. Gilchrist, A. Johri, J. L. Wallace, M. D. Hollenberg, R. Moqbel, and A. D. Befus
Proteinase-Activated Receptor (PAR)-1 and -2 Agonists Induce Mediator Release from Mast Cells by Pathways Distinct from PAR-1 and PAR-2
J. Pharmacol. Exp. Ther., August 1, 2002; 302(2): 466 - 474.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
M. D. Hollenberg and S. J. Compton
International Union of Pharmacology. XXVIII. Proteinase-Activated Receptors
Pharmacol. Rev., June 1, 2002; 54(2): 203 - 217.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. E Cuffe, M. Bertog, S. Velazquez-Rocha, O. Dery, N. Bunnett, and C. Korbmacher
Basolateral PAR-2 receptors mediate KCl secretion and inhibition of Na+ absorption in the mouse distal colon
J. Physiol., February 15, 2002; 539(1): 209 - 222.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
B. Al-Ani, M. Saifeddine, S. J. Wijesuriya, and M. D. Hollenberg
Modified Proteinase-Activated Receptor-1 and -2 Derived Peptides Inhibit Proteinase-Activated Receptor-2 Activation by Trypsin
J. Pharmacol. Exp. Ther., February 1, 2002; 300(2): 702 - 708.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Fiorucci, A. Mencarelli, B. Palazzetti, E. Distrutti, N. Vergnolle, M. D. Hollenberg, J. L. Wallace, A. Morelli, and G. Cirino
Proteinase-activated receptor 2 is an anti-inflammatory signal for colonic lamina propria lymphocytes in a mouse model of colitis
PNAS, November 20, 2001; 98(24): 13936 - 13941.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. C. Buresi, E. Schleihauf, N. Vergnolle, A. Buret, J. L. Wallace, M. D. Hollenberg, and W. K. MacNaughton
Protease-activated receptor-1 stimulates Ca2+-dependent Cl{-} secretion in human intestinal epithelial cells
Am J Physiol Gastrointest Liver Physiol, August 1, 2001; 281(2): G323 - G332.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
S. R. Macfarlane, M. J. Seatter, T. Kanke, G. D. Hunter, and R. Plevin
Proteinase-Activated Receptors
Pharmacol. Rev., June 1, 2001; 53(2): 245 - 282.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
H. Danahay, L. Withey, C. T. Poll, S. F. J. van de Graaf, and R. J. Bridges
Protease-activated receptor-2-mediated inhibition of ion transport in human bronchial epithelial cells
Am J Physiol Cell Physiol, June 1, 2001; 280(6): C1455 - C1464.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. D. Hollenberg
Receptor Binding and Agonist Efficacy: New Insights from Mutants of the Thrombin Protease-Activated Receptor-1 (PAR-1)
Mol. Pharmacol., April 13, 2001; 58(6): 1175 - 1177.
[Full Text]


Home page
Mol. Pharmacol.Home page
B. D. Blackhart, L. Ruslim-Litrus, C.-C. Lu, V. L. Alves, W. Teng, R. M. Scarborough, E. E. Reynolds, and D. Oksenberg
Extracellular Mutations of Protease-Activated Receptor-1 Result in Differential Activation by Thrombin and Thrombin Receptor Agonist Peptide
Mol. Pharmacol., April 13, 2001; 58(6): 1178 - 1187.
[Abstract] [Full Text]


Home page
J. Physiol.Home page
J. J Ubl, M. Sergeeva, and G. Reiser
Desensitisation of protease-activated receptor-1 (PAR-1) in rat astrocytes: evidence for a novel mechanism for terminating Ca2+ signalling evoked by the tethered ligand
J. Physiol., June 1, 2000; 525(2): 319 - 330.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. J. O'Brien, N. Prevost, M. Molino, M. K. Hollinger, M. J. Woolkalis, D. S. Woulfe, and L. F. Brass
Thrombin Responses in Human Endothelial Cells. CONTRIBUTIONS FROM RECEPTORS OTHER THAN PAR1 INCLUDE THE TRANSACTIVATION OF PAR2 BY THROMBIN-CLEAVED PAR1
J. Biol. Chem., April 28, 2000; 275(18): 13502 - 13509.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
B. Al-Ani, M. Saifeddine, A. Kawabata, B. Renaux, S. Mokashi, and M. D. Hollenberg
Proteinase-Activated Receptor 2 (PAR2): Development of a Ligand-Binding Assay Correlating with Activation of PAR2 by PAR1- and PAR2-Derived Peptide Ligands
J. Pharmacol. Exp. Ther., August 1, 1999; 290(2): 753 - 760.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
S. J. Compton, J. A. Cairns, K.-J. Palmer, B. Al-Ani, M. D. Hollenberg, and A. F. Walls
A Polymorphic Protease-activated Receptor 2 (PAR2) Displaying Reduced Sensitivity to Trypsin and Differential Responses to PAR Agonists
J. Biol. Chem., December 8, 2000; 275(50): 39207 - 39212.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. R. Hamilton, A. G. Frauman, and T. M. Cocks
Increased Expression of Protease-Activated Receptor-2 (PAR2) and PAR4 in Human Coronary Artery by Inflammatory Stimuli Unveils Endothelium-Dependent Relaxations to PAR2 and PAR4 Agonists
Circ. Res., July 6, 2001; 89(1): 92 - 98.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kawabata, A.
Right arrow Articles by Hollenberg, M. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kawabata, A.
Right arrow Articles by Hollenberg, M. D.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition