Introduction

Top Abstract Introduction Materials & Methods Results Discussion References

TGF-1 has many diverse biological functions, including regulating cell activation, proliferation, differentiation and viability and promoting tissue regeneration and repair (Massague, 1990; Stavnezer, 1995; Wahl et al., 1988). These pleiotropic regulatory effects extend to the immune system, where TGF-1 is capable of mediating both stimulatory and inhibitory activity on effector functions of leukocytes engaged in immune responses (Massague, 1990; Stavnezer, 1995; Takahama et al., 1994). These diverse effects mediated by TGF-1 are probably linked to many variables, including the specific cell type being targeted, the TGF-1 concentration and the stage of activation or differentiation the target cell is in when it encounters TGF-1. Historically, the majority of research attention has been devoted to the immunoinhibitory effects produced by TGF-1, including that exerted on B-cell proliferation and IgM and IgG secretion (Kehrl et al., 1991), cytotoxic T-cell generation (Ranges et al., 1987), T-cell growth (Kehrl et al., 1986) and NK cell function (Bellone et al., 1995). However, a better understanding of its regulatory effects suggests that TGF-1 acts more as a factor that promotes certain responses at the expense of others than as a general mediator of immunosuppression. Supporting this premise is the fact that although TGF-1 is a potent inhibitor of IgM and IgG production, it helps induce immunoglobulin class switching to promote IgA production (Coffman et al., 1989; Kehrl et al., 1986; Kehrl et al., 1991; Lebman et al., 1990). Similarly, TGF-1 inhibits Th2 cytokine expression, including IL-4 and IL-5; once again, this is primarily due to the promoting activity it exerts on Th1 cells, which is characterized by enhanced secretion of IL-2 and IFN- (Sad and Mosmann, 1994; Spaccapelo et al., 1995; Swain et al., 1991). However, it is also notable that the enhancing activity of TGF-1 even on IL-2 expression has been controversial and is probably associated with the activational state of T-cells when they encounter TGF-1.

With regard to T-cell regulation, one of the most profound effects by TGF-1 is to increase IL-2 production. The increase in IL-2 has been correlated with an increase in IL-2 gene expression and does not appear to involve changes in cell cycle progression (Cerwenka et al., 1994). Moreover, in primary T-cells, the most striking effects of TGF-1 have been observed after secondary challenge when cells initially received a primary activational stimulus in the presence of TGF-1 (Cerwenka et al., 1994; Swain et al., 1991). This co-stimulatory signal delivered by TGF-1 to facilitate enhanced secondary T-cell responses has been referred to as a "priming effect." Concomitant with the priming effect, TGF-1 exhibited enhanced phorbol-12-myristate-13-acetate (PMA)³-induced CD2 receptor and human mucosal lymphocyte-1 expression but had no effect on CD4, CD8, CD45RA, CD45RO, CD25, CD71 and B7 expression. The T-cell priming effect is also characterized by increased proliferation (Swain et al., 1991).

The mechanism by which TGF-1 helps to regulate IL-2 positively (or, under certain conditions, negatively) is poorly understood. Because of the current interest in TGF-1 as a multifaceted regulator, the signal-transducing events initiated through TGF- receptors are being vigorously investigated. Little is known about how these signaling events via the TGF receptor affect T-cell regulation. In light of the aforementioned priming effect, which appears to be related to T-cell activation, the object of the present studies was to investigate the direct actions of TGF-1 on IL-2 gene regulation by using the murine thymoma EL4. We report that TGF-1, in the absence of any additional stimuli, produced a modest activation of IL-2 gene expression. Moreover, this pleiotropic cytokine induced DNA binding by trans-activating factors critical in regulating IL-2 gene expression, including NF-AT, NF-B and AP-1, in EL4 cells. Equally important, induction of DNA binding by trans-activating factors was sufficient to activate transcription as measured by NF-B, NF-AT and AP-1 CAT-expression vectors. In light of the fact that all three major families of transcription factors that regulate IL-2 expression were positively regulated by TGF-1, these findings suggest that there may be significant overlap in T-cells between the signal transduction circuits that activate transcription of the IL-2 gene in the absence of TGF-1 and those pathways activated through TGF- receptors.

	Materials and Methods

Top Abstract Introduction Materials & Methods Results Discussion References

Reagents. The following drugs and chemicals were used in this study: porcine TGF-1 (R&D Systems Inc., Minneapolis, MN), PMA, ionomycin and acetyl CoA (Sigma Chemical Co., St. Louis, MO), reagents for cell culture (Gibco BRL, Grand Island, NY), FCS (Hyclone Laboratories, Logan, UT), PCR reagents (Promega, Madison, WI), DEAE-Dextran (Pharmacia, Uppsala, Sweden) and D-threo-[dichloroacetyl-1-¹⁴C]chloramphenicol (Amersham Life Science Co., Arlington Heights, IL).

Cells and culture conditions. The C57BL/6 mouse T-cell lymphoma, EL4, was obtained from American Type Culture Collection (Bethesda, MD) and cultured in Roswell Park Memorial Institute (RPMI) 1640 medium supplemented with 10% FCS, 100 U/ml penicillin, 100 µg/ml streptomycin, 50 µM 2-ME, and 2 mM L-glutamine at 37°C in a 5% CO₂-humidified incubator.

Preparation of internal standard for RT-PCR. A recombinant IL-2 IS was prepared to quantify IL-2 mRNA expression by quantitative/competitive RT-PCR as previously described (Condie et al., 1996). Briefly, rcRNA was used as an IS containing specific PCR primer sequences for IL-2 that were added to RNA samples in a dilution series. A rat -globin sequence was used as the spacer gene for the IL-2 IS. This method, developed by Vanden Heuvel (Vanden Heuvel et al., 1994; Vanden Heuvel et al., 1993), avoids sample-to-sample variation of reference gene expression (e.g., -actin), as well as gene-to-gene differences in amplification efficiency. The primer sequences from 5' to 3' for IL-2 are forward primer = TGCTCCTTGTCAACAGCG and reverse primer = TCATCATCGAATTGGCACTC. This IS primer design from 5' to 3' is as follows: IS forward primer = T7 promoter (TAATACGACTCACTATAGG), IL-2 forward primer (as stated above) and rat -globin forward primer (GGTGCTTGGAGACAGAGGTC); IS reverse primer = (dT)₁₈, IL-2 reverse primer (as stated above) and rat -globin reverse primer (TCCTGTCAACAATCCACAGG). PCR reaction conditions for making the IS were performed as stated previously, using 100 ng of rat tailed-genomic DNA (Vanden Heuvel et al., 1993). PCR-amplified products were purified using the Wizard PCR Prep DNA Purification System (Promega Co, Madison, WI) and transcribed into RNA using Promega's Gemini II In Vitro Transcription System. The rcRNA was subsequently treated with RNase-free DNase to remove the DNA template. After quantifying, the following calculations were performed to determine the molecules per microliter of the IL-2 IS which was 330 bp: Additionally, we that 330 × bp equals the molecular weight of the IS.

Quantitative competitive RT-PCR. Total RNA was isolated using Tri Reagent (Molecular Research Center, Cincinnati, OH) as described by Chomczynski (1993) and Chomczynski and Mackey (1995). In order to avoid any DNA contamination, RNA samples were incubated with RNase-free DNase for 15 min at 37°C in 10 mM MgCl₂, 1 mM DTT, 25 U/ml RNase inhibitor, 10 mM Tris and 1 mM EDTA, phenol:chloroform-extracted and precipitated in isopropyl alcohol. Competitive RT-PCR was performed as outlined in Gilliland et al. (Gilliland et al., 1990a; Gilliland et al., 1990b), except that rcRNA was used as an IS instead of genomic DNA, with 8 aliquots of rcRNA from 10² to 10⁹ molecules made for each RNA treatment group. Briefly, total RNA and IS rcRNA of known amounts were reverse-transcribed into cDNA using oligo(dT)₁₅ as primers. A PCR master mixture consisting of PCR buffer, 4 mM MgCl₂, 6 pmol each of IL-2 forward and reverse primers and 2.5 U of Taq DNA polymerase was added to the cDNA samples. Samples were then heated to 94°C for 4 min and cycled 30 times at 94°C for 16 sec, 60°C for 30 sec and 72°C for 30 sec, after which an additional extension step at 72°C for 5 min was included. PCR products were electrophoresed in 3% NuSieve 3:1 gels (FMC Bioproducts, Rockland, ME) and visualized by ethidium bromide staining. The IL-2 primers produce a 391-bp amplified product from the cellular RNA and a 474-bp product from the IS rcRNA. Quantitation was performed using the Gel Doc 1000 (Bio-Rad), where the amount of IL-2 mRNA present is determined as described by Gilliland et al. (1990b). Briefly, the ratio of the volume of the IS rcRNA to IL-2 RNA bands are plotted against the amount of IS rcRNA (in molecules) added to each reaction. The point at which the ratio of IS (rcRNA) to IL-2 mRNA is equal to 1 signifies the "cross-over" point that represents the amount of IL-2 molecules present in the initial RNA sample. After performing the 10² to 10⁹ range-finding experiment, we examined a second set of much narrower IS dilutions to quantify RNA message levels more accurately.

ELISA for IL-2 quantitation. Mouse recombinant IL-2 (as standard), purified rat anti-mouse IL-2 antibody and biotinylated anti-mouse IL-2 antibody were purchased from PharMingen (San Diego, CA). EL4 cells (5 × 10⁵/ml) were cultured in triplicate in 48-well cell culture plates (0.8 ml/well, Corning Inc., Corning, NY). The supernatants were collected at the indicated time-points and quantitated for IL-2 by enzyme-linked immunosorbent assay (ELISA) as described previously (Ouyang et al., 1995).

EMSA. Nuclear extracts were prepared as described (Xie et al., 1993). Treated and untreated EL4 cells were lysed with hypotonic buffer (10 mM HEPES, 1.5 mM MgCl₂, pH 7.5), and the nuclei were pelleted by centrifugation at 3000 × g for 5 min. Nuclear lysis was performed using a hypertonic buffer (30 mM HEPES, 1.5 mM MgCl₂, 450 mM KCl, 0.3 mM EDTA and 10% glycerol) that contained 1 mM DTT, 1 mM PMSF and 1 µg/ml each of aprotinin and leupeptin. After lysis, the samples were centrifuged at 14,500 × g for 20 min, and the supernatant was retained for use in the DNA binding assay. Double-stranded deoxyoligonucleotides containing the NF-B consensus recognition site (5'-GGGGACTTTCC-3') (Pierce et al., 1988), the Oct (5'-ATGCAAAT-3') (Wirth et al., 1987), the NF-AT (5'-GAGGAAAATTTG-3') (Jain et al., 1993) and the AP-1 (5'-TGACTCA-3') were synthesized and end-labeled with [-³²P]-dATP. Nuclear extracts (5 µg) were incubated with 1 µg poly (dI-dC) and the ³²P-labeled DNA probe in the binding buffer (100 mM KCl, 30 mM HEPES, 1.5 mM MgCl₂, 0.3 mM EDTA, 10% glycerol, 1 mM DTT, 1 mM PMSF and 1 µg/ml each of aprotinin and leupeptin) for 20 min at room temperature. DNA binding activity was separated from free probe using a 4.8% polyacrylamide gel in 0.5 X TBE (44.5 mM Tris, 44.5 mM boric acid and 1 mM EDTA). After electrophoresis, the gel was dried and subjected to autoradiography.

Plasmid construction. A minimal promoter vector containing no enhancer, pCAT-Promoter, was purchased from Promega Co. (Madison, WI). To construct p(NF-B)₃-CAT, p(NF-AT)₃-CAT and p(AP-1)₃-CAT, BglII-adhering oligonucleotides containing three copies of each consensus recognition motif, either NF-B, NF-AT or AP-1, were synthesized and cloned into the pCAT-Promoter vector, respectively. Cloning was confirmed by a comparison of EcoRI-digested fragments from each recombinant plasmid and pCAT-Promoter vector. p(NF-B)₃-CAT, p(NF-AT)₃-CAT and p(AP-1)₃-CAT were then purified with Quiagen Plasmid Kit (Quiagen Inc., Chatsworth, CA) and quantified for transient transfection studies.

Transfection and CAT assay. Transient transfections were performed using a general DEAE-Dextran method with slight modifications (Pierce et al., 1991; Pierce et al., 1988). A total of 2 × 10⁷ cells were washed with Tris-buffered saline and incubated in 4 ml of buffer containing 25 mM Tris-HCl (pH 7.4), 137 mM NaCl, 5 mM KCl, 0.6 mM Na₂HPO₄, 0.7 mM CaCl₂ and 0.5 mM MgCl₂ plus 40 µg of each plasmid and 200 µg of DEAE-Dextran per milliliter at 37°C for 40 min. Cells were washed with HEPES-buffered saline (140 mM NaCl, 5 mM KCl, 0.75 mM Na₂HPO₄, 6 mM dextrose and 25 mM HEPES) and cultured in four Petri dishes. Twenty-four hours after transfection, cells were treated with the indicated concentrations of TGF-1. Cells were harvested 18 hr later, washed with phosphate-buffered saline and then freeze-thawed three times in 100 µl of 0.25 mM Tris-HCl (pH 7.4) using liquid N₂. The supernatants were isolated, and equal amounts of proteins were incubated in the CAT reaction mixture containing 0.1 µCi [¹⁴C]-chloramphenicol, 0.7 mM acetyl CoA and 0.14 M Tris-HCl (pH 7.4) at 37°C for 3 hr. The degree of acetylation was assessed by thin-layer chromatography and autoradiography.

Statistical analysis. The mean ± S.E. was determined for each treatment group in the individual experiments. Homogeneous data were evaluated by a parametric analysis of variance, and Dunnett's two-tailed t test was used to compare treatment groups with the vehicle control when significant differences were observed (Dunnett, 1955).

	Results

Top Abstract Introduction Materials & Methods Results Discussion References

TGF-1 induction of IL-2 mRNA expression in EL4 cells as measured by qualitative RT-PCR. We have previously reported that Con A stimulation of splenocytes isolated from mice possessing elevated TGF-1 serum concentrations induced markedly enhanced IL-2 secretion (Delaney et al., 1994). To investigate further the regulation of IL-2 by TGF-1, EL4 cells were employed as a model system. In a preliminary set of experiments, we found that TGF-1 (1 ng/ml), in the absence of any additional stimuli, induced IL-2 mRNA expression in EL4 cells as demonstrated by qualitative RT-PCR. Figure 1 compares the effects of TGF-1, PMA and PMA plus ionomycin treatment on IL-2 mRNA expression in EL4 cells. In these initial studies, we used 1 ng/ml of TGF-1 in light of previous experiments that showed strong immunomodulatory activity in splenocyte preparation at this concentration. Although all three treatments were capable of inducing IL-2 mRNA expression, the greatest magnitude of stimulation, not surprisingly, was observed with PMA plus ionomycin treatment. It is notable that basal IL-2 mRNA expression was below the level of detection in EL4 cells, even as measured by RT-PCR. In light of the fact that TGF-1 alone can induce IL-2 expression, this model makes it possible to evaluate the direct effects of TGF-1 on IL-2 regulation in the absence of any confounding stimuli.

View larger version (60K): [in this window] [in a new window]   Fig. 1.   Induction of IL-2 mRNA expression in EL4 cells treated with TGF-1. EL4 cells (5 × 105 cells/ml) were treated with 1 ng/ml TGF-1, 80 nM PMA, 1 µM ionomycin (Io), and PMA/Io, respectively, and incubated for 24 hr at 37°C in a 5% CO2-humidified incubator. At the end of the incubation period, the cells were harvested and total RNA was isolated as described in "Materials and Methods." IL-2 transcripts were amplified by RT-PCR from 100 ng of total RNAs and qualitatively standardized on the basis of the concentration of 18S and 28S ribosomal RNAs. One of three representative experiments is shown.

TGF-1 induction of IL-2 mRNA expression and secretion. On the basis of the foregoing results, a quantitative RT-PCR approach was utilized to determine more precisely whether dose-related modulation of IL-2 mRNA expression could be demonstrated in response to TGF-1 in EL4 cells. We have found this quantitative RT-PCR method to be extremely sensitive in quantifying the relative expression of mRNAs for a variety of genes, including IL-2 (Condie et al., 1996). The method utilizes a rcRNA IS, which is used to spike isolated RNA samples and is then simultaneously co-amplified with the target gene (e.g., IL-2). EL4 cells were incubated with TGF-1 over a broad dose range (0.01-1 ng/ml) for 24 hr, and then the magnitude of IL-2 mRNA was determined by quantitative RT-PCR (fig. 2A). Interestingly, IL-2 mRNA expression was unchanged in the cells treated with 0.01 to 0.08 ng/ml of TGF-1. Conversely, IL-2 mRNA was significantly increased at a concentration of 0.1 ng/ml, exhibiting what appeared to be a threshold-like response. At 0.1 ng/ml, TGF-1 produced peak IL-2 mRNA expression, which gradually waned at higher concentrations but still remained elevated at 1 ng/ml. The number of IL-2 mRNA molecules in cells treated with TGF-1 (0.1-1 ng/ml) was in the range of ~10⁴ per 100 ng of total RNA. Culture supernatants were collected at 24 hr and assayed for IL-2 by ELISA to determine whether the modest increase in IL-2 mRNA expression by TGF-1 resulted in IL-2 production. In the absence of any additional stimuli, 0.1 ng/ml TGF-1 did in fact induce a modest level of IL-2 secretion by EL4 cells (fig. 2B).

View larger version (12K): [in this window] [in a new window]   Fig. 2.   Dose-dependent induction of IL-2 mRNA expression by TGF-1 in EL4 cells. EL4 cells (5 × 105 cells/ml) were treated with the indicated concentrations of TGF-1 (0.01-1 ng/ml) and incubated for 24 hr at 37°C in a 5% CO2-humidified incubator. At the end of the incubation period, the cells were harvested and total RNA was isolated as described in "Materials and Methods." IL-2 mRNA in 400 ng of total RNA was amplified with rcRNA as an internal standard by quantitative RT-PCR. After electrophoresis using a 3% NuSieve 3:1 gel, DNA bands were quantitated, and the ratio of internal standard to IL-2 mRNA in each sample was calculated in order to generate each standard curve for each treatment group. Each bar represents the mean number of molecules of IL-2 mRNA per 100 ng of total RNA. Error bars represent the S.D. of each treatment group. One of three representative experiments is shown.

Kinetics for induction of IL-2 mRNA expression by TGF-1. The kinetics of response to TGF-1 by EL4 cells was also determined, as assessed by the magnitude of IL-2 mRNA expression. EL4 cells were exposed to 0.1 ng/ml of TGF-1, the optimal concentration for IL-2 expression, over a period of 6 to 48 hr (fig. 3). IL-2 mRNA expression gradually increased as compared with background at 6 to 24 hr after TGF-1 treatment; maximal induction was observed at 24 hr. By 48 hr after TGF-1 treatment, IL-2 mRNA expression was returning toward basal levels. In light of the fact that IL-2 transcription is very tightly regulated, these results, which showed both dose- and time-dependent induction of IL-2 mRNA expression, strongly suggested that in EL4 cells, TGF-1 regulates IL-2 at the level of transcription.

View larger version (12K): [in this window] [in a new window]   Fig. 3.   Time-dependent induction of IL-2 mRNA expression by EL4 cells in response to 0.1 ng/ml TGF-1. EL4 cells (5 × 105 cells/ml) were treated with 0.1 ng/ml of TGF-1 and incubated for the indicated time periods (0-24 hr) at 37°C in a 5% CO2-humidified incubator. At the end of the incubation period, the cells were harvested and total RNA was isolated as described in "Materials and Methods." IL-2 mRNA in 400 ng of total RNA was amplified with rcRNA as an internal standard by quantitative RT-PCR. After electrophoresis using a 3% NuSieve 3:1 gel, DNA bands were quantitated, and the ratio of internal standard to IL-2 mRNA in each sample was calculated in order to generate each standard curve for each treatment group. Each bar represents the mean number of molecules of IL-2 mRNA per 100 ng of total RNA. Error bars represent the S.D. of each treatment group. One of three representative experiments is shown.

Modulation of NF-AT, NF-B, AP-1 and Oct by TGF-1 as determined by EMSA. The induction of IL-2 gene promoter activity is regulated by an approximately 300-bp region adjacent to the transcription initiation site. This cis-acting domain contains recognition binding sites for NF-AT, NF-B, AP-1 and Oct, transcription factors that act in concert to facilitate maximal activation of the IL-2 promoter. To assess in more detail the mechanism by which TGF-1 influences IL-2 mRNA expression, we investigated the effect of TGF-1 on NF-AT, NF-B, AP-1 and Oct DNA binding activity, using EMSA. Nuclear proteins isolated from TGF-1-treated EL4 cells exhibited an increase in DNA binding for all of the aforementioned consensus recognition domains except Oct site binding proteins. Figure 4 shows that TGF-1 treatment markedly induced two protein complexes that specifically bound to the B consensus recognition motif. A significant increase in B binding activity was induced 90 to 120 min after TGF-1 treatment of EL4 cells. Although it also increased, induction of AP-1 binding in EL4 cells by TGF-1 exhibited modestly different kinetics with peak binding occurring at approximately 60 min (fig. 5). AP-1 binding remained elevated even approximately 120 min after TGF-1 treatment; however, binding activity was noticeably decreasing by this point. Recently, TGF-1 has been implicated in the regulation of immediate early signaling events, including the activation of AP-1 activity in some promoters as well as increased expression of c-fos, junB, and c-jun, whose products bind to AP-1 sites. NF-AT binding activity was also strongly induced by TGF-1 (0.1 ng/ml) in EL4 cells, as exhibited by the formation of two distinct binding complexes (fig. 6). Enhanced NF-AT binding in response to TGF-1 was initially visible at 30 min after treatment and appeared to increase gradually over the following 120 min. Binding specificity was confirmed by excess unlabeled probe. In contrast, Oct, which exhibited strong basal binding activity, was not influenced by TGF-1 treatment throughout the 120-min incubation period (fig. 7). These results indicate that in EL4 cells, TGF-1 increases the binding activity of NF-AT, NF-B and AP-1, all of which are involved in the induction of IL-2 gene transcription.

View larger version (75K): [in this window] [in a new window]   Fig. 4.   Activation of NF-B binding in EL4 cells by TGF-1-treatment. EL4 cells (5 × 105 cells/ml) were treated with 0.1 ng/ml TGF-1 for 0 to 120 min. Nuclear extracts were isolated at various times after TGF-1 treatment and incubated with the 32P-labeled oligonucleotide containing a B consensus recognition motif. Two picomoles of 32P-unlabeled B probe was utilized for competition assay. Reaction products were resolved by electrophoresis, and the gel was dried and autoradiographed. NF-B/DNA binding is identified by arrows. One of three representative experiments is shown.

View larger version (78K): [in this window] [in a new window]   Fig. 5.   Activation of AP-1 binding in EL4 cells by TGF-1 treatment. EL4 cells (5 × 105 cells/ml) were treated with 0.1 ng/ml TGF-1 for 0 to 120 min. Nuclear extracts were isolated at various times after TGF-1 treatment and incubated with the 32P-labeled oligonucleotide containing a AP-1 consensus recognition motif. Two picomoles of 32P-unlabeled AP-1 probe was utilized for competition assay. Reaction products were resolved by electrophoresis, and the gel was dried and autoradiographed. AP-1/DNA binding is identified by arrows. One of three representative experiments is shown.

View larger version (78K): [in this window] [in a new window]   Fig. 6.   Activation of NF-AT binding in EL4 cells by TGF-1-treatment. EL4 cells (5 × 105 cells/ml) were treated with 0.1 ng/ml TGF-1 for 0 to 120 min. Nuclear extracts were isolated at various times after TGF-1 treatment and incubated with the 32P-labeled oligonucleotide containing a NF-AT consensus recognition motif. Two picomoles of 32P-unlabeled NF-AT probe was utilized for competition assay. Reaction products were resolved by electrophoresis, and the gel was dried and autoradiographed. NF-AT/DNA binding is identified by arrows. One of three representative experiments is shown.

View larger version (68K): [in this window] [in a new window]   Fig. 7.   Effect of TGF-1 on Oct binding activity in EL4 cells. EL4 cells (5 × 105 cells/ml) were treated with 0.1 ng/ml TGF-1 for 0 to 120 min. Nuclear extracts were isolated and incubated with the 32P-labeled oligonucleotide containing an Oct consensus recognition motif. Two picomoles of 32P-unlabeled Oct probe was utilized for competition assay. Reaction products were resolved by electrophoresis, and the gel was dried and autoradiographed. Oct/DNA binding is identified by arrows. One of three representative experiments is shown.

Increased DNA binding by NF-AT, NF-B and AP-1 in the presence of TGF-1 promotes transcriptional activity. To determine whether induction of DNA binding by NF-AT, NF-B and AP-1 would concordantly exhibit transcriptional activity, we made CAT-recombinant plasmids containing three copies of each binding sequence for NF-AT, NF-B and AP-1: p(NF-B)₃-CAT, p(NF-AT)₃-CAT and p(AP-1)₃-CAT, respectively. EL4 cells were transiently transfected with each recombinant construct by a general DEAE-Dextran method, and 24 hr later the cells were incubated with TGF-1 (0.1-1 ng/ml) for 18 hr. TGF-1 increased CAT reporter activity with all three constructs; p(NF-B)₃-CAT, p(NF-AT)₃-CAT and p(AP-1)₃-CAT, as shown in figures 8, 9 and 10. Interestingly, the magnitudes of activation by TGF-1, at the concentrations tested, were very similar with all three constructs.

View larger version (82K): [in this window] [in a new window]   Fig. 8.   Inducibility of the NF-B trimer/CAT activity by TGF-1 in transiently transfected EL4 cells. EL4 cells (5 × 105 cells/ml) were transiently transfected with a NF-B trimer/CAT construct pCAT(NF-B)3, as demonstrated by the DEAE-Dextran method. At 24 hr after transfection, the cells were incubated without or with TGF-1 (0.1-1 ng/ml) for 18 hr, and then the CAT activity of each treatment group was analyzed. The relative fold induction was normalized to the amount of CAT activity from cells incubated in the absence of TGF-1. One of the three representative experiments is shown.

View larger version (85K): [in this window] [in a new window]   Fig. 9.   Inducibility of the AP-1 trimer/CAT activity by TGF-1 in transiently transfected EL4 cells. EL4 cells (5 × 105 cells/ml) were transiently transfected with the AP-1 trimer/CAT construct pCAT(AP-1)3, as demonstrated by DEAE-Dextran method. At 24 hr after transfection, the cells were incubated without or with TGF-1 (0.1-1 ng/ml) for 18 hr, and then the CAT activity of each treatment group was analyzed. The relative fold induction was normalized to the amount of CAT activity from cells incubated in the absence of TGF-1. One of the three representative experiments is shown.

View larger version (79K): [in this window] [in a new window]   Fig. 10.   Inducibility of the NF-AT trimer/CAT activity by TGF-1 in transiently transfected EL4 cells. EL4 cells (5 × 105 cells/ml) were transiently transfected with the NF-AT trimer/CAT construct pCAT(NF-AT)3, as demonstrated by DEAE-Dextran method. At 24 hr after transfection, the cells were incubated without or with TGF-1 (0.1-1 ng/ml) for 18 hr, and then the CAT activity of each treatment group was analyzed. The relative fold induction was normalized to the amount of CAT activity from cells incubated in the absence of TGF-1. One of the three representative experiments is shown.

	Discussion

Top Abstract Introduction Materials & Methods Results Discussion References

In the present studies, we show that TGF-1, in the absence of any other stimuli, increased IL-2 mRNA expression in the mouse thymoma EL4. The increase in IL-2 mRNA expression induced by TGF-1, though modest in magnitude as compared with that observed after phorbol ester treatment, is consistent with previous reports implicating TGF-1 as a co-regulatory peptide that potentiates IL-2 secretion (Cerwenka et al., 1994; Swain et al., 1991). This premise is supported by the fact that primary T-cells activated in the presence of TGF-1 exhibit enhanced proliferation and secrete large amounts of IL-2. The mechanism responsible for enhanced IL-2 secretion in the presence of TGF-1 is poorly understood, as are the signal-transducing pathways associated with both forms of TGF- receptors, type I and type II. Because EL4 cells are a well-characterized model for investigating IL-2 regulation, we utilized this cell line to examine the direct effects of TGF-1 on IL-2 gene regulation.

Dose-response studies demonstrated that the peak stimulatory effects induced by TGF-1 on IL-2 mRNA expression in EL4 cells occurred at low concentrations (<1 ng/ml) within a relatively narrow concentration range; they were in fact sufficient at 0.1 ng/ml to induce a measurable amount of IL-2 secretion in the absence of any additional stimuli. Interestingly, TGF-1 also appeared to regulate IL-2 mRNA expression positively over a very narrow concentration range, an effect reminiscent of a threshold-like response. At approximately 0.08 ng/ml TGF-1, no effect was observed on IL-2 mRNA expression, whereas expression of IL-2 mRNA was maximal at 0.1 ng/ml TGF-1 in EL4 cells. The mechanism responsible for a threshold-like response to TGF-1 is unclear, but that response may at least in part be due to the unique interactions that are required between TGF- type I and type II receptors for induction of downstream signaling. The type II receptor, which is a constitutively active serine/threonine kinase receptor that can bind TGF-, is incapable of signaling in the absence of the type I receptor (Wrana et al., 1992). Additionally, TGF-1 can bind to the type I receptor only when the type II receptor is concomitantly present (Ebner et al., 1993; Wrana et al., 1994). Recently, Wang and co-workers have demonstrated, using a yeast two hybrid system, that immunophilin-FKBP12 (FKBP12), is associated with TGF- type I receptor and that this interaction is inhibitory to TGF- receptor-induced signaling (Wang et al., 1996). Ligand binding to TGF- type II receptors induces phosphorylation of FKBP12 and its release from type I receptors. In light of this, the threshold-like response to TGF-1 observed in our studies may reflect poor dissociation of FKBP12 from TGF- type I receptors in the presence of TGF-1 at concentrations below 0.1 ng/ml.

To characterize further the mechanism by which TGF-1 contributes to the positive regulation of IL-2 gene expression, we prepared nuclear extracts from TGF-1-treated EL4 cells for gel shift assays. The regulation of nuclear protein binding was evaluated using four separate recognition motifs: AP-1, NF-B, NF-AT and Oct. All of the aforementioned recognition motifs are well established as critical in the regulation of the IL-2 gene, and all are present in what has been termed the minimal essential region of the IL-2 promoter (321 bp) (Novak et al., 1990). The present studies revealed that TGF-1 treatment of EL4 cells rapidly (within 90 min) increased DNA binding by NF-AT, NF-B and AP-1. All three families of transcription factors that are normally induced during T-cell activation to initiate IL-2 transcription were found to have low or nondetectable DNA binding in the absence of TGF-1 by EL4 cells. The latter observation is consistent with numerous studies that have demonstrated that IL-2 is a tightly regulated gene with virtually no basal level of expression in primary T-cells. EL4 cells also exhibit a very low background level of IL-2 gene expression (i.e., in the absence of exogenous stimuli). Interestingly, NF-AT exhibited the greatest induction in DNA binding of the three families of transcription factors in response to TGF-1. Studies by Wang and co-workers suggest that concomitantly with the association of FKBP12 with TGF- type I receptor, there is an additional association between TGF- type I receptor-bound FKBP12 and a cytoplasmic inhibitory protein, which they propose is calcineurin (Wang et al., 1996). Moreover, they showed that a myristylated wild-type FKBP12, but not a calcineurin-binding-deficient FKBP12 mutant, specifically blocked TGF- responses, a result that suggests a critical role for calcineurin in the initiation of signal-transducing events through the TGF- type I receptor. Our findings are interesting in light of the Wang studies and suggest that TGF--induced release of calcineurin from the TGF- type I receptor may lead to increased dephosphorylation of NF-ATc, as implied by an increase in NF-AT DNA binding. Concomitantly with an increase in NF-AT binding activity, a strong activation of NF-B binding activity in EL4 cells by TGF-1 treatment was also observed, which suggests that signaling through TGF- type I receptors also leads to the activation of IB kinase and the dissociation of IB from NF-B. In comparison with NF-AT and NF-B, the magnitude of AP-1 DNA binding in response to TGF-1 was more moderately increased. Conversely, TGF-1 produced no significant effect on Oct, which exhibits a high constitutive level of DNA binding in primary T-cells and in EL4. Most striking is the fact that all three major inducible families of trans-activating factors (AP-1, NF-AT and NF-B) involved in IL-2 gene regulation exhibited increased DNA binding after TGF-1 treatment of EL4 cells. This finding suggests that signal events induced through the TGF- receptor may have significant overlap with those induced during T-cell activation, leading to IL-2 expression in the absence of TGF-1. Further, an overlap in signaling circuits provides a mechanism by which TGF-1 can function as a co-stimulator in potentiating IL-2 production by primary T-cells. It is notable that although EL4 cells represent a widely used model for studying IL-2 gene regulation, differences between this thymoma and primary T-cells exist. The most important with respect to these studies is the fact that primary T-cells, unlike EL4 cells, cannot be activated to produce IL-2 with phorbol ester alone and require an additional calcium signal through the use of a calcium ionophore. This is probably one of the reasons why TGF-1 alone does not induce IL-2 expression in primary T-cells and acts only as a co-stimulator/enhancer of IL-2 expression in the presence of a complete activation signal.

In light of the fact that binding of transcription factors to their respective cognate DNA recognition domains does not necessarily activate gene transcription, the ability of TGF-1 to regulate transcription activity was measured in EL4 cells using a series of CAT-reporter gene constructs under the regulation of NF-AT, NF-B or AP-1 enhancer domains. Transient transfection studies revealed induction of CAT activity with all three constructs in EL4 cells over the same TGF-1 concentration range as that which increased IL-2 mRNA expression and transcription factor binding observed in the gel shift assays. These findings are once again consistent with the fact that TGF-1 alone is a weak activator of IL-2 gene expression in EL4, and they further support the premise that TGF-1 acts as a co-stimulator of IL-2 expression in primary T-cells by contributing to the activation of relevant transcription factors necessary for IL-2 gene expression.

In spite of the fact that the specific role of TGF-1 in immune regulation is poorly understood, this multifunctional peptide has profound influence on leukocyte proliferation and differentiation. Interestingly, T-cells appear to be especially responsive to TGF-1, which is at least partially explained by its 5- to 10-fold higher binding affinity for T-cells than other cell types (Kehrl et al., 1986; Wakefield et al., 1987). The ability of TGF-1 to induce enhanced secretion of IL-2 and IFN-, while simultaneously inhibiting IL-4 and IL-5 secretion, has led to speculation that one specific role for TGF-1 in immune regulation is as a switch factor promoting Th1 cell responses. The present studies support an important role for TGF-1 as a co-stimulatory molecule at least in the regulation of IL-2. This is evidenced by the ability of TGF-1 to induce IL-2 mRNA expression and secretion at very low concentrations and within a relatively narrow concentration rangea common characteristic of regulatory molecules. The positive role of TGF-1 in IL-2 regulation is further support by its ability to increase DNA binding and gene transcription by three major families of inducible trans-activating factors known to regulate IL-2 gene expression: NF-AT, AP-1 and NF-B. Studies are currently underway to characterize further the modulation of IL-2 expression by TGF- in primary cells.