![]() |
|
|
Vol. 285, Issue 2, 862-868, May 1998
B by Tumor Necrosis Factor-
: Effects
on Prostaglandin Endoperoxide Synthase-2 mRNA Accumulation
Department of Pharmacology, New York Medical College, Valhalla, New York
| |
Abstract |
|---|
|
|
|---|
We previously have demonstrated that tumor necrosis factor-
(TNF-
) increases prostaglandin endoperoxide synthase-2 (PGHS-2) mRNA
accumulation and tyrosine phosphorylation in the fibrosarcoma cell
line, MCA-101. Tyrosine kinase inhibitor, genistein, and tyrosine
phosphatase inhibitor, phenylarsine oxide (PAO), blocked TNF-
-mediated induction of PGHS-2 mRNA in these cells. Because the
PGHS-2 promoter has a nuclear factor-
B (NF-
B) binding motif, which is important for PGHS-2 gene transcription in some cell types, we
have evaluated the effects of tyrosine kinase inhibitors and PAO on
TNF-
-induced NF-
B activation. TNF-
(1 nM) rapidly induced
translocation of NF-
B, an event accompanied by degradation of
inhibitory protein I
B-
. N-tosyl-L-phenylalanine
chloromethyl ketone (TPCK), a serine protease inhibitor, inhibited
I
B-
degradation and NF-
B activation in response to TNF-
in
a dose-dependent manner (25, 50, 100 µM). TPCK also inhibited PGHS-2
mRNA accumulation. These data suggest that NF-
B contributed to
PGHS-2 mRNA accumulation in MCA-101 cells stimulated with TNF-
. PAO
(2.4 µM) completely abolished activation of NF-
B and degradation
of I
B-
induced by TNF-
at a concentration that blocked PGHS-2
mRNA accumulation. However, four tyrosine kinase inhibitors, genistein,
tyrphostin 47, herbimycin A and erbstatin, failed to block
translocation of NF-
B and degradation of I
B-
. These data
demonstrate that tyrosine kinase pathways are not required for
TNF-
-induced NF-
B activation in MCA-101 cells and suggest that
signaling via these pathways mediates TNF-
-induced
PGHS-2 mRNA accumulation via an NF-
B-independent
mechanism. Moreover, an upstream tyrosine phosphatase pathway may
mediate PGHS-2 mRNA accumulation by TNF-
via an
NF-
B-dependent mechanism.
| |
Introduction |
|---|
|
|
|---|
Tumor
necrosis factor-
is a primary mediator of the immune and
inflammatory responses (Vassalli, 1992
). Induction of PGHS-2, with a
subsequent increase in prostaglandin formation, may contribute to the
net outcome of these responses. We demonstrated previously that TNF-
increases PGHS-2 mRNA accumulation, protein expression and
prostaglandin E2 formation in MCA-101 cells, a
murine fibrosarcoma cell line. Our results suggested that PTKs and
PTP-ase(s) play a role in the transcriptional and post-transcriptional
mechanisms that contribute to the regulation of the PGHS-2 gene by
TNF-
(Mahboubi et al., 1997a
).
Binding of TNF-
to p55 and p75 receptors, which lack intrinsic PTKs
and PTPase(s) activity, triggers multiple signaling pathways, that
result in activation of promoters and enhancers of various genes
including interleukin-6 (Patestos et al., 1993
),
interleukin-8 (Mukaida et al., 1990
), endothelial cell
adhesion molecules (Collins et al., 1995
) and PGHS-2
(Yamamoto et al., 1995
). TNF-
-mediated induction of some
of these genes occurs, at least in part, via induction of
transcription factor NF-
B. For instance, Yamamota et al.
(1995)
demonstrated the potential role of NF-
B in the induction of
PGHS-2 by TNF-
in MC3T3-E1 cells. NF-
B is a heterodimer that
comprises a 48- to 55-kdalton DNA binding subunit (p50) and a 65- to
68-kdalton transactivator (p65) (Siebenlist et al., 1994
), and it is sequestered within the cytosol by association with an inhibitory protein, I
B-
. Activation is post-translational and results from dissociation of I
B-
followed by translocation of the
released NF-
B into the nucleus. TNF-
is a potent activator of
NF-
B in a wide variety of the cell types including MCA-101 cells
(Mahboubi et al., 1997b
). Both TNF-
receptors
independently mediate NF-
B activation by TNF-
(Rothe et
al., 1995
; Hohmann et al., 1990
); however, the precise
mechanism responsible for this activation is unknown. Like all NF-
B
activators, TNF-
causes serine phosphorylation of I
B-
and
nearly complete degradation of the inhibitor within minutes after
administration (Miyamoto et al., 1994
; Finco et
al., 1994
; Sun et al., 1995
; Menon et al., 1995
; Mahboubi et al., 1997b
). Several signaling pathways,
including acidic and neutral sphingomyelinase-generated ceramides
(Schutze et al., 1992
), PTKs (Anderson et al.,
1994
; Reddy et al., 1994
), PTPase(s) (Menon et
al., 1995
; Singh and Aggarwal, 1995
), proteases (Finco et
al., 1994
) and superoxide radicals (Schreck et al., 1992
; Suzuki et al., 1994
; Schulze-Osthoff et
al., 1993
), have been implicated in TNF-
-induced
phosphorylation of I
B-
in different cell types. Whether these
signals are generated by TNF-
sequentially or independently of each
other, however, is not understood. Moreover, the relative contribution
of the individual signaling components to TNF-
-mediated NF-
B
likely will differ among cell types.
The role of PTPase(s) and PTKs in cytokine receptor signaling has been
investigated with use of various chemical inhibitors such as PAO, which
inhibits PTPase(s), and genistein, tyrphostin, herbimycin A and
erbstatin, which inhibit tyrosine kinases. By use of these inhibitors,
it has been shown that PTKs and PTPase(s) are part of TNF-
signal
transduction pathways. The importance of PTKs and PTP-ase(s) in
mediating TNF-
cytotoxicity (Sasaki and Patek, 1995
; Mishra et
al., 1994
; Totpal et al., 1992
) and NF-
B activation
(Singh and Aggarwal, 1995
; Guesdon et al., 1995
; Anderson
et al., 1994
; Reddy et al., 1994
) has been
demonstrated in several cell types.
We previously showed that TNF-
induces tyrosine phosphorylation in
MCA-101 cells and that tyrosine kinase and tyrosine phosphatase inhibitors prevent accumulation of PGHS-2 mRNA induced by TNF-
in
these cells (Mahboubi et al., 1997a
). In the present study we demonstrated that PTP-ase(s) inhibitor, PAO, abrogates the TNF-
-induced I
B-
degradation, and subsequently,
TNF-
-induced nuclear translocation of NF-
B in MCA-101 cells. A
serine protease inhibitor, TPCK, inhibits both PGHS-2 mRNA accumulation
and NF-
B activation induced by TNF-
in these cells. However,
tyrosine kinase inhibitors do not inhibit NF-
B activation induced by
TNF-
in these cells. Taken together, these results suggest that a
tyrosine kinase pathway may not be required for TNF-
-induced NF-
B
activation but is involved in TNF-
signal transduction pathways
leading to increased PGHS-2 accumulation in MCA-101 cells. Moreover,
tyrosine phosphatase-dependent NF-
B activation by TNF-
may be an
important mechanism by which PGHS-2 mRNA accumulation is increased.
| |
Experimental Procedures |
|---|
|
|
|---|
Cell line and reagents.
MCA-101 (a kind gift from Dr.
Nicholas Restifo, National Cancer Institute, Bethesda, MD) is a
fibrosarcoma cell line of B6 origin that was generated and cultured as
described previously (Mahboubi et al., 1997b
). Recombinant
mouse TNF-
was purchased from Genzyme (Boston, MA). PAO, TPCK,
leupeptin, PMSF, MTT and sodium orthovanadate were from Sigma Chemical
Co. (St. Louis, MO). Genistein, tyrphostin 47, herbimycin A and
erbstatin were purchased from LC Lab (Wonburn, MA). The PGHS-2 cDNA
probe (1.9 kb) was obtained from Oxford (Oxford, MI).
Western blot analysis of I
B-
.
After the appropriate
treatment with TNF-
, the media were removed and cells washed twice
with ice-cold PBS. Cells were harvested and centrifuged at 600 × g for 4 min in the cold room. The pellet was lysed with RIPA
buffer (PBS, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM PMSF,
10 µg/ml leupeptin, 1 mM sodium orthovanadate) for 30 min on ice. The
lysate was centrifuged at 10,000 × g for 20 min at
4°C. Protein concentrations of the supernatant were determined with a
detergent-compatible Bio-Rad protein assay kit. Cell lysate (20 µg)
was dissolved in an equal volume of 2× SDS-PAGE sample buffer (100 mM
Tris-Cl, pH 6.8, 200 mM DTT, 4% SDS, 0.2% bromophenol blue, 20%
glycerol) and boiled for 3 min. The proteins in the cell lysate were
separated on a 10% SDS-PAGE gel and transferred to nitrocellulose.
Nonspecific sites on the membrane were blocked by incubating the
membrane in blocking solution containing 3% non-fat dry milk in TBST
at room temperature for 30 min. After blocking, membranes were
immunoblotted with rabbit anti-human I
B-
antibody (Santa Cruz
Biotechnology, Santa Cruz, CA) at 1 µg/ml in blocking solution for 45 min and washed two times for 7 min with TBST. Membranes were incubated
with horseradish peroxidase-conjugated goat anti-rabbit antisera (Santa
Cruz Biotechnology, Santa Cruz, CA) and diluted in blocking solution
for 30 min at room temperature. Membranes were washed with TBST, and
I
B-
protein was detected by the enhanced chemiluminescence system
(Amersham, Arlington Heights, IL).
Total RNA isolation and Northern blot analysis.
Confluent,
quiescent cells were incubated in the absence or presence of TNF-
in
media containing 0.5% serum. After various incubation periods, media
were removed and the cell monolayers washed twice with ice-cold PBS.
Total cellular RNA was isolated by lysing the cells in guanidine
isothiocyanate sodium citrate buffer and extracting RNA with ethanol as
described previously (Kamdar and Evans, 1992
). RNA (10 µg) was
electrophoresed in a 1% agarose/formaldehyde gel in 1×
3-[N-morpholino] propane sulfonic acid as running buffer. RNA was
then transferred to a nylon membrane (Genescreen, Dupont-New England
Nuclear, Boston, MA) and hybridized to a randomly primed
32P-labeled cDNA probe in buffer containing: 50%
formamide, 10% dextran sulfate, 0.2% polyvinylpyrrolidone, 0.2%
ficoll, 0.2% bovine serum albumin, 1.0 M NaCl, 1.0% SDS, 0.05 M Tris,
pH 7.5, and 0.1% sodium phosphate at 42°C for 24 hr. After
hybridization, the membrane was washed with 2× SSC, 1.0% SDS at
65°C for 1 hr and 0.1% SSC at 25°C for 1 hr. Then the probed blots
were exposed at
70°C to XAR-5 X-ray film (Eastman Kodak, Rochester,
NY).
Nuclear extraction and EMSA.
Nuclear protein extracts were
prepared by the method of Schreiber et al. (1989)
. Cells
were washed twice in ice-cold PBS, then harvested in buffer A (20 mM
HEPES, pH 8.0, 0.32 M sucrose, 2.0 mM CaCl2, 2.0 mM MgCl2, 0.1 mM EDTA, 0.5% NP-40, 1.0 mM DTT, 0.25 mM PMSF, 1 µg/ml leupeptin) and nuclei pelleted by
centrifugation at 1500 × g for 5 min at 4°C.
Pelleted nuclei were resuspended in 50 µl of buffer B (20 mM HEPES,
pH 8.0, 25% glycerol, 0.42 M NaCl, 2 mM MgCl2,
0.2 mM EDTA, 1.0 mM DTT and 0.25 mM PMSF, 1 µg/ml leupeptin). Nuclei
pellets were mixed gently and incubated on ice for 15 min. Nuclear
debris was removed by centrifugation for 15 min at 10,000 × g, and the nuclear protein concentration was measured by the
Bradford method.
B oligonucleotide (5'...
AGTTGAGGGGACTTTCCCAGGC, Promega, Madison, WI) was
5'-end-labeled with [
-32P]ATP (specific
activity, 3,000 Ci/mmol; Amersham, Arlington Heights, IL) and T4
polynucleotide kinase (Clontech, Palo Alto, CA). The unincorporated
[
-32P]ATP was separated from labeled probe
by electrophoresis in a 15% polyacrylamide gel. The labeled NF-
B
was extracted with phenol/chloroform followed by ethanol precipitation.
The final pellet was dissolved in Tris-EDTA buffer, pH 7.4. Binding
reaction mixtures containing 20 µg protein of nuclear extract,
32P-labeled NF-
B probe and 2 µg of calf
thymus DNA in binding buffer (20 mM HEPES, pH 8.0, 5 mM DTT, 0.2 mM
EDTA, 0.2 mM PMSF, 2 mM MgCl2, 10% glycerol, 1 µg/ml leupeptin) were incubated at room temperature for 20 min.
Samples were analyzed by use of native 6% polyacrylamide gels followed
by autoradiography.
Cytotoxicity assay.
MCA-101 cells were cultured in 96-well
plates (2.5 × 105 per well) overnight. The
next day, media were removed and drugs or media were added for 2 or 3 hr. At the end of the incubation periods, the viability of the cells
was determined by assaying their metabolic capacity with use of MTT
(Mosmann, 1983
). MTT (1 mg/ml) was added to all the wells. After a 2-hr
incubation at 37°C/5% CO2 in the presence of
MTT, acidified isopropanol was added to each well and the plates were
read with a test wavelength of 570 nm and a reference wavelength of 630 nm.
| |
Results |
|---|
|
|
|---|
TNF-
-mediated activation of NF-
B in MCA-101 cells.
MCA-101 cells were incubated with TNF-
(1 nM) for various times.
Nuclear extracts were prepared, incubated with a
32P-labeled NF-
B oligonucleotide probe and
separated by gel electrophoresis. Incubation of confluent, quiescent
MCA-101 cells with TNF-
for 15 min revealed that NF-
B binding
activity was increased markedly in nuclear extracts (fig.
1A). NF-
B activity was maximal after stimulation with TNF-
for 1 hr and was still evident up to 4 hr
(fig. 1A). Competition experiments with a 100-fold molar excess of
unlabeled NF-
B consensus oligonucleotide were done to verify the
specificity of the NF-
B binding activity in nuclear extracts from
TNF-
-treated cells. NF-
B binding activity in nuclear extracts from cells treated with TNF-
for 1 hr was completely absent when extracts were incubated with unlabeled NF-
B consensus
oligonucleotide competitor before the addition of
32P-labeled NF-
B probe (fig. 1B). In contrast,
the DNA binding activity was not affected by a 100-fold molar excess of
the nonspecific competitor, AP-1 (fig. 1B). The identity of the
putative NF-
B complex was confirmed by use of EMSA in conjunction
with antibody mobility supershifts. Nuclear extracts from
TNF-
-stimulated cells were incubated with
32P-labeled NF-
B probe for 30 min, and
antibodies specific for either p65 or p50 were then added for an
additional 30 min. When anti-NF-
B p65 or anti-NF-
B p50 antibodies
were added to the EMSA binding reaction, the mobility of the putative
NF-
B complex clearly was diminished compared with the mobility of
the complex in the absence of these antibodies (data not shown). Thus,
the complex induced by TNF-
is a form of NF-
B containing the p65 (rel A) and p50 subunits.
|
TPCK inhibits TNF-
-mediated activation of NF-
B.
Degradation of I
B-
protein by unknown proteases plays a critical
role in the activation of NF-
B in vivo. Evidence for this emerges from studies with inhibitors of chymotrypsin-like proteases, such as TPCK, a serine protease inhibitor which modifies histidine residues in active sites (Schoellmann and Shaw, 1962
) and blocks degradation of I
B-
and activation of NF-
B by TNF-
in
different cell types (Finco et al., 1994
; Menon et
al., 1995
). EMSA were performed to determine whether TPCK also
inhibits NF-
B activation by TNF-
in MCA-101 cells. Cells were
preincubated with different doses of TPCK (25, 50 or 100 µM) for 10 min followed by a 1-hr incubation with 1 nM TNF-
. After incubation,
nuclear extracts were prepared and NF-
B activity was measured.
TNF-
-mediated activation of NF-
B was inhibited in a
dose-dependent manner in the presence of TPCK and was inhibited
completely in the presence of 100 µM TPCK (fig.
2). In vitro treatment of
nuclear extracts from TNF-
-stimulated cells, containing activated
NF-
B free of I
B-
, with TPCK did not inhibit the DNA binding of
activated NF-
B (data not shown). This indicated that TPCK does not
directly block binding of the NF-
B complex to DNA. Cell viability,
as determined by the MTT assay, was 100% after treatment for 2 or 3 hr
with 25 µM TPCK and ranged from 88 to 96% after treatment for 2 or 3 hr with 50 or 100 µM TPCK.
|
B activation were related to I
B-
degradation. We
previously demonstrated that TNF-
induces I
B-
degradation in
MCA-101 cells and complete degradation is seen 15 min after addition of
TNF-
(Mahboubi et al., 1997b
for 15 min. I
B-
protein was detected in control
cells (fig. 3). On the other hand,
incubation with TNF-
for 15 min caused degradation of the I
B-
protein in the absence of TPCK. TNF-
-mediated degradation of
I
B-
protein was partially inhibited by 25 µM TPCK, the
concentration that partially inhibited TNF-
-mediated activation
NF-
B. However, TNF-
-mediated degradation of I
B-
was
inhibited drastically in the presence of either 50 or 100 µM TPCK,
the dose that completely inhibited TNF-
-mediated activation of
NF-
B. Taken together, these data indicate that TPCK can inhibit
TNF-
-mediated activation of NF-
B and degradation of I
B-
protein in MCA-101 cells.
|
TPCK inhibits PGHS-2 mRNA accumulation induced by TNF-
.
TPCK was used to investigate whether NF-
B activation plays a role in
TNF-
-mediated induction of PGHS-2 mRNA accumulation. Cells were
preincubated for 10 min with media or TPCK, then incubated with or
without TNF-
for 3 hr, lysed and Northern blot analysis performed
with use of a specific PGHS-2 cDNA probe. As shown previously (Mahboubi
et al., 1997a
), PGHS-2 mRNA accumulation was increased significantly by TNF-
in MCA-101 cells (fig.
4). Preincubation with 25 µM TPCK
slightly reduced PGHS-2 mRNA accumulation induced by TNF-
, whereas
50 µM of TPCK completely inhibited PGHS-2 mRNA accumulation by
TNF-
(fig. 4). Thus, TPCK, which inhibited NF-
B activation and
prevented the TNF-
-mediated degradation of I
B-
, also inhibited
PGHS-2 mRNA accumulation induced by TNF-
.
|
TNF-
-mediated activation of NF-
B is inhibited by PAO.
NF-
B activation was assessed in cells challenged with TNF-
in the
absence or presence of a tyrosine phosphatase inhibitor, PAO, to assess
if activation of tyrosine phosphatase(s) also plays a role in NF-
B
activation by TNF-
. Cells were preincubated with 2.4 µM PAO for 10 min, then incubated with or without TNF-
for 1 hr; this dose of PAO
previously was shown to maximally increase tyrosine phosphorylation in
MCA 101 cells (Mahboubi et al., 1997a
). Preincubation with
PAO completely inhibited NF-
B activation by TNF-
(fig.
5). Nuclear extracts from
TNF-
-stimulated cells, which contain activated NF-
B free of
I
B-
, were incubated alone or with 2.4 µM PAO for 10 min, after
which labeled probe was added. In vitro treatment of
extracts with PAO did not inhibit the DNA binding of activated NF-
B
(data not shown), which indicates that PAO does not directly block
binding of the NF-
B complex to DNA. These results suggest the
involvement of a PTPase(s) in TNF-
signal transduction pathways
leading to the activation of NF-
B in MCA-101 cells. PAO did not
affect cell viability as measured by the MTT cytotoxicity assay.
|
B-
protein degradation induced by TNF-
were evaluated to confirm that PAO inhibited TNF-
-mediated activation of NF-
B. Cells were preincubated with PAO for 10 min, then incubated with or without TNF-
for an additional 15 min. I
B-
protein was detected in both control and PAO-treated cells (fig. 6). On the other hand, TNF-
caused degradation of I
B-
protein in the absence of PAO (fig. 6).
The TNF-
-mediated degradation of I
B-
protein was prevented
completely when cells were preincubated for 10 min with PAO before the
addition of TNF-
. We conclude that activity of a putative PTPase(s)
is critical for degradation of I
B-
protein by TNF-
in MCA-101
cells.
|
Tyrosine kinase inhibitors do not prevent activation of NF-
B by
TNF-
.
Recent studies with tyrosine kinase inhibitors have
demonstrated that TNF-
activates NF-
B via a tyrosine
kinase signaling pathway(s) (Anderson et al., 1994
; Reddy
et al., 1994
). We previously showed that TNF-
induces
tyrosine phosphorylation in MCA-101 cells (Mahboubi et al.,
1997a
). Therefore, we determined whether activation of tyrosine kinases
is involved in TNF-
signal transduction leading to NF-
B
activation in these cells. Cells were preincubated for 1 hr with
increasing concentrations of genistein (50, 100, 200 µM) and then
were incubated with or without TNF-
for 1 hr. TNF-
-activated
NF-
B and preincubation with genistein did not inhibit this effect
(fig. 7). Other tyrosine kinase
inhibitors including tyrphostin 47 (300 µM), herbimycin A (1.7 µM)
and erbstatin (50 µM) also did not inhibit NF-
B activation by
TNF-
in MCA-101 cells (data not shown). Similarly, several tyrosine
kinase inhibitors had no effect on TNF-
-mediated degradation of
I
B-
protein in MCA-101 cells. Cells were preincubated for 1 hr
with 200 µM genistein, 300 µM tyrphostin 47, 50 µM erbstatin or
1.7 µM herbimycin A, then incubated without or with 1 nM TNF-
for
15 min. I
B-
protein was present in both unstimulated (control)
cells and cells treated with tyrosine kinase inhibitors (fig.
8). Moreover, TNF-
caused degradation
of I
B-
protein in the absence or presence of tyrosine kinase
inhibitors (fig. 8). These data suggest that TNF-
activates NF-
B
in MCA-101 cells via a tyrosine kinase-independent pathway.
|
|
| |
Discussion |
|---|
|
|
|---|
In this study we demonstrated that PTPase(s), but not PTKs,
contribute to TNF-
-induced proteolysis of I
B-
and
TNF-
-mediated NF-
B activation in MCA-101 cells. We also showed
that inhibition of NF-
B by TPCK prevented the TNF-
-mediated
increase in PGHS-2 mRNA accumulation in these cells. We previously
showed that inhibition of PTP-ase(s) and PTKs inhibited
TNF-
-mediated induction of PGHS-2 mRNA (Mahboubi et al.,
1997a
). Accordingly, we postulate that TNF-
-mediated NF-
B
activation, via a PTP-ase-dependent mechanism, increases
transcription of the PGHS-2 gene. Moreover, activation of tyrosine
kinases by TNF-
contributes to induction of PGHS-2 mRNA
via an NF-
B-independent pathway. Thus, TNF-
(i.e., a single cytokine) can increase PGHS-2 by either a
NF-
B-dependent or NF-
B-independent mechanism. Because inhibition
of serine/threonine phosphatases with okadaic acid increases PGHS-2
mRNA accumulation by an NF-
B-independent mechanism (Mahboubi
et al., 1997b
), it is apparent that the PGHS-2 gene may be
regulated by multiple mechanisms within a given cell type.
The signal transduction pathways associated with TNF-
receptors in
MCA-101 cells were evaluated in the present study. Both TNF-
receptors (p55, p75) lack intrinsic tyrosine kinase and tyrosine
phosphatase activity. However, PTKs and PTPase(s) have been
hypothesized to be a part of TNF-
signal transduction pathways. For
instance, modulation of cellular tyrosine kinase and tyrosine phosphatase activity by kinase and phosphatase inhibitors,
respectively, can block the growth inhibitory effects of TNF-
(Sasaki and Patek, 1995
; Mishra et al., 1994
; Totpal
et al., 1992
) and NF-
B activation (Singh and Aggarwal,
1995
; Guesdon et al., 1995
; Anderson et al., 1994
; Reddy et al., 1994
). Tyrosine kinase inhibitors
inhibit NF-
B activation by TNF-
in Jurkat B
5.2 cells (Anderson
et al., 1994
), in a human histiocytic lymphoma cell line
(U937) (Reddy et al., 1994
) and in endothelial cells (Weber
et al., 1995
). We previously demonstrated that TNF-
increases tyrosine phosphorylation in MCA-101 cells and the tyrosine
kinase inhibitor, genistein, inhibits TNF-
-mediated increases in
PGHS-2 mRNA accumulation (Mahboubi et al., 1997a
). The doses
of genistein used in the present study are specific for tyrosine
kinases and have no effect on serine/threonine kinases, PKA or PKC
(Akiyama et al., 1987
; Akiyama and Ogawara, 1991
; van
Hinsbergh et al., 1994
). Thus, we postulated that
TNF-
-induced tyrosine phosphorylation played a role in
TNF-
-mediated activation of NF-
B in these cells. Unlike previous
reports where tyrosine kinase inhibitors abolished TNF-
-mediated
NF-
B activation, our results indicate that tyrosine phosphorylation
is not involved in TNF-
signal transduction leading to NF-
B
activation in MCA-101 cells. Anderson et al. (1994)
suggested that activation of an unidentified redox-sensitive PTK(s) is
a common requirement for the triggering of NF-
B activation by
TNF-
and oxidants in Jurkat T cells. Induction of NF-
B by TNF-
apparently is independent of and excludes a role for reactive oxygen
intermediates in MCA-101 cells (Mahboubi K, Young W and Ferreri NR,
unpublished data). Therefore, it is possible that a redox-sensitive
PTK(s), which is activated in Jurkat T cells in response to TNF-
, is
not activated in TNF-
-stimulated MCA-101 cells.
A tyrosine phosphatase inhibitor, PAO, increases tyrosine
phosphorylation in several cell types (Staal et al., 1994
;
Menon et al., 1995
) including MCA-101 cells (Mahboubi
et al., 1997a
) and inhibits NF-
B activation by TNF-
in
the transformed monocyte cell line (U-937) (Menon et al.,
1995
) and monoblastic leukemia cell line (ML-1a) (Singh and Aggarwal,
1995
). Menon et al. (1995)
demonstrated that tyrosine
phosphatase inhibitor, PAO, abolished TNF-
-induced serine
phosphorylation and degradation of I
B-
in U937 cells. In the
present study, we demonstrated the importance of tyrosine phosphatases
because inhibition of PTPase(s) with PAO prevented TNF-
-mediated
I
B-
degradation and, thus, NF-
B activation.
The promoter region of the mouse PGHS-2 gene has been cloned and
sequenced (Fletcher et al., 1992
). It contains various
putative transcriptional regulatory elements such as NF-
B, SP1, ETS,
AP-2, CRE, NF-IL6 (C/EBP
) and ATF. Among these elements, CRE (Xie
et al., 1994
), C/EBP
(NF-IL6) (Sirois and Richards, 1993
;
Yamamoto et al., 1995
) and NF-
B (Yamamoto et
al., 1995
) acted as positive regulatory elements for PGHS-2 gene
transcription. We previously showed that a transcriptional mechanism
contributes to the TNF-
-mediated increase in PGHS-2 mRNA
accumulation in MCA-101 cells (Mahboubi et al., 1997a
).
Therefore, NF-
B may be an important transcription factor that
contributes to the regulation of the PGHS-2 gene by TNF-
in these
cells. We showed that two inhibitors of NF-
B, a protease inhibitor
(TPCK) and tyrosine phosphatase inhibitor (PAO) (Mahboubi et
al., 1997a
) abrogated TNF-
-induced PGHS-2 mRNA accumulation.
These data are consistent with the hypothesis that activation of
NF-
B by TNF-
may be linked to the TNF-
-mediated increase of
PGHS-2 gene transcription.
Regulation of gene transcription generally is controlled by the
concerted action of more than one transcription factor. For instance,
activation of NF-
B is necessary, but is not sufficient, for
induction of interleukin-6 (Patestos et al., 1993
),
interleukin-8 (Mukaida et al., 1990
) and endothelial cell
adhesion molecules (Collins et al., 1995
) by TNF-
.
Yamamota et al. (1995)
demonstrated the involvement of both
NF-
B and C/EBP
(NF-IL6) motifs in the TNF-
-dependent PGHS-2
induction in MC3T3-E1 cells. Our data do not exclude the possible role
of transcription factor C/EBP
(NF-IL6) and other transcription
factors in the TNF-
-dependent PGHS-2 induction in MCA-101 cells.
Moreover, we previously showed that okadaic acid, a serine-threonine
phosphatase inhibitor, increases PGHS-2 transcription without
activation of NF-
B in MCA-101 cells (Mahboubi et al.,
1997b
), which indicates a role for other transcription factors in the
regulation of PGHS-2 gene transcription. Tyrosine kinase-mediated
induction of PGHS-2 by TNF-
is NF-
B-independent, according to our
findings. Thus, the inability to link PTKs to NF-
B activation may
suggest that TNF-
-mediated PTKs activation, which results in PGHS-2
mRNA accumulation and presumably gene transcription, leads to
activation of other transcription factor(s) in MCA-101 cells involved
in PGHS-2 gene transcription. The role of C/EBP
(NF-IL6) and other
transcription factors in TNF-
-mediated induction of PGHS-2 gene
transcription in MCA-101 cells remains to be determined.
| |
Footnotes |
|---|
Accepted for publication January 27, 1998.
Received for publication April 8, 1997.
Send reprint requests to: Dr. Keyvan Mahboubi, Department of Pharmacology, New York Medical College, Valhalla, NY 10595.
| |
Abbreviations |
|---|
PGHS-2, prostaglandin endoperoxide synthase-2;
NF-
B, nuclear factor-
B;
MCA, methylcholanthrene;
TNF-
, tumor
necrosis factor-
;
TBST, tris buffer saline tween;
SDS, sodium
dodecyl sulfate;
PBS, phosphate-buffered saline;
EMSA, electrophoresis
mobility shift assay;
C/EBP
, CCAAT/enhancer binding protein
;
CRE, cyclic AMP response element;
PMSF, phenylmethylsulfonyl fluoride;
PAO, phenylarsine oxide;
PTKs, protein tyrosine kinases;
PTPase(s), protein tyrosine phosphatases;
TPCK, N-tosyl-L-phenylalanine chloromethyl ketone;
MTT, 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium;
PAGE, polyacrylamide gel electrophoresis;
HEPES, N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid;
EDTA, ethylenediaminetetraacetic acid;
DTT, dithiothreitol;
SSC, standard
saline citrate.
| |
References |
|---|
|
|
|---|
B signal transduction pathway.
Proc Natl Acad Sci USA
91:
11527-11531
B and cytokine-inducible enhancers.
FASEB J
9:
899-909[Abstract].
-B
is not sufficient for its dissociation from NF-
B and is inhibited by protease inhibitors.
Proc Natl Acad Sci USA
91:
11884-11888
B.
J Biol Chem
265:
22409-22417
-dependent regulation of prostaglandin endoperoxide
synthase-2. Cytokine in press.
B-
serine phosphorylation in nuclear factor
B activation by tumor necrosis factor.
J Biol Chem
270:
18881-18887
-induced phosphorylation of I
B
is a signal for its degradation but not dissociation from NF-
B.
Proc Natl Acad Sci USA
91:
12740-12744
B- and cis-regulatory enhancer binding protein-like factor binding elements in activating the interleukin-8 gene by pro-inflammatory cytokines.
J Biol Chem
265:
21128-21133
B is not sufficient for regulation of tumor necrosis factor-induced interleukin-6 gene expression.
Biochimie
75:
1007-1018[Medline].
B activation induced by tumor necrosis factor requires membrane-associated components.
J Biol Chem
269:
25369-25372
B by TNF receptor 2 and CD40.
Science
269:
1424-1427
B activation in intact cells.
J Exp Med
175:
1181-1194
B by phosphatidylcholine-specific phospholipase c-induced "acidic" sphingomyelin breakdown.
Cell
71:
765-776[Medline].
B.
Annu Rev Cell Biol
10:
405-455.
B.
J Biol Chem
270:
10631-10639
B by phosphatase inhibitors involves the phosphorylation of I
B
at phosphatase 2A-sensitive sites.
J Biol Chem
270:
18347-18351
B activation.
J Immunol
153:
5008-5015[Abstract].
-induced plasminogen activator inhibitor-1 transcription but not urokinase expression in human endothelial cells.
Blood
84:
2984-2991
B and nuclear factor-interleukin-6 in the tumor necrosis factor
-dependent induction of cyclooxygenase-2 in MC3T3-E1 cells.
J Biol Chem
270:
31315-31320This article has been cited by other articles:
![]() |
H. Boudin, P. Sarret, J. Mazella, A. Schonbrunn, and A. Beaudet Somatostatin-Induced Regulation of SST2A Receptor Expression and Cell Surface Availability in Central Neurons: Role of Receptor Internalization J. Neurosci., August 15, 2000; 20(16): 5932 - 5939. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. R. Ferreri, S.-J. An, and J. C. McGiff Cyclooxygenase-2 expression and function in the medullary thick ascending limb Am J Physiol Renal Physiol, September 1, 1999; 277(3): F360 - F368. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||