![]() |
|
|
Vol. 285, Issue 2, 820-827, May 1998
Neurofarmacología, Instituto de Neurobiología Santiago Ramón y Cajal, Consejo Superior de Investigaciones Científicas, Avenida Doctor Arce 37, E-28002 Madrid, Spain
| |
Abstract |
|---|
|
|
|---|
To analyze the selectivity of delta receptor subtypes to
regulate different classes of G proteins, the expression of the
-subunits of Gi2, Gi3, Go1, Go2, Gq and G11 transducer proteins was
reduced by administration of oligodeoxynucleotides (ODNs) complementary to sequences in their respective mRNAs. Mice receiving antisense ODNs
to Gi2
, Gi3
, Go2
and
G11
subunits showed an impaired antinociceptive response
to all the delta agonists evaluated. An ODN to
Go1
specifically blocked the antinociceptive effect of
the agonist of delta-1 receptors,
[D-Pen2,5]enkephalin (DPDPE), without
altering the activity of [D-Ala2]deltorphin
II or [D-Ser2]-Leu-enkephalin-Thr (DSLET). In
mice treated with an ODN to Gq
, the effects of the
agonists of delta-2-opioid receptors were reduced, but
not those of DPDPE. Thus, Go1 proteins are selectively linked to
delta-1-mediated analgesia, and Gq proteins are related
to delta-2-evoked antinociception. After impairing the
synthesis of Go1
subunits, DPDPE exhibited an
antagonistic activity on the antinociception produced by
[D-Ala2]deltorphin II. After treatment with
ODNs complementary to sequences in Gq
or PLC-
1 mRNAs,
the analgesic capacity of [D-Ala2]deltorphin
II was diminished. However, the delta-2-agonist did not
alter the antinociceptive activity of DPDPE. An ODN complementary to
nucleotides 7 to 26 of the murine delta receptor reduced
the analgesic potency of [D-Ala2]deltorphin
II, but not that observed for DPDPE. In these mice, [D-Ala2]deltorphin II did not antagonize the
effect of DPDPE. These results suggest the existence of different
molecular forms of the delta opioid receptor, and the
involvement of inositol-signaling pathways in the supraspinal
antinociceptive effects of delta agonists.
| |
Introduction |
|---|
|
|
|---|
A
series of studies on the antinociceptive effects of
delta-selective agonists in the mouse has led to the
proposed division of delta opioid receptors into subtypes,
termed delta-1 and delta-2 (see for review Zaki
et al., 1996
). Most of the pharmacological evidence favoring
the subdivision of delta receptors has come from the use of
antagonists (Sofuoglu et al., 1991a
; Portoghese et
al., 1992
; Vanderah et al., 1994
). The
delta-1 receptor was defined as the site activated by DPDPE
and sensitive to antagonism by
[D-Ala2,Leu5,Cys6]-enkephalin
and 7-benzylidenenaltrexone, the delta-2 receptor binds the
agonists [D-Ala2]deltorphin II and
DSLET and the antagonist naltrindrole 5'-isothiocyanate. Other
pharmacological approaches, including tolerance and cross-tolerance studies (Mattia et al., 1991
; Sofuoglu et al.,
1991b
), have also supported the existence of subtypes for the
delta receptor. Consistent with this proposal, the CXBK
inbred strain of mice exhibits a diminished response to i.c.v., but not
intrathecal, [D-Ala2]deltorphin II
(Raffa et al., 1992
). It is proposed that these mice are
deficient in the delta-2 subtype of the delta
receptor in the brain, but not in the spinal cord. By contrast, a
single functional subtype of delta opioid receptor has been
described in in vitro bioassay systems, such as the mouse
vas deferens (Wild et al., 1993
).
The primary structure of a unique delta receptor from the
adult mouse brain has been obtained by molecular cloning (Yasuda et al., 1994
). The mRNA encodes a protein of 372 amino acids
that presents a structural homology to G protein-coupled receptors. The
ODN strategy has been used to impair delta receptor-mediated functions in in vivo studies (Standifer et al.,
1994
; Lai et al., 1994
; Bilsky et al., 1996
;
Sánchez-Blázquez et al., 1997
). After subchronically giving doses of an ODN complementary to sequences in
delta opioid receptor, the i.c.v. injection of
125I-IgGs directed to delta receptors
demonstrated a reduction of the protein encoded by the targeted mRNA
(Sánchez-Blázquez et al., 1997
). The in
vivo administration of an ODN complementary to nucleotides 7 to 29 of the cloned delta receptor did not reduce the
antinociceptive potency of all the agonists binding this opioid receptor (Lai et al., 1994
; Bilsky et al., 1996
;
Sánchez-Blázquez et al., 1997
). This observation
supports the existence of subtypes for the delta opioid
receptor.
It is assumed that, at the cellular level, the effects of opioids
involve the inhibition of cAMP formation, the inhibition of
Ca++ entry through voltage-sensitive
Ca++ channels, and the stimulation of an outward
K+ conductance (for review, see Childers, 1991
).
In addition, recent reports suggest the coupling of opioid receptors to
the phosphoinositide cascade (Miyamae et al., 1993
; Smart
et al., 1994
; Jin et al., 1994
). Thus, it is of
interest to determine whether the stimulatory effect of opioids on
inositol lipid turnover also participates in the mechanisms of
opioid-induced antinociception. It is well established that
delta agonists regulate G proteins to produce supraspinal
antinociception; this has been ascertained by the in vivo
administration of agents known to interfere directly with the function
of G proteins, i.e., pertussis toxin
(Sánchez-Blázquez and Garzón 1988
, 1991
), antibodies
administered by the i.c.v. route against Gi2
and Gi3
subunits (Sánchez-Blázquez
and Garzón, 1993
; Sánchez-Blázquez et al.,
1993
, 1995
), and in vivo antisense strategies to reduce the
synthesis of specific G
subunits (Raffa et al., 1994
;
Sánchez-Blázquez et al., 1995
; Standifer
et al., 1996
).
In our work, we have extended our previous studies on the regulation of
G proteins by delta receptors in the production of supraspinal analgesia to include G protein classes associated with
inositol lipid turnover: Go1, Go2, Gq and G11. The participation of
PLC
1 in this opioid activity was also explored. Distinct binding sites and inositol-signaling pathways mediated the supraspinal antinociceptive effects of delta agonists; one was linked to
a PTX-sensitive Go1 protein (delta-1), and the other to a
PTX-resistant Gq protein (delta-2). These results provide
further support for the existence of subtypes of delta
receptors.
| |
Methods |
|---|
|
|
|---|
Animals and evaluation of analgesia.
Male albino mice CD-1
(Charles River, Barcelona, Spain) weighing 22 to 25 g, were used
throughout this study. Animals were kept at 22°C under a 12-hr
light/dark cycle (8 A.M./8 P.M.). Food and
water were provided ad libitum. Mice were housed and used strictly in accordance with the guidelines of the European Community about Care and Use of Laboratory Animals. To reduce the possibility of
interference from spinal events, all substances were injected i.c.v.
into the right lateral ventricle, as previously described (Sánchez-Blázquez et al., 1995
; 1997
). Briefly,
animals were lightly anesthetized with ether, and injections were given
with a 10-µl Hamilton syringe at a depth of 3 mm, 2 mm lateral and 2 mm caudal from the bregma. Four µl of each solution were infused at a
rate of 1 µl every 5 sec; afterward, the needle was maintained for an
additional period of 10 sec. The warm water (52°C) tail-flick test
was used to measure the antinociceptive effect. Latencies in seconds
were determined both before treatment (basal latency) and also after
the administration of the substance under study. Baseline latencies
ranged from 1.5 to 2.2 sec and were not affected by ODN administration.
A cut-off time of 10 sec was allotted to minimize the risk of tissue
damage. Antinociception was expressed as a percentage of the MPE
according to the following formula: %MPE = 100 x (test
latency-baseline latency)/(cut-off time-baseline latency).
Dose-response curves were routinely constructed for the opioids under
control and treatment conditions; however, for the sake of directness
the data are presented in a single dose format. Intracerebroventricular
doses of the opioids were given and antinociception was assessed after
30 min for
-endorphin, after 15 min for DPDPE or DSLET and after 10 min for [D-Ala2]deltorphin II. All
compounds were dissolved in distilled water except for
[D-Ala2]deltorphin II, which was
dissolved in 1% DMSO. Agonist solutions were made up immediately
before use. Statistical analysis of the results was accomplished by
analysis of variance followed by the Student-Newman-Keuls test. The
level of significance was set at P < .05.
Synthesis of oligodeoxynucleotides.
End-capped
phosphorothioate ODNs were synthesized in a CODER 300 DNA synthesizer
using phosphoramidite chemistry (Matteucci and Caruthers, 1981
). Crude
ODNs were purified by reverse-phase chromatography using COP cartridges
(Cruachem, Glasgow, UK). The eluted ODNs in 50% acetonitrile-water
were then lyophilized (Rouan RC 1009/RCT 90, France). Sequences were as
follows: ODN-Gi2
: 5'-A*T*GGTCAGCCCAGAGCCTCCGGATGACGCCC*G*A-3', corresponding to nucleotides 523-556 of the Gi2
gene sequence
(Jones and Reed, 1987
). This ODN was also labeled in the
final synthetic cycle with fluorescein-CE phosphoramidite at the 5'-end
(Cruachen, Glasgow, UK, #22-8409); ODN-Gi3
:
5'-G*C*CATCTCGCCATAAACGTTTAATCACGCCT*G*C-3', corresponding to
nucleotides 554-587 of the Gi3
gene sequence (Jones and Reed, 1987
). Both oligos were previously
characterized (Raffa et al., 1994
;
Sánchez-Blázquez et al., 1995
).
ODN-Go1
: 5'-A*G*GCAGCTGCATCTTCATAGGTG*T*T-3',
a 25 base oligo corresponding to nucleotides 882-906 of the murine
Go1
gene sequence; and
ODN-Go2
: 5'-G*A*GCCACAGCTTCTGTGAAGGCA*C*T-3', which corresponds to
nucleotides 882-906 of the Go2
sequence
(Strathmann et al., 1990
). These two ODNs were identical to
those used by Kleuss et al. (1991)
in in vitro
experiments. ODN-Gq
:
5'-C*G*GCTACACGGTCCAAGTC*A*T-3', corresponding to nucleotides 484-504 of the Gq
gene sequence; ODN-G11
: 5'-C*T*GTGGCGATGCGGTCCAC*G*T-3',
which corresponds to nucleotides 487-507 of the
G11
sequence; and
ODN-Gq/11
: 5'-C*C*ATGCGGTTCTCATTGTC*T*G-3', a
21 base oligo corresponding to nucleotides 724-744 of the
Gq
/G11
gene sequence
(Strathmann and Simon, 1990
).
ODN-delta7-26:
5'-G*C*ACGGGCAGAGGGCACC*A*G-3', corresponding to nucleotides 7 to
26 of the murine delta opioid receptor gene. This ODN is
identical to that designed by Lai et al. (1994)
. And
finally, ODN-PLC
1: 5'-G*C*TGTCGGACACG*C*A-3', corresponding to nucleotides 49-63 of the PLC
1 gene sequence (Suh
et al., 1988
). These sequences displayed no homology to
other relevant cloned proteins (GeneBank database). A random oligo
(ODN-RD) with the sequence 5'-C*C*CTTATTTACTACTTTC*G*C-3' served as a
control (Sánchez-Blázquez et al., 1995
).
Administration of ODNs.
ODN solutions were made up in the
appropriate volume of sterile water immediately before use. Animals
received either the vehicle, the random sequence ODN or the antisense
oligo. These were injected into the right lateral ventricle and
subsequent administrations were performed on the same side. Each ODN
treatment was performed on a distinct group of 15 to 20 mice using the
following schedule: on days 1 and 2, with 2 nmol; on days 3 and 4, with 3 nmol; on day 5, with 4 nmol. On day 6, the opioid agonists were injected i.c.v. and their antinociceptive activity evaluated by the
warm water tail-flick test. An interval of 24 hr was selected between
ODN administrations to minimize neurotoxic damage (Chiasson et
al., 1994
). With this schedule, the experimental animals displayed no noticeable behavioral changes.
Visualization at the PAG level of a fluorescence-labeled ODN to
Gi2
mRNA.
Mice that had received a
single i.c.v. injection of 3 nmol of a fluorescein-labeled
ODN-Gi2
were killed 10, 30 or 120 min later. Brains were
removed and frozen on dry ice. Coronal cryostat sections (20 µm) were
cut, mounted onto gelatin-subbed slides and coverslipped in a solution
of 0.1 M phosphate buffer-30% glycerol. Sections were analyzed under a
Leica TCS 4D confocal laser-scanning microscope equipped with an
argon/krypton-mixed gas laser with excitation peak at 488 nm. The
confocal microscope was associated with a Leitz DMIRB fluorescence
microscope.
Electrophoresis and immunoblotting.
Membranes from PAGs of
ODN-treated mice were solubilized in a buffer containing 50 mM
Tris.HCl, 3% sodium dodecyl sulfate, 10% glycerol, 5%
-mercaptoethanol, pH 6.8, and the proteins (30 to 60 µg
protein/lane) were subsequently resolved by polyacrylamide sodium
dodecyl sulfate gel electrophoresis [12.5% acrylamide
concentration/0.0625% bisacrylamide cross-linker concentration, with a
linear gradient from 4 to 8 M urea (Shah and Milligan,
1994
)] with 8-cm × 11-cm × 0.15-cm slab gels (Hoefer SE
280) at 20-mA constant current (ISCO power supply, model 595). For
detection of PLC
1, brain PAGs were collected in Tris buffer 50 mM
(pH 7.4), 1 mM EDTA, 1 mM benzamidine, 0.1 mM phenylmethylsufonyl
fluoride, 1 µg/µl leupeptin and 1 µg/µl pepstatin, and
homogenized. After centrifugation, the supernatant was resolved by
electrophoresis (gradient of 5-16% total acrylamide
concentration/2,6% bisacrylamide cross-linker concentration). The
proteins were transferred (Mini-Trans-Blot electrophoretic transfer
cell; Bio-Rad, Hercules, CA) to 0.2-µm polyvinylidene difluoride
Trans-Blot membranes (Bio-Rad) using Towing buffer (25 mM Tris.HCl, 192 mM glycine, 0.04% sodium dodecyl sulfate, 20% methanol), by
application of 70 V (200-300 mA) for 120 min. Unoccupied protein sites
were blocked with 5% w/v non-fat dry milk (Blocker; Bio-Rad) in
Tris-buffered saline for 1 hr at 37°C. The membranes were incubated
with antibodies against G
subunits at 1:1,000 dilution in Tris
buffered saline-0.05% Tween 20 at 6°C for 24 hr, and subsequently
with a secondary antiserum [goat anti-rabbit IgG (H+L) horseradish
peroxidase conjugate (BioRad, Hercules, CA #170-6515)] diluted 1:3,000
in Tris-buffered saline-0.05% Tween 20 for 3 hr. Antibody binding was
detected using the substrate solution (1 mg/ml 3,3'-diaminobenzidine,
0.02% hydrogen peroxide, .04% nickel chloride in 0.1 M Trizma base
buffer pH 7.2). A mixture of IgG monoclonal antibodies (Upstate
Biotech, Lake Placid, NY, #05-164) diluted to 1:1,000 was used to
detect PLC
1. The IgGs were detected with a secondary antiserum
[goat anti-mouse IgG (H+L) horseradish peroxidase conjugate (BioRad,
#170-6516)] and visualized with Enhanced Chemiluminescence reagents
(Amershan Corp., Buckinghamshire, UK). Immunoblots were analyzed by
densitometry using an instrument with reflectance capabilities (BioRad,
GS-700 Imaging Densitometer).
Antibodies and chemicals.
The antisera used were raised
against: anti Gi2
internal fragment [115-125:
EEQGMLPEDLS] S/1 (Sánchez-Blázquez et al., 1993
; 1995
). Anti Gi3
(371729-Q) and anti
Gq
(371752-Q) were obtained from
Calbiochem-Novabiochem Corporation (La Jolla, CA). Anti-Go
(GC/2, NEI-804) and anti
Gq/11 (QL, NEI-809) came from Du Pont-New England
Nuclear Research Products (Boston, MA). Anti-PLC
1 (#05-164)
monoclonal antibodies were obtained from Upstate Biotechnology. Human
-endorphin, DSLET, DPDPE and
[D-Ala2]deltorphin II were
purchased from Peninsula Laboratories Europe (Merseyside, UK).
| |
Results |
|---|
|
|
|---|
Changes in G
-like immunoreactivity after in vivo
administration of oligodeoxynucleotides.
Ten minutes after i.c.v.
injection of the fluorescein-labeled ODN, fluorescence was detected in
the periaqueductal region (fig. 1).
Subsequently, and in a time-dependent fashion, these signals entered
from the cerebral aqueduct and spread through the neural tissue. For
immunodetection, the mice were killed 6 days after starting the
subchronic administration of the ODNs and P2 membranes from PAG were
obtained and resolved by polyacrylamide sodium dodecyl sulfate gel
electrophoresis. In the absence of urea, the anti
Gq/11
and anti Gq
appear to recognize a single, 42 kDa, polypeptide. Similarly, the anti
Go
antiserum labeled a single band of 39 kDa
(not shown). Gq
and
G11
subunits could be resolved with a linear
gradient of 4 to 8 M urea, G11
showing a
greater electrophoretic mobility than Gq
subunits (fig. 2, upper panel). An
identical approach was utilized to separate
Go1
from Go2
in
immunoblots (Mullaney and Milligan, 1990
) (fig. 2, upper
panel). The ODNs corresponding to mRNA of G
subunits reduced the
extent of labeling in immunoblots. Molecular weight markers are not
indicated when urea was used, because this procedure alters the
migration of the protein standards used. The diminishing effect of ODNs
to mRNAs of Gi2
and
Gi3
subunits on the target proteins has
already been reported (Sánchez-Blázquez et al.,
1995
).
|
|
1 recognized a protein of
about 150 kDa (Suh et al., 1988
1 the intensity of labeling was reduced (fig. 2, bottom). This treatment showed no cross-effect on the immunoreactivity
associated to Go
, Gq
or G11
subunits in neural membranes (data not
shown).
Effects of in vivo administration of ODNs and
antibodies to G
subunits on supraspinal analgesia induced by opioids
binding delta opioid receptors.
Mice that received
i.c.v. injections of saline, the random oligo or ODNs to G
subunits,
responded in the analgesic test with basal latencies comparable to
those of noninjected (naive) mice. The analgesic substances produced
similar effects in mice that received i.c.v. injections of the vehicle,
the random oligo, or in naive animals. Thus, the responsiveness of mice
in the antinociceptive test was not altered by the experimental
procedure alone.
,
Gi3
, Go2
and
G11
subunits was followed by a significant
decrease in the antinociceptive potency of the delta
receptor-agonists DPDPE and [D-Ala2]deltorphin II (fig.
3). The impairment of
Go1
function led to a weaker analgesic
response to DPDPE, whereas, the effect of
[D-Ala2]deltorphin II was unaltered
in these mice. The antisense ODN to Gq
subunit-mRNA produced opposite effect; DPDPE-induced antinociception was unchanged although the activity of the selective agonists of
delta-2-opioid receptors
[D-Ala2]deltorphin II and DSLET, as
well as that exhibited by the endogenous opioid peptide
-endorphin,
clearly diminished (figs. 3 and 4).
|
|
subunits were i.c.v.-injected into the mice. Control
animals received 2 µg of protein A-purified IgGs (preimmune serum) in
the same volume. The supraspinal antinociceptive activity of the opioid
agonists was assessed 24 hr later. As previously described, i.c.v.
administration of preimmune IgGs did not alter the response of the
animals to the analgesic effect of opioids (Sánchez-Blázquez and Garzón, 1993
subunits reproduced the effects of
sub-chronic ODNs. I.c.v. injection of anti-Gi2
(S/1), anti-Gi3
(CN-1),
anti-Go1/o2
(CG/2) and
anti-Gq/11
(QL) antibodies reduced the
antinociceptive activity of the opioids binding to delta opioid
receptors (fig. 5). The administration of
anti Gq
(CN-Q) IgGs only impaired the effect
of the delta-2-agonist [D-Ala2]deltorphin II.
|
Agonist-antagonist activity of delta-selective ligands
in ODN-treated mice.
In mice undergoing treatment with the random
ODN the analgesia obtained by the combination of DPDPE and
[D-Ala2]deltorphin II was
significantly higher than the value of either agonist when acting alone
(fig. 6). After reducing the expression of Go1
subunits, DPDPE antagonized
[D-Ala2] deltorphin II in its
capacity to produce an analgesic effect (fig. 6). After administration
of ODN-Gq
,
[D-Ala2]deltorphin II did not alter
the antinociceptive potency of DPDPE, a result suggesting the existence
of distinct binding sites for these two agonists. In agreement with
this, after the in vivo down-regulation of
delta-2 receptor expression by
ODN-delta7-29 (Lai et al., 1994
;
Bilsky et al., 1996
; Sánchez-Blázquez et al., 1997
; Rossi et al., 1997
), the antinociception
induced by the selective agonist of delta-2 receptors
[D-Ala2]deltorphin II was strongly
reduced. Interestingly,
[D-Ala2]deltorphin II did not
interfere with the antinociception evoked by DPDPE in these animals
(fig. 6).
|
Effect of in vivo administration of ODNs to
phospholipase C
1 on the supraspinal analgesia induced by
delta agonists in mice.
The effect of ODN-PLC
1 was
evaluated in vivo. Mice subjected to subchronic
administration of the ODN to PLC
1 showed an impaired analgesic
response to [D-Ala2]deltorphin II,
DSLET and
-endorphin. Notwithstanding, in these mice the
antinociception induced by DPDPE was preserved and
[D-Ala2]deltorphin II did not
antagonize DPDPE (fig. 7). The effect of agonists binding mu-opioid receptors, DAMGO and morphine,
was not altered by treatment with the antisense ODN to phospholipase C
1 (not shown).
|
| |
Discussion |
|---|
|
|
|---|
Pharmacological studies (Mattia et al., 1991
; Sofuoglu
et al., 1991a
, b
; Portoghese et al., 1992
;
Vanderah et al., 1994
) and antisense ODN strategies (Lai
et al., 1994
; Bilsky et al., 1996
; Sánchez-Blázquez et al, 1997
) have convincingly
demonstrated the existence of subtypes of the delta opioid
receptors. However, only one molecular form for this opioid receptor
has been described so far (Evans et al., 1992
; Kieffer
et al., 1992
; Yasuda et al., 1994
). In in
vivo studies using antibodies (Sánchez-Blázquez and
Garzón, 1993
; Sánchez-Blázquez et al.,
1993
, 1995
) or antisense ODNs (Raffa et al., 1994
;
Sánchez-Blázquez et al., 1995
; Standifer et al., 1996
) directed to G
subunits of transducer
proteins known to inhibit adenylyl cyclase activity, it was found that
the blocking of Gi2
or
Gi3
subunits, but not
Gi1
or Gx/z
,
significantly reduced delta-mediated supraspinal
antinociception in mice. Although these treatments effectively
differentiated mu- and delta-mediated antinociception, they did not discriminate between the
pharmacologically defined subtypes of delta opioid
receptors.
The coupling of delta receptors to various effector systems
(e.g., phospholipase C and type II adenylyl cyclase) has
been documented in a series of in vitro studies (Tsu
et al., 1995
). The observed impairment of
delta-mediated supraspinal analgesia by antisense ODNs
complementary to Go1
and
Gq
subunits, indicates that distinct signaling
pathways associated with phosphoinositide cascades are involved in this
opioid effect. The Gi2, Gi3, Go2 and G11 proteins are activated by both
subtypes of delta opioid receptors in the production of
supraspinal antinociception (Raffa et al., 1994
;
Sánchez-Blázquez et al., 1995
; Standifer
et al., 1996
; present work). Go1 proteins are regulated
selectively by delta-1 receptors whereas Gq seems to be
linked solely to the effect of delta-2-agonists (fig.
8).
|
The selective regulation of different classes of G proteins by the
delta-agonists in the production of antinociception,
supports the proposed existence of two separate subtypes of
delta opioid receptor. It might also be feasible that after
binding a unique delta opioid receptor, certain agonists
activate different classes of G proteins, i.e.,
Go1
, Gq
. Different
functional profiles would then be observed. This suggests the
pharmacological heterogeneity of the delta receptor subtypes
described. If this is the case, both agonists,
[D-Ala2]deltorphin II and DPDPE,
ought to bind to this unique delta receptor. This is
consistent with the finding that after treatment with the ODN to
Go1
subunits, DPDPE, which is more effective
than [D-Ala2]deltorphin II in
activating Go1 proteins, now antagonized the analgesic effect of
[D-Ala2]deltorphin II. In the
single receptor model,
[D-Ala2]deltorphin II, which is
more efficient than DPDPE in activating Gq proteins, should reduce the
effect of DPDPE in Gq
-deficient mice. However,
in this paradigm, antagonism of
[D-Ala2]deltorphin II on DPDPE was
not observed. A single receptor also fails to explain why the selective
impairment promoted by ODN-delta7-29 on the
antinociception of delta-2-agonists (Lai et al.,
1994
; Bilsky et al., 1996
; Sánchez-Blázquez
et al., 1997
; present work) is not accompanied by
[D-Ala2]deltorphin II antagonism of
DPDPE activity. These observations indicate that, the
delta-2-agonist
[D-Ala2]deltorphin II does not bind
to the receptors acted upon by DPDPE, whereas DPDPE might also bind the
receptors of [D-Ala2]deltorphin II.
Similarly, the work of Vanderah et al. (1994)
, using the
antagonists
[D-Ala2,Leu5,Cys6]-enkephalin
and naltrindrole5'-isothiocyanate selective for the pharmacologically
defined delta-1 and delta-2 receptors, supports the existence of two distinct subtypes of the delta
receptor. Recent results from work with ODNs corresponding to the
cloned opioid receptor gene are also consistent with the existence of closely related molecular forms of this receptor (Rossi et
al., 1997
; Sánchez-Blázquez et al., 1997
).
In mice whose delta receptor gene has been disrupted by gene
targeting, the capacity of both DPDPE and
[D-Ala2]deltorphin II to produce
analgesia was strongly but not completely reduced (Zhu et
al., personal communication). Therefore, at the present time, it
cannot be concluded whether the delta receptor subtypes
arise as splice variants from a unique gene, or come from separate
genes.
In this study, it was shown that besides the Gi family of G-transducer
proteins, delta receptors are associated with Go and Gq
classes in the production of supraspinal antinociception in the mouse.
Jin et al. (1994)
have reported activation of
phosphoinositide cascades via delta receptors and the
subsequent mobilization of calcium from inositol 1,4,5-triphosphate
sensitive stores in neuroblastoma x glioma 108-15 cells. In
Ltk
fibroblasts transfected with the cloned
delta receptor, DPDPE was able to stimulate phosphoinositide-specific
phospholipase C through a pertussis toxin-sensitive G protein (Tsu
et al., 1995
). The inhibition of the
-subunits of Gi and
Go proteins reduced the degree of analgesia evoked by DPDPE. These
findings indicate that pertussis toxin-sensitive G proteins are
implicated mainly in the physiological effects of this compound. The G
proteins activated by the pharmacologically defined delta-1
receptor in the production of supraspinal analgesia (fig. 3) are in
accordance with observations made when using membranes of human
neuroblastoma SH-SY5Y cells. In these cells, which exhibit
mu and delta receptors, DPDPE, after binding
selectively delta opioid receptors, increased the
incorporation of [
-32P]GTP azidoanilide into
the
-subunits of Gi1, Gi2, Gi3, Go1 and Go2 proteins (Laugwitz
et al., 1993
). There are few in vitro studies on
the regulation of G protein classes and effectors by
delta-2-selective compounds (Garzón et al.,
1997a
, b
), making direct comparison with the in vivo results
difficult. Nevertheless, the data of our study reveal that multiple G
proteins, including the pertussis toxin-insensitive Gq which stimulates
phosphoinositide breakdown, participate in delta-2-mediated
antinociceptive effects.
G protein-mediated activation of phospholipase C
isozymes occurs via
at least two mechanisms, each showing different sensitivities to
pertussis toxin. Activation of PCL
1, PCL
2 and PCL
3 is achieved with the help of the pertussis toxin-insensitive G
subunits of Gq
transducer proteins (Smrcka et al., 1991
; Taylor et
al., 1991
; Wu et al., 1992
, 1993
). Also, stimulation of
PLC
isozymes is achieved through G
subunits of pertussis
toxin-sensitive Gi/Go proteins (Moriarty et al., 1990
; Camps
et al., 1992
; Carozzi et al., 1993
). In
coreconstitution experiments using lipid vesicles, PLC
1 stimulates
hydrolysis of Gq/11-bound GTP and acts as a GTPase-activating protein
for its physiological regulator, Gq/11 (Berstein et al., 1992
). The ODN-induced inhibition of Gq
and
phospholipase C
1 leads to a similar impairment in the
antinociceptive effects of agonists of delta-2-opioid
receptors. This data, supports the idea that there is coupling of this
subtype of delta receptor to Gq proteins and PLC
1
effector enzyme. By using DPDPE, the coupling of delta
opioid receptors in the stimulation of PLC and the generation of
phosphoinositides has been shown in NG108-15 cells. This has also been
achieved in Xenopus oocytes and Ltk
fibroblasts expressing cloned delta receptors (Miyamae
et al., 1993
; Jin et al., 1994
; Tsu et
al., 1995
). The DPDPE-induced activation of G11 proteins in the
production of supraspinal antinociception appears not to be related to
PLC
1 as no reduction was found for this agonist in mice treated with
the ODN to this enzyme. Whether DPDPE leads to stimulation of PLC
2
and/or PLC
3 isozymes remains to be seen.
In summary, the supraspinal antinociception produced by agonist-activated delta receptors is mediated by G proteins of the Gq/11 family as well as by Gi- and Go-transducer proteins. The present work provides further evidence favoring the existence of delta-1- and delta-2-opioid receptors. Go1 proteins seem to be selectively activated by delta-1 receptors, whereas delta-2 receptors show preference for the pertussis toxin-insensitive Gq proteins in this effect. It might therefore be concluded that delta receptors trigger at least two signaling cascades, adenylyl cyclase and phospholipase C, in the production of analgesia.
| |
Acknowledgments |
|---|
The authors are indebted to C. Bailón for assistance with the confocal laser scanning microscopy and M. A. Arevalo for helpful assistance in the synthesis of the ODNs.
| |
Footnotes |
|---|
Accepted for publication January 29, 1998.
Received for publication September 23, 1997.
1 This research was supported by the Comisión Interministerial de Ciencia y Tecnología (Grant SAF95-0003), CAM (Grant AE00363/95) and Fondo de Investigaciones Sanitarias (Grant 97/0506).
Send reprint requests to: Dr. Pilar Sánchez-Blázquez, Instituto Cajal, CSIC, Avenida Doctor Arce 37, E-28002, Madrid, Spain.
| |
Abbreviations |
|---|
delta-1 and delta-2, subtypes of the delta opioid receptor; DPDPE, [D-Pen2,5]enkephalin; DSLET, [D-Ser2]-Leu-enkephalin-Thr; G proteins, GTP-binding proteins; PLC, phophoinositide-specific phospholipase C; ODN, antisense oligodeoxynucleotide; RD, random oligodeoxynucleotide; i.c.v., intracerebroventricular; PAG, periaqueductal gray matter; MPE, maximum possible effect.
| |
References |
|---|
|
|
|---|
1 is a GTPase-activating protein for Gq/11, its physiological regulator.
Cell
70:
411-418[Medline].
3 by G protein 
subunits.
FEBS
315:
340-342[Medline].
-opioid receptor: isolation of a cDNA by expression cloning and pharmacological characterization.
Proc Natl Acad Sci USA
89:
12048-12052
opioid receptors differentially couple to G proteins subtypes in membranes of human neuroblastoma SH-SY5Y cells.
Neuron
1:
233-242.
opioid receptor mediates phospholipase C activation via Gi in Xenopus oocytes.
FEBS Lett
333:
311-314[Medline].
1 opioid receptor antagonist: 7-benzylidenenaltrexone.
Eur J Pharmacol
218:
195-196[Medline].
2-mediated supraspinal analgesia in mice.
Life Sci
48:
1721-1727[Medline].
-opioid supraspinal antinociception in mice is mediated by Gi3 transducer proteins.
Life Sci/Pharmacol Lett
53:
PL129-134[Medline].
opioid mediated supraspinal antinociception.
Life Sci/Pharmacol Lett
53:
PL381-386[Medline].
subunits and supraspinal analgesia evoked by mu and delta opioid agonists.
J Pharmacol Exp Ther
275:
1590-1596
T3-1 pituitary cells regulates cellular levels of both of the phosphoinositidase C-linked G proteins, Gq
and G11
, equally.
Mol Pharmacol
46:
1-7[Abstract].
-FNA treated mice provides further evidence for
opioid receptor subtypes.
Life Sci
4:
PL153-PL156.
subunits.
Mol Pharmacol
50:
293-298[Abstract].
subunits is present in vertebrates and invertebrates.
Proc Natl Acad Sci USA
87:
9113-9117
subunit of GTP-binding protein Go.
Proc Natl Acad Sci USA
87:
6477-6481
1 isozyme of phospholipase C by
subunits of the Gq class of G protein.
Nature
350:
516-518[Medline].
-opioid receptor subtypes in vivo.
Eur J Pharmacol
252:
133-137[Medline].
subunits of the Gq and G11 proteins in transfected Cos-7 cells.
J Biol Chem
267:
1811-1817
1 required for activation of G-proteins.
J Biol Chem
268:
3704-3709
opioid receptors from mouse brain.
Proc Natl Acad Sci USA
90:
6736-6740This article has been cited by other articles:
![]() |
D. M. Villarreal, B. Derrick, and I. Vathy Prenatal Morphine Exposure Attenuates the Maintenance of Late LTP in Lateral Perforant Path Projections to the Dentate Gyrus and the CA3 Region In Vivo J Neurophysiol, March 1, 2008; 99(3): 1235 - 1242. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Garzon, M. Rodriguez-Munoz, A. Lopez-Fando, and P. Sanchez-Blazquez Activation of {micro}-Opioid Receptors Transfers Control of G{alpha} Subunits to the Regulator of G-protein Signaling RGS9-2: ROLE IN RECEPTOR DESENSITIZATION J. Biol. Chem., March 11, 2005; 280(10): 8951 - 8960. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chakrabarti, N.-J. Liu, and A. R. Gintzler Reciprocal modulation of phospholipase C{beta} isoforms: Adaptation to chronic morphine PNAS, November 11, 2003; 100(23): 13686 - 13691. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zeng, D. Zhao, S. Yang, K. Datta, and D. Mukhopadhyay Heterotrimeric G{alpha}q/G{alpha}11 Proteins Function Upstream of Vascular Endothelial Growth Factor (VEGF) Receptor-2 (KDR) Phosphorylation in Vascular Permeability Factor/VEGF Signaling J. Biol. Chem., May 30, 2003; 278(23): 20738 - 20745. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Charles, N. Mostovskaya, K. Asas, C. J. Evans, M. L. Dankovich, and T. G. Hales Coexpression of delta -Opioid Receptors with {micro} Receptors in GH3 Cells Changes the Functional Response to {micro} Agonists from Inhibitory to Excitatory Mol. Pharmacol., January 1, 2003; 63(1): 89 - 95. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zeng, D. Zhao, and D. Mukhopadhyay KDR Stimulates Endothelial Cell Migration through Heterotrimeric G Protein Gq/11-mediated Activation of a Small GTPase RhoA J. Biol. Chem., November 22, 2002; 277(48): 46791 - 46798. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Sánchez-Blázquez, M. Rodríguez-Díaz, I. DeAntonio, and J. Garzón Endomorphin-1 and Endomorphin-2 Show Differences in Their Activation of {micro} Opioid Receptor-Regulated G Proteins in Supraspinal Antinociception in Mice J. Pharmacol. Exp. Ther., October 1, 1999; 291(1): 12 - 18. [Abstract] [Full Text] |
||||
![]() |
R. M. Quock, T. H. Burkey, E. Varga, Y. Hosohata, K. Hosohata, S. M. Cowell, C. A. Slate, F. J. Ehlert, W. R. Roeske, and H. I. Yamamura The delta -Opioid Receptor: Molecular Pharmacology, Signal Transduction, and the Determination of Drug Efficacy Pharmacol. Rev., September 1, 1999; 51(3): 503 - 532. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||