![]() |
|
|
Vol. 283, Issue 2, 675-683, 1997
3,
4, and
7 Neuronal Nicotinic Receptor
Subtypes1
Department of Biology, University of Pennsylvania. (F.O.), and Department of Neuroscience, University of Pennsylvania Medical School, Philadelphia, Pennsylvania (V.G., A.K., F.W., J.L.)
| |
Abstract |
|---|
|
|
|---|
Because chronic exposure to nicotine and nicotinic drugs might both
activate and desensitize nicotinic acetylcholine receptors (AChRs), we
sought to determine whether prolonged exposure to nicotine
concentrations encountered in tobacco users differentially affects
electrophysiological properties of major subtypes of human neuronal
nicotinic AChRs. Xenopus laevis oocytes were injected with subunit cRNAs encoding (1) homomeric
7 AChRs, (2) heteromeric
4
2 AChRs and (3) heteromeric
3 AChRs formed from combinations of
3,
2,
4 and
5 cRNAs. Acute activation required
micromolar concentrations of nicotine. Chronic exposure to
submicromolar concentrations of nicotine irreversibly inactivated many
4
2 AChRs and
7 AChRs but inhibited
3 AChRs much less. Thus,
although
3 AChRs are present in the brain in much smaller amounts
than are
4
2 AChRs or
7 AChRs,
3 AChRs in brain and
autonomic ganglia may be able to play a relatively large role in acute
responses to endogenous ACh or subsequent doses of nicotine after
chronic exposure to nicotine. The behavioral effects of nicotine may
typically reflect the sustained inhibition of
4
2 AChRs and
7
AChRs in combination with the residual susceptibility of
3 AChRs and
perhaps some other AChR subtypes for acute activation. Tolerance for
nicotine exhibited by tobacco users may reflect the long-term
irreversible functional inactivation of
4
2 AChRs and
7 AChRs
produced by chronic exposure to nicotine.
| |
Introduction |
|---|
|
|
|---|
Nicotine
acting at neuronal nicotinic AChRs is the primary component of
tobacco that drives its habitual use (Benowitz, 1996
). It has been
hypothesized that smoking a cigarette results in a rapid bolus of
nicotine that activates the mesolimbic dopaminergic system producing
pleasure and reward, that nicotine slowly builds to a low steady
concentration which causes both reversible desensitization and
long-term inactivation of AChRs as well as increases in the amounts of
some AChR subtypes and that smokers medicate themselves with nicotine
to regulate their AChR response (Collins and Marks, 1996
; Dani and
Heinemann, 1996
; Wonnacott et al., 1996
).
Nicotine and nicotinic drugs could be important in some neurological
diseases because it has been shown that a substantial decrease in
nicotinic AChRs is characteristic of both Alzheimer's and Parkinson's
disease (Lange et al., 1993
; Whitehouse et al., 1988
). Epidemiological studies also indicate that smoking may be
protective against Parkinson's disease and, to a lesser extent, Alzheimer's disease (Morens et al., 1995
). In Parkinson's
disease, there is loss of dopamine due to the degeneration of the
substantia nigra. It is known that presynaptic AChRs can
modulate the release of dopamine (Wonnacott et al., 1996
)
and that nicotine can be neuroprotective against excitotoxicity (Akaike
et al., 1994
). These results suggest mechanisms by which
nicotine might be protective against Parkinson's disease and by which
nicotinic drugs might be therapeutic. The effects of nicotine in
several other diseases suggest that nicotinic AChRs may be involved in
some way in their pathology or therapy. For example, nicotine from
transdermal patches is effective in reducing the severity of
Tourette's syndrome (Dursun et al., 1994
). As another
example, it has been reported that
7 AChRs may be responsible for an
attentional deficit that may be a predisposing genetic factor for
schizophrenia, that
7 AChRs are reduced in brains of schizophrenia
patients and that schizophrenia patients may smoke heavily to
self-medicate with nicotine (Freedman et al., 1997
).
Along with the synchronized activation of AChRs by a rapid bolus of
nicotine, long-term application of this agonist can lead to inactive
states of these AChRs, some of which are readily reversible and others
of which are not (Collins and Marks, 1996
; Dani and Heinemann, 1996
;
Hsu et al., 1996a
; Lester and Dani, 1994
; Lukas, 1991
). An
understanding of the effects of chronic exposure to nicotine on various
AChR subtypes might provide better insights into mechanisms of nicotine
dependence, tolerance and withdrawal and into the effects of medication
with nicotine or nicotinic drugs.
An AChR subtype with the subunit stoichiometry
(
4)2 (
2)3 is
thought to account for most of the high affinity nicotine binding in
brain (Anand et al., 1991
; Flores et al., 1992
;
Lindstrom, 1996
; Wada et al., 1989
). Nearly equal amounts of
a subtype thought to have an (
7)5 subunit
stoichiometry are found in brain (Alkondon and Albuquerque.,
1993; Anand et al., 1993
; Couturier et
al., 1990
; Del Toro et al., 1994
; Lindstrom, 1996
;
Schoepfer et al., 1990
; Seguela et al., 1993
).
The
7 AChRs are also often found in peripheral ganglion neurons,
which also express a mixture of
3 AChR subtypes (Conroy and Berg,
1995
). The
3 AChRs are found in brain, although in lower amounts
than
4
2 AChRs or
7 AChRs (Wada et al., 1989
). The
3 forms functional AChRs in combination with
2 or
4 subunits
(Gerzanich et al., 1995
; Papke, 1992
), and
5 subunits
assemble efficiently with both combinations (Wang et al.,
1996
). Presumably many subtypes of AChRs are expressed in discrete
populations of neurons performing particular functional roles. Many of
the AChRs in brain are thought to be located presynaptically and have
been implicated in facilitating release of transmitters including ACh,
dopamine, glutamate and
-aminobutyric acid (Collins and Marks, 1996
;
Gray et al., 1996
; Lena and Changeux, 1997
; McGehee and
Role, 1995
; Wonnacott et al., 1996
).
Chronic exposure to nicotine has been shown to differentially affect
both the amount and function of neuronal AChR subtypes. Chicken
4
2 AChRs expressed in Xenopus laevis oocytes or a
permanently transfected cell line were shown to double in amount when
chronically exposed to nicotine (Peng et al., 1994
). The
EC50 for upregulation was 0.2 µM, essentially
equal to the concentration of nicotine typically found in the serum of
smokers (Benowitz et al., 1990
). The upregulation was due to
a decrease in the rate of destruction of these AChRs resulting from an
inactive conformation of these AChRs (Peng et al., 1994
).
Chronic exposure to high concentrations of nicotine not only reversibly
desensitized these AChRs but also permanently inactivated some of them
(Peng et al., 1994
). Similarly, human
4
2 AChRs in a
permanently transfected cell line were upregulated by chronic nicotine
exposure, but the amount of ACh-induced ion flux per AChR was decreased
(Gopalakrishnan et al., 1996
). The
7 AChRs and the
mixture of
3 AChRs expressed by the human neuroblastoma cell line
SH-SY5Y increased by 30% and 600%, respectively, in response to
chronic exposure to nicotine but only when extremely high
concentrations were used (Peng et al., 1997
). In a
comparison of the electrophysiological responses to a 48-hr exposure to
nicotine of rat
4
2 AChRs expressed in X. laevis
oocytes, it was found that nanomolar concentrations of nicotine
eliminated most
4
2 AChR function, whereas micromolar
concentrations of nicotine blocked only 50% to 60% of rat
3
2
AChR responses (Hsu et al., 1996a
).
This study compares both the short- and long-term effects of chronic
nicotine treatment on electrophysiological function of cloned human
4
2,
3
2,
3
2
5,
3
4,
3
4
5,
3
2
4
5, and
7 subunit combinations expressed in X. laevis oocytes. It examines the concentration and time dependence
of the responses of these AChR subtypes to acute activation by nicotine
and both reversible desensitization and permanent inactivation caused
by chronic exposure to nicotine.
| |
Methods |
|---|
|
|
|---|
Cloning of human
4 subunit cDNA.
The cDNA
encoding the human neuronal AChR alpha4 subunit was obtained
by PCR amplification of cDNA synthesized from human brain
poly(A)+ RNA (Clontech, Palo Alto, CA) with
StrataScript RNase H
Reverse Transcriptase
(Strategene, La Jolla, CA) using two sets of primers (forward,
GCCAGCAGCCATGTGGAG; reverse, GCCATCTTATGCATGGACTCGATG) and
(forward, TGGGTACGCAGGGTCTTC; reverse, AGCAGGCTCCCGGTCCCTTCC TAG). For
subsequent recloning into vector, the product obtained with the first
primer set was digested with BsaI and NsiI
endonucleases. The product obtained with the second set of primers was
digested with only NsiI. The 5
end of this subunit was
amplified from 5
-RACE-Ready cDNA (Clontech) using Anchor Primer
supplied with the kit (CTGGTTCGGCCCACCTCTGAAGGTTCCAGAATCGATAG) and
specific 5
reverse primer (GCCACGGGTCGGGACCAC). The 5
-end PCR
fragment was digested with ClaI and BsaI
restrictions enzymes. All PCR fragments were purified by agarose gel
electrophoresis using the Geneclean II kit (BIO 101, Vista, CA). The
PCR products were ligated together via BsaI and
NsiI sites and cloned into the Cla I and EcoRV
blunt end sites of the pBluescript II SK(
)
phagemid. The construct was sequenced according to the Sanger method
(Sequenase Version 2.0 DNA Sequencing Kit; United States Biochemicals,
Cleveland, Ohio) to verify the published sequence of the human
4
AChR subunit (Gopalakrishnan et al., 1996
).
In vitro transcription, oocyte isolation and cRNA
injection.
cDNAs encoding the human
4 and
7 subunits were
cloned into a modified SP64T expression vector,
3 and
4 in pcDNAI
vector, and
5 and
2 in pSP64A vector, using standard DNA cloning
procedures (Melton et al., 1984
). cRNA was synthesized
in vitro using the Megascript kit (Ambion, Austin, TX).
4
2,
3
2
4
5, and
7 subunit cRNAs (equal weights of 5-12 ng of each subunit per AChR subtype in a total volume of 55 nl).
After injections, oocytes were maintained under semisterile conditions
at 18°C in Liebovitz L-15 medium (Life Technologies, Grand Island,
NY) diluted by half in 10 mM HEPES buffer, pH 7.5.
Purification and immunoabsorption of AChRs from oocytes and
solid-phase radioimmunoassays.
The purification and
immunoabsorption of AChRs from X. laevis oocytes as well as
solid-phase radioimmunoassays were used to compare the relative amounts
of AChR subunits expressed in oocytes injected with equal amounts of
3,
2,
4 and
5 subunit cRNAs. The procedures for these
experiments were as previously described (Peng et al.,
1994
).
Nicotine treatment and electrophysiological recordings.
Currents were measured using a standard two-microelectrode
voltage-clamp amplifier (Oocyte Clamp OC-725; Warner Instrument Corp.,
Hamden, CT) as previously described (Gerzanich et al., 1995
). All recordings were digitized using MacLab software and hardware
(AD Instruments, Castle Hill, Australia) and stored on an Apple
Macintosh IIcx computer. Data were analyzed using KALEIDAGRAPH (Synergy
Software, Reading, PA).
| |
Results |
|---|
|
|
|---|
Acute activation by nicotine.
For each AChR type, the
concentration-response curves for activation by nicotine and ACh were
compared, as shown in figure 1. Table
1 summarizes some of the pharmacological
properties of
4
2,
3 and
7 AChRs.
|
|
4
2 AChRs were activated by the lowest concentrations of nicotine
of the three subtypes investigated. The concentration of nicotine that
produced the half-maximal activation (EC50) was 0.30 ± 0.04 µM. This value is particularly significant because it is close to the 0.2 µM steady-state concentration of nicotine typical of the serum of smokers (Benowitz et al., 1990
3,
2,
4 and
5
subunits to model autonomic neurons and characterized neuroblastoma cell lines (Conroy and Berg, 1995
3 AChRs. These
3 AChRs had an
EC50 for activation by nicotine of 3.0 ± 0.3 µM, indicating a 10-fold lower sensitivity to nicotine than that
exhibited by
4
2 AChRs. The maximal current elicited by a
saturating concentration of nicotine was approximately half of that
elicited by ACh. Previously, we showed that nicotine is a partial
agonist for human
3
2
5 AChRs but a full agonist for human
3
4
5 AChRs (Wang et al., 1996
3,
2,
4 and
5 AChR subunits showed that 55% of the AChRs expressed contained the
4 subunit, whereas 35% contained the
2 subunit (fig. 2). The sum of
3 AChRs
containing
2 subunits with those containing
4 subunits accounts
for the total, indicating that few contain both
2 and
4 subunits.
As shown in detail previously (Wang et al., 1996
3 subunits and >60% contain
5 subunits. These results
imply that with this mixture of
3,
2,
4 and
5 cRNAs in
X. laevis oocytes, most of the
3 AChRs consist of either
3
2
5 or
3
4
5 AChRs but not
3
2
4
5 AChRs.
|
7 AChRs have the lowest sensitivity to nicotine of the three
subtypes investigated. The
7 homomers have been shown to have an
EC50 for activation by nicotine of 40 ± 2 µM (Peng et al., 1993
7 homomers desensitize much faster than those of the
other two AChRs subtypes. This is a characteristic property of
7
AChRs (Couturier et al., 1990Long-term inhibition by nicotine.
To determine the effects of
long-term exposure to nicotine, oocytes were incubated for 48 hr in
various concentrations of nicotine. Then, responses from the oocytes
were tested using 100 µM ACh as agonist in a perfusing solution that
also contained nicotine at the concentration used for incubation.
Figure 3 compares the nicotine
concentration dependence of chronic inhibition with that for acute
activation.
|
7 AChRs were the most sensitive of the three AChR subtypes
investigated to inhibition by chronic exposure to nicotine. Complete
attenuation of response was obtained for concentrations of nicotine of
>0.2 µM. The IC50 value for nicotine-induced
loss of response was 2.8 ± 0.41 nM.
4
2 AChRs also decreased their response to a saturating
concentration of ACh after incubation with nanomolar concentrations of
nicotine. A total loss of response to ACh occurred after incubation with nicotine concentrations of >2 µM. The
IC50 value for nicotine-induced loss of
responsiveness was 17 ± 3.1 nM.
In contrast, for
3 AChRs responses to ACh were not completely
inhibited even after incubation with 10 µM nicotine. The
IC50 value for nicotine-induced loss of
responsiveness in this case was 870 ± 330 nM.
Time course of nicotine-induced inhibition.
Initial control
currents were evoked with 100 µM ACh 3 days after injection of cRNA.
After incubation of the oocytes in 0.2 µM nicotine, the responses to
100 µM ACh were determined initially in 0.2 µM nicotine and again
after a 1-hr rinse in nicotine-free saline to permit recovery from
reversible desensitization. At each time point, responses were compared
with those of control oocytes that were incubated without nicotine. At
all prolonged times of incubation in nicotine, ACh-evoked responses
were decreased with respect to control oocytes. Results from these
experiments are shown in figure 4.
|
4
2 AChRs exposed to 0.2 µM nicotine lost their response to
100 µM ACh rapidly on prolonged exposure. After 10 sec in nicotine,
the response to 100 µM ACh was reduced only 10%, and this reduction
was completely reversed within 1 hr after removal of the nicotine.
However, after 100 sec in nicotine, the response decreased 50%, and
even after 1 hr of rinsing, 30% of the
4
2 AChRs appeared to be
permanently inactivated. After 2.8 hr in 0.2 µM nicotine, essentially
all of the
4
2 AChRs were desensitized to a state that required
>1 hr to recover from and were presumed to be permanently inactivated.
In the case of
7 AChRs, the response to ACh decreased by 50% within
the first 100 sec of nicotine exposure. About 90% inhibition occurred
within 3 hr. This occurred despite the fact that the nicotine
concentration used was 35 times less than the
EC50 value for activation of
7 AChRs by
nicotine. At any incubation time in nicotine longer than 10 sec, the
extent of recovery of the response to ACh after washing was very small.
In contrast,
3 AChRs were relatively unaffected by prolonged
exposure to 0.2 µM nicotine. After 28 hr, the response was less than
the control value by only 25%. Furthermore, these AChRs exhibited almost full recovery within 1 hr, even after a 28-hr incubation in
nicotine. The inactivation caused by 3 hr in 0.2 µM nicotine was
determined with each of the four
3 AChR subtypes (fig.
5). The
3 AChRs containing
2
subunits were inhibited ~50%, whereas
3 AChRs containing
4
subunits were not inhibited. This indicated that the 25% inhibition
observed for the
3
2
4
5 mixture (fig. 4) resulted from the
2-containing AChRs in the mixture.
|
Time course of recovery after long-term incubation in
nicotine.
We also considered the time course of recovery of
response after a 28-hr incubation in 0.2 µM nicotine, as shown in
figure 6. At this point, 72 hr had
elapsed since the oocytes were injected with cRNA, and their ability to
synthesize new AChRs was probably substantially reduced due to decay of
this cRNA. The limited recoveries observed after prolonged washing
suggest that in these oocytes, most of the desensitization observed
after 24-hr incubation reflects permanent inactivation and there was
little synthesis of new AChRs.
|
7 AChRs exhibited little recovery of response to 100 µM ACh
after a 28-hr incubation in 0.2 µM nicotine, despite 24 hr of
washing.
The
4
2 AChRs were also substantially irreversibly inhibited by a
28-hr incubation in 0.2 µM nicotine. These AChRs were inhibited to
~10% of the control response. This response recovered to as much as
40% of the control response within 6 hr, but then the responses began
to decrease, possibly reflecting AChR turnover in the absence of new
synthesis.
By contrast,
3 AChRs were inhibited by only 25% after 28 hr in 0.2 µM nicotine, and the results show a recovery rate of >95% within 1 hr after washout.
| |
Discussion |
|---|
|
|
|---|
We found that prolonged exposure to nicotine affects three major
human neuronal nicotinic AChR subtypes differently;
4
2 AChRs and
7 AChRs were substantially inactivated by prolonged exposure to
nicotine, but
3 AChR subtypes were not.
The
4
2 AChRs exhibited the highest sensitivity for acute
activation by nicotine (EC50 = 300 nM) and,
correspondingly, were efficiently desensitized by 48-hr incubation in
low concentrations of nicotine. The much lower concentrations of
nicotine required for chronic inactivation than acute activation
presumably reflect the gradual accumulation of AChRs in a high affinity
desensitized conformation, which can occur without necessarily gating
the AChRs. After 3 hr in 0.2 µM nicotine, the response of
4
2
AChRs to a saturating concentration of ACh was virtually eliminated,
and it recovered negligibly after washing for 1 hr, suggesting that irreversible desensitization had occurred. Hsu et al.
(1996a)
agree that chronic exposure to nM concentrations of nicotine
inhibits the response of
4
2 AChRs but not
3
2 AChRs and that
micromolar concentrations of nicotine eliminate the response of
4
2 AChRs. Differences in species and methods make quantitative
comparisons with their IC50 values difficult. We
incubated with nicotine for 48 hr starting 48 hr after injection of
oocytes with human
4
2 cRNAs and found that 17 nM nicotine caused
a 50% reduction in the response to 100 µM ACh compared with
untreated oocytes. They reported that after incubation with nicotine
for 48 hr starting 48 hr after injection with rat
4
2 cRNAs, 0.11 nM nicotine caused a 50% reduction in the response to 0.7 µM
nicotine compared with the initial responses of these oocytes. Their
reported IC50 value changed to 1.9 nM if the
oocytes were incubated with nicotine starting 24 hr after cRNA
injection.
Oocytes injected with equal amounts of cRNAs for
3,
2,
4 and
5 subunits to model the mix of
3 AChRs found in chick ciliary ganglia (Conroy and Berg, 1995
) and several rat or human neuroblastoma cell lines (Lukas et al., 1993
; Wang et al.,
1996
) were found to express a mixture of
2 and
4
subunit-containing
3 AChRs rather than a homogeneous population of
AChRs containing all four subunits. The
3 AChRs exhibited 10-fold
lower sensitivity for acute activation by nicotine and were 50-fold
less efficiently desensitized by 48-hr incubation in low concentrations
of nicotine (IC50 = 870 nM) than were
4
2
AChRs. In the presence of 0.2 µM nicotine,
3
2 AChRs and
3
2
5 AChRs were inhibited by ~50% in their response to 100 µM ACh, whereas
3
4 AChRs and
3
4
5 AChRs were not
significantly inhibited. This probably reflects the higher sensitivity
for activation by nicotine for
3
2 AChRs
(EC50 = 6.8 µM) and
3
2
5 AChRs
(EC50 = 1.9 µM) than for
3
4 AChRs
(EC50 = 106 µM) and
3
4
5 AChRs
(EC50 = 105 µM) (27). Even after 3 hr in 0.2 µM nicotine, the response of
3 AChRs to a saturating concentration
of ACh recovered completely after 1 hr of washing, in contrast with the
almost total loss of
4
2 AChR response.
The
7 AChRs exhibited the lowest sensitivity for acute
activation by nicotine of the three subtypes
(EC50 = 40,000 nM), 13-fold lower than
3 AChRs
and 133-fold lower than
4
2 AChRs. However,
7 AChRs were the
most sensitive of the three subtypes to inactivation by 48-hr
incubation in low concentrations of nicotine
(IC50 = 2.8 nM), probably reflecting the rapid
desensitization characteristic of
7 AChRs (Alkondon and Albuquerque,
1993
; Couturier et al., 1990
; Gerzanich et al.,
1994
, 1995
; Lindstrom, 1996
; Peng et al., 1993
; Seguela
et al., 1993
). The
7 AChRs were 6-fold more sensitive than
4
2 AChRs and 310-fold more sensitive than
3 AChRs.
EC50 values for activation by ACh and nicotine of
cloned human
4
2 AChRs and
7 AChRs determined here using a set
of glass tubes to ensure rapid application agree well with values
obtained for these cloned AChRs by others using a
millisecond-resolution multibarrel puffer technique on transfected
cells (Buisson et al., 1996
; Gopalakrishnan et
al., 1995
).
Irreversible inactivation may be related to AChR up-regulation, which
is another phenomenon associated with chronic exposure of nicotinic
AChRs to nicotine. Previously, we showed that the upregulation of
4
2 AChRs occurs due to a decrease in AChR turnover that could be
associated with a change in AChR conformation not associated with
channel opening (Peng et al., 1994
). It is not clear whether
this conformation is identical to a reversibly desensitized or an
irreversibly inactivated conformation. It is clear that despite an
increase in the number of AChRs as a result of chronic exposure to
nicotine, there is a net decrease in function of
4
2 AChRs and
7 AChRs. Recent findings also show that sustained exposure of
4
2 AChRs to nicotine increases the phosphorylation of the
4
subunit (Hsu et al., 1996b
; Molinari et al.,
1996
). Further investigations of this mechanism may lead to a clearer
picture of the relationship between the AChR conformations and
post-translational modifications associated with up-regulation and
those associated with functional inactivation.
The tolerance to increased nicotine doses that is characteristic of
tobacco users (Benowitz, 1996
; Collins and Marks, 1996
; Dani and
Heinemann, 1996
) can be explained by the net decreases in
4
2 AChR
and
7 AChR function that we have observed after chronic exposure to
nicotine. These decreases in function occur despite an increase in the
amount, especially of
4
2 AChRs, induced by chronic exposure to
nicotine (Peng et al., 1994
, 1997
). Permanent inactivation
of
4 or
7 AChRs coupled with a slow rate of
resynthesis may account for the weeks of benefit reported for
Tourette's syndrome patients treated for only 2 days with
transdermal nicotine patches (Dursun et al., 1994
). A
particularly good example of nicotine acting in vivo as a
time-averaged antagonist is the effect of nicotine on prolactin release
in the rat (Hulihan-Giblin et al., 1990a
, 1990b
; Sharp and
Beyer, 1986
). A single intravenous injection of nicotine causes an
increase in serum prolactin concentration as a result of activating
AChRs in the hypothalamus. This response desensitizes rapidly and for a
long duration, resulting in little or no response 1 or 6 hr later.
Chronic treatment with nicotine by injections twice a day for 10 days
prevented any acute response to nicotine despite provoking an increase
in hypothalamic [3H]ACh binding sites. After
this chronic nicotine treatment, 8 to 14 days were required for the
response to acute nicotine treatment and the amount of AChR to return
to normal, presumably as a result of turnover of permanently
inactivated AChRs.
Gene knockout experiments also suggest that it is reasonable to think
that chronic exposure to nicotine in tobacco users could be
associated with the net loss of
4
2 AChR and
7 AChR function but not great neurological impairment. Knockout of the
2 subunit gene in mice eliminates the high affinity binding of nicotine in the
brain that would be expected from the loss of
4
2 AChRs (Picciotto
et al., 1995
). Knockout of the
7 subunit gene in mice eliminates the high-affinity binding of
-bungarotoxin in
brain that would be expected from
7 AChRs (Orr-Urtreger et
al., 1996
). In neither case do these knockout mice exhibit gross
behavioral or anatomic anomalies.
In a chronic smoker with a typical serum concentration of nicotine of
0.2 µM (Benowitz et al., 1990
), virtually all
4
2
AChRs would be inactivated, as would 90% of their
7 AChRs, but only 20% of their
3 AChRs would be inactivated, and only these could quickly recover as the serum nicotine concentration dropped after a few
hours without smoking. Thus, the behavioral effects and reward of
smoking are likely to depend on the inactivation of
4
2 AChRs and
7 AChRs while leaving
3 AChRs available to respond to the
micromolar boluses of nicotine available quickly after inhalation of
smoke (Benowitz, 1996
). The first cigarette of the morning is generally
regarded as the most rewarding (Benowitz, 1996
), which might
result either from increased sensitivity or resynthesis of
4
2
AChRs and
7 AChRs after overnight abstinence or as a relief from
withdrawal symptoms as these two AChR subtypes are quickly returned to
their chronically inactivated states. Neuronal synaptic mechanisms can
be complex. In ciliary ganglia, postsynaptic
3 AChRs combine with
perisynaptic
7 AChRs to contribute to a high safety factor for
neurotransmission, and neurotransmission can occur even if the
7
AChRs are blocked with
-bungarotoxin (Zhang et
al., 1996
). At this type of synapse, the
7 AChR component of
the postsynaptic current would be blocked by the chronic presence of
nicotine, but transmission could still occur through
3 AChRs.
The
4 (Wada et al., 1989
) and
7 AChRs (Cimino et
al., 1992
; Del Toro et al., 1994
; Seguela et
al., 1993
) are expressed in many areas of the brain, whereas
3
AChRs can be found mostly in the peripheral nervous system (McGehee and
Role, 1995
; Orr-Urtreger et al., 1996
; Wada et
al., 1989
; Whiting et al., 1991
). In the brain,
3
AChRs have been thought to be localized to areas known to be directly
involved in the reward mechanisms of drug abuse, including the locus
ceruleus, ventral tegmental area and substantia nigra (Wada et
al., 1989
). Recent evidence, however, suggests that many of
the dopamine-containing regions of the brain associated with addiction
or Parkinson's disease may in fact contain
6 rather than
3 (LeNovere et al., 1996). The
6 subunits
are closely related to
3 subunits in sequence. Their ability to
function as parts of AChRs has only recently been demonstrated
(Gerzanich et al., 1997
). The
6
4 AChRs were
found to differ pharmacologically from
3
4 AChRs, with nicotine
behaving as an 18% partial agonist with a prolonged inhibitory
effect. Therefore, investigations of the acute and chronic
effects of nicotine on
6 AChRs will be important in
the future. It remains to be determined which AChR subtypes are
associated with particular components of the behavioral responses to
chronic exposure to nicotine and how these AChR subtypes act by
presynaptic and postsynaptic mechanisms in various circuits to produce
these behavioral effects.
| |
Acknowledgments |
|---|
We thank Drs. Mark Nelson and Gregg Wells for useful comments on the manuscript.
| |
Footnotes |
|---|
Accepted for publication July 25, 1997.
Received for publication May 30, 1997.
1 This work was supported by grants to J.L. from the National Institutes of Health, The Smokeless Tobacco Research Council and the Muscular Dystrophy Association.
2 These two authors contributed equally to this work.
Send reprint requests to: Dr. Jon Lindstrom, Department of Neuroscience, 217 Stemmler Hall, University of Pennsylvania Medical School, Philadelphia, PA 19104-6074.
| |
Abbreviations |
|---|
ACh, acetylcholine; AChR, acetylcholine receptor.
| |
References |
|---|
|
|
|---|
-bungarotoxin-sensitive acetylcholine receptors immunoisolated from chick retina: Contrasting properties of
7 and
8 subunit-containing subtypes.
Mol. Pharmacol.
44: 1046-50, 1993.
4
2 neuronal nicotinic acetylcholine receptor in HEK 293 cells: a patch clamp study.
J. Neurosci.
16: 7880-7891, 1996.
3 subunit mRNA,
-bungarotoxin and nicotine binding sites.
Neurosci.
51: 77-86, 1992.
7) is developmentally regulated and forms a homo-oligomeric channel blocked by
-BTX.
Neuron
5: 847-856, 1990.
7 subunit of the nicotinic acetylcholine receptor in rat central nervous system.
J. Comp. Neurol.
349: 325-342, 1994.
4 and
2 subunits and is upregulated by chronic nicotine treatment.
Mol. Pharmacol.
41: 31-37, 1992.
8 and
7 subunits of nicotinic receptors exhibit similar channel but contrasting binding site properties.
Mol. Pharmacol.
45: 212-220, 1994.
6 nicotinic AChR subunit can form a functional heteromeric acetylcholine receptor.
Mol. Pharmacol.
51: 320-327, 1997.
7 nicotinic acetylcholine receptor.
Eur. J. Pharmacol.
290: 237-246, 1995.
4
2 receptor.
J. Pharm. Exp. Ther.
276: 289-297, 1996.
3
2 and
4
2 neuronal nicotinic receptors expressed in Xenopus oocytes.
J. Neurochem.
66: 667-775, 1996a.
4 subunit of
4
2 neuronal
nicotinic receptors expressed in Xenopus oocytes by both cyclic
AMP-dependent protein kinase and a tyrosine kinase. Society for
Neuroscience (Abstract 603.12)1526, 1996b.
6 mRNA is selectively concentrated in catecholaminergic nuclei of the rat brain.
Eur. J. Neursci.
8: 2428-2439, 1996.
3 AChRs and
7 AChRs expressed by the human neuroblastoma cell line SH-SY5Y.
Mol. Pharmacol.
51: 776-784, 1997.
7 acetylcholine receptor: Cloning of the
7 subunit from the SH-SY5Y cell line and determination of pharmacological properties of native receptors and functional
7 homomers expressed in Xenopus oocytes.
Mol. Pharmacol.
45: 546-554, 1993.
7 neuronal nicotinic receptor gene by targeted recombination.
Neuroscience Society Meeting Abstract
501: 6, 1996.
-bungarotoxin binding protein cDNAs and mAbs reveal subtypes of this branch of the ligand-gated ion channel gene superfamily.
Neuron
5: 35-48, 1990.
7: a nicotinic cation channel highly permeable to calcium.
J. Neurosci.
13: 596-604, 1993.
2,
3,
4, and
2 neuronal nicotinic receptor subunit mRNAs in the central nervous systems: a hybridization histochemical study in the rat.
J. Comp. Neurol.
284: 314-335, 1989.
3 subunit with
2,
4, and
5 subunits.
J. Biol. Chem.
271: 17656-17665, 1996.
-bungarotoxin.
Neuron
17: 1231-1240, 1996.
This article has been cited by other articles:
![]() |
A. A. Steiner, D. L. Oliveira, J. L. Roberts, S. R. Petersen, and A. A. Romanovsky Nicotine administration and withdrawal affect survival in systemic inflammation models J Appl Physiol, October 1, 2008; 105(4): 1028 - 1034. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Laviolette, N. M. Lauzon, S. F. Bishop, N. Sun, and H. Tan Dopamine Signaling through D1-Like versus D2-Like Receptors in the Nucleus Accumbens Core versus Shell Differentially Modulates Nicotine Reward Sensitivity J. Neurosci., August 6, 2008; 28(32): 8025 - 8033. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Arredondo, A. I. Chernyavsky, D. L. Jolkovsky, K. E. Pinkerton, and S. A. Grando Receptor-mediated tobacco toxicity: acceleration of sequential expression of {alpha}5 and {alpha}7 nicotinic receptor subunits in oral keratinocytes exposed to cigarette smoke FASEB J, May 1, 2008; 22(5): 1356 - 1368. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mamede, K. Ishizu, M. Ueda, T. Mukai, Y. Iida, H. Kawashima, H. Fukuyama, K. Togashi, and H. Saji Temporal Change in Human Nicotinic Acetylcholine Receptor After Smoking Cessation: 5IA SPECT Study J. Nucl. Med., November 1, 2007; 48(11): 1829 - 1835. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Briggs, E. J. Gubbins, M. J. Marks, C. B. Putman, R. Thimmapaya, M. D. Meyer, and C. S. Surowy Untranslated Region-Dependent Exclusive Expression of High-Sensitivity Subforms of {alpha}4beta2 and {alpha}3beta2 Nicotinic Acetylcholine Receptors Mol. Pharmacol., July 1, 2006; 70(1): 227 - 240. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Tournier, K. Maouche, C. Coraux, J.-M. Zahm, I. Cloez-Tayarani, B. Nawrocki-Raby, A. Bonnomet, H. Burlet, F. Lebargy, M. Polette, et al. {alpha}3{alpha}5{beta}2-Nicotinic Acetylcholine Receptor Contributes to the Wound Repair of the Respiratory Epithelium by Modulating Intracellular Calcium in Migrating Cells Am. J. Pathol., January 1, 2006; 168(1): 55 - 68. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kuryatov, J. Luo, J. Cooper, and J. Lindstrom Nicotine Acts as a Pharmacological Chaperone to Up-Regulate Human {alpha}4{beta}2 Acetylcholine Receptors Mol. Pharmacol., December 1, 2005; 68(6): 1839 - 1851. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-H. Jo, D. Wiedl, and L. W. Role Cholinergic Modulation of Appetite-Related Synapses in Mouse Lateral Hypothalamic Slice J. Neurosci., November 30, 2005; 25(48): 11133 - 11144. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Davis, J. R. James, S. J. Siegel, and T. J. Gould Withdrawal from Chronic Nicotine Administration Impairs Contextual Fear Conditioning in C57BL/6 Mice J. Neurosci., September 21, 2005; 25(38): 8708 - 8713. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Reynolds and J. R. Hoidal Temporal-Spatial Expression and Transcriptional Regulation of {alpha}7 Nicotinic Acetylcholine Receptor by Thyroid Transcription Factor-1 and Early Growth Response Factor-1 during Murine Lung Development J. Biol. Chem., September 16, 2005; 280(37): 32548 - 32554. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. B. Free, S. B. McKay, P. D. Gottlieb, R. T. Boyd, and D. B. McKay Expression of Native {alpha}3{beta}4* Neuronal Nicotinic Receptors: Binding and Functional Studies Investigating Turnover of Surface and Intracellular Receptor Populations Mol. Pharmacol., June 1, 2005; 67(6): 2040 - 2048. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Rau, R. D. Johnson, and B. Y. Cooper Nicotinic AChR in Subclassified Capsaicin-Sensitive and -Insensitive Nociceptors of the Rat DRG J Neurophysiol, March 1, 2005; 93(3): 1358 - 1371. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Proskocil, H. S. Sekhon, Y. Jia, V. Savchenko, R. D. Blakely, J. Lindstrom, and E. R. Spindel Acetylcholine Is an Autocrine or Paracrine Hormone Synthesized and Secreted by Airway Bronchial Epithelial Cells Endocrinology, May 1, 2004; 145(5): 2498 - 2506. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. N. Nguyen, B. A. Rasmussen, and D. C. Perry Subtype-Selective Up-Regulation by Chronic Nicotine of High-Affinity Nicotinic Receptors in Rat Brain Demonstrated by Receptor Autoradiography J. Pharmacol. Exp. Ther., December 1, 2003; 307(3): 1090 - 1097. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. A. Wooltorton, V. I. Pidoplichko, R. S. Broide, and J. A. Dani Differential Desensitization and Distribution of Nicotinic Acetylcholine Receptor Subtypes in Midbrain Dopamine Areas J. Neurosci., April 15, 2003; 23(8): 3176 - 3185. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.E. Richardson, J.M. Morgan, B. Jasani, J.T. Green, J. Rhodes, G.T. Williams, J. Lindstrom, S. Wonnacott, S. Peel, and G.A.O. Thomas Effect of smoking and transdermal nicotine on colonic nicotinic acetylcholine receptors in ulcerative colitis QJM, January 1, 2003; 96(1): 57 - 65. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Gentry, L. H. Wilkins Jr., and R. J. Lukas Effects of Prolonged Nicotinic Ligand Exposure on Function of Heterologously Expressed, Human alpha 4beta 2- and alpha 4beta 4-Nicotinic Acetylcholine Receptors J. Pharmacol. Exp. Ther., January 1, 2003; 304(1): 206 - 216. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Rush, A. Kuryatov, M. E. Nelson, and J. Lindstrom First and Second Transmembrane Segments of alpha 3, alpha 4, beta 2, and beta 4 Nicotinic Acetylcholine Receptor Subunits Influence the Efficacy and Potency of Nicotine Mol. Pharmacol., June 1, 2002; 61(6): 1416 - 1422. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Meyer, L. C. Gahring, and S. W. Rogers Nicotine Preconditioning Antagonizes Activity-dependent Caspase Proteolysis of a Glutamate Receptor J. Biol. Chem., March 22, 2002; 277(13): 10869 - 10875. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Sekhon, J. A. Keller, B. J. Proskocil, E. L. Martin, and E. R. Spindel Maternal Nicotine Exposure Upregulates Collagen Gene Expression in Fetal Monkey Lung . Association with alpha 7 Nicotinic Acetylcholine Receptors Am. J. Respir. Cell Mol. Biol., January 1, 2002; 26(1): 31 - 41. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Girod and L. W. Role Long-Lasting Enhancement of Glutamatergic Synaptic Transmission by Acetylcholine Contrasts with Response Adaptation after Exposure to Low-Level Nicotine J. Neurosci., July 15, 2001; 21(14): 5182 - 5190. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Tizabi, B. Getachew, M. Davila-Garcia, and R. E. Taylor Alcohol preference: association with reduced striatal nicotinic receptors Alcohol Alcohol., July 1, 2001; 36(4): 318 - 322. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Köfalvi, B. Sperlágh, T. Zelles, and E. S. Vizi Long-Lasting Facilitation of 4-Amino-n-[2,3-3H]butyric Acid ([3H]GABA) Release from Rat Hippocampal Slices by Nicotinic Receptor Activation J. Pharmacol. Exp. Ther., November 1, 2000; 295(2): 453 - 462. [Abstract] [Full Text] |
||||
![]() |
M. Ferreira, A. Singh, K. L. Dretchen, K. J. Kellar, and R. A. Gillis Brainstem Nicotinic Receptor Subtypes That Influence Intragastric and Arterial Blood Pressures J. Pharmacol. Exp. Ther., July 1, 2000; 294(1): 230 - 238. [Abstract] [Full Text] |
||||
![]() |
D. C. Perry, M. I. Dávila-García, C. A. Stockmeier, and K. J. Kellar Increased Nicotinic Receptors in Brains from Smokers: Membrane Binding and Autoradiography Studies J. Pharmacol. Exp. Ther., June 1, 1999; 289(3): 1545 - 1552. [Abstract] [Full Text] |
||||
![]() |
A. L. Obaid, T. Koyano, J. Lindstrom, T. Sakai, and B. M. Salzberg Spatiotemporal Patterns of Activity in an Intact Mammalian Network with Single-Cell Resolution: Optical Studies of Nicotinic Activity in an Enteric Plexus J. Neurosci., April 15, 1999; 19(8): 3073 - 3093. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Fu, S. G. Matta, and B. M. Sharp Local alpha -Bungarotoxin-Sensitive Nicotinic Receptors Modulate Hippocampal Norepinephrine Release by Systemic Nicotine J. Pharmacol. Exp. Ther., April 1, 1999; 289(1): 133 - 139. [Abstract] [Full Text] |
||||
![]() |
A. D. J. Maus, E. F. R. Pereira, P. I. Karachunski, R. M. Horton, D. Navaneetham, K. Macklin, W. S. Cortes, E. X. Albuquerque, and B. M. Conti-Fine Human and Rodent Bronchial Epithelial Cells Express Functional Nicotinic Acetylcholine Receptors Mol. Pharmacol., November 1, 1998; 54(5): 779 - 788. [Abstract] [Full Text] |
||||
![]() |
F. Wang, M. E. Nelson, A. Kuryatov, F. Olale, J. Cooper, K. Keyser, and J. Lindstrom Chronic Nicotine Treatment Up-regulates Human alpha 3beta 2 but Not alpha 3beta 4 Acetylcholine Receptors Stably Transfected in Human Embryonic Kidney Cells J. Biol. Chem., October 30, 1998; 273(44): 28721 - 28732. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||