JPET Assistant Professor of Medicine (Clinician-Educator)

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Olale, F.
Right arrow Articles by Lindstrom, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Olale, F.
Right arrow Articles by Lindstrom, J.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*NICOTINE
*NICOTINE TARTRATE

Vol. 283, Issue 2, 675-683, 1997

Chronic Nicotine Exposure Differentially Affects the Function of Human alpha 3, alpha 4, and alpha 7 Neuronal Nicotinic Receptor Subtypes1

Felix Olale2 , Volodymyr Gerzanich2 , Alexander Kuryatov, Fan Wang and Jon Lindstrom

Department of Biology, University of Pennsylvania. (F.O.), and Department of Neuroscience, University of Pennsylvania Medical School, Philadelphia, Pennsylvania (V.G., A.K., F.W., J.L.)


    Abstract
Top
Abstract
Introduction
Methods
Results
Discussion
References

Because chronic exposure to nicotine and nicotinic drugs might both activate and desensitize nicotinic acetylcholine receptors (AChRs), we sought to determine whether prolonged exposure to nicotine concentrations encountered in tobacco users differentially affects electrophysiological properties of major subtypes of human neuronal nicotinic AChRs. Xenopus laevis oocytes were injected with subunit cRNAs encoding (1) homomeric alpha 7 AChRs, (2) heteromeric alpha 4beta 2 AChRs and (3) heteromeric alpha 3 AChRs formed from combinations of alpha 3, beta 2, beta 4 and alpha 5 cRNAs. Acute activation required micromolar concentrations of nicotine. Chronic exposure to submicromolar concentrations of nicotine irreversibly inactivated many alpha 4beta 2 AChRs and alpha 7 AChRs but inhibited alpha 3 AChRs much less. Thus, although alpha 3 AChRs are present in the brain in much smaller amounts than are alpha 4beta 2 AChRs or alpha 7 AChRs, alpha 3 AChRs in brain and autonomic ganglia may be able to play a relatively large role in acute responses to endogenous ACh or subsequent doses of nicotine after chronic exposure to nicotine. The behavioral effects of nicotine may typically reflect the sustained inhibition of alpha 4beta 2 AChRs and alpha 7 AChRs in combination with the residual susceptibility of alpha 3 AChRs and perhaps some other AChR subtypes for acute activation. Tolerance for nicotine exhibited by tobacco users may reflect the long-term irreversible functional inactivation of alpha 4beta 2 AChRs and alpha 7 AChRs produced by chronic exposure to nicotine.


    Introduction
Top
Abstract
Introduction
Methods
Results
Discussion
References

Nicotine acting at neuronal nicotinic AChRs is the primary component of tobacco that drives its habitual use (Benowitz, 1996). It has been hypothesized that smoking a cigarette results in a rapid bolus of nicotine that activates the mesolimbic dopaminergic system producing pleasure and reward, that nicotine slowly builds to a low steady concentration which causes both reversible desensitization and long-term inactivation of AChRs as well as increases in the amounts of some AChR subtypes and that smokers medicate themselves with nicotine to regulate their AChR response (Collins and Marks, 1996; Dani and Heinemann, 1996; Wonnacott et al., 1996).

Nicotine and nicotinic drugs could be important in some neurological diseases because it has been shown that a substantial decrease in nicotinic AChRs is characteristic of both Alzheimer's and Parkinson's disease (Lange et al., 1993; Whitehouse et al., 1988). Epidemiological studies also indicate that smoking may be protective against Parkinson's disease and, to a lesser extent, Alzheimer's disease (Morens et al., 1995). In Parkinson's disease, there is loss of dopamine due to the degeneration of the substantia nigra. It is known that presynaptic AChRs can modulate the release of dopamine (Wonnacott et al., 1996) and that nicotine can be neuroprotective against excitotoxicity (Akaike et al., 1994). These results suggest mechanisms by which nicotine might be protective against Parkinson's disease and by which nicotinic drugs might be therapeutic. The effects of nicotine in several other diseases suggest that nicotinic AChRs may be involved in some way in their pathology or therapy. For example, nicotine from transdermal patches is effective in reducing the severity of Tourette's syndrome (Dursun et al., 1994). As another example, it has been reported that alpha 7 AChRs may be responsible for an attentional deficit that may be a predisposing genetic factor for schizophrenia, that alpha 7 AChRs are reduced in brains of schizophrenia patients and that schizophrenia patients may smoke heavily to self-medicate with nicotine (Freedman et al., 1997).

Along with the synchronized activation of AChRs by a rapid bolus of nicotine, long-term application of this agonist can lead to inactive states of these AChRs, some of which are readily reversible and others of which are not (Collins and Marks, 1996; Dani and Heinemann, 1996; Hsu et al., 1996a; Lester and Dani, 1994; Lukas, 1991). An understanding of the effects of chronic exposure to nicotine on various AChR subtypes might provide better insights into mechanisms of nicotine dependence, tolerance and withdrawal and into the effects of medication with nicotine or nicotinic drugs.

An AChR subtype with the subunit stoichiometry (alpha 4)2 (beta 2)3 is thought to account for most of the high affinity nicotine binding in brain (Anand et al., 1991; Flores et al., 1992; Lindstrom, 1996; Wada et al., 1989). Nearly equal amounts of a subtype thought to have an (alpha 7)5 subunit stoichiometry are found in brain (Alkondon and Albuquerque., 1993; Anand et al., 1993; Couturier et al., 1990; Del Toro et al., 1994; Lindstrom, 1996; Schoepfer et al., 1990; Seguela et al., 1993). The alpha 7 AChRs are also often found in peripheral ganglion neurons, which also express a mixture of alpha 3 AChR subtypes (Conroy and Berg, 1995). The alpha 3 AChRs are found in brain, although in lower amounts than alpha 4beta 2 AChRs or alpha 7 AChRs (Wada et al., 1989). The alpha 3 forms functional AChRs in combination with beta 2 or beta 4 subunits (Gerzanich et al., 1995; Papke, 1992), and alpha 5 subunits assemble efficiently with both combinations (Wang et al., 1996). Presumably many subtypes of AChRs are expressed in discrete populations of neurons performing particular functional roles. Many of the AChRs in brain are thought to be located presynaptically and have been implicated in facilitating release of transmitters including ACh, dopamine, glutamate and gamma -aminobutyric acid (Collins and Marks, 1996; Gray et al., 1996; Lena and Changeux, 1997; McGehee and Role, 1995; Wonnacott et al., 1996).

Chronic exposure to nicotine has been shown to differentially affect both the amount and function of neuronal AChR subtypes. Chicken alpha 4beta 2 AChRs expressed in Xenopus laevis oocytes or a permanently transfected cell line were shown to double in amount when chronically exposed to nicotine (Peng et al., 1994). The EC50 for upregulation was 0.2 µM, essentially equal to the concentration of nicotine typically found in the serum of smokers (Benowitz et al., 1990). The upregulation was due to a decrease in the rate of destruction of these AChRs resulting from an inactive conformation of these AChRs (Peng et al., 1994). Chronic exposure to high concentrations of nicotine not only reversibly desensitized these AChRs but also permanently inactivated some of them (Peng et al., 1994). Similarly, human alpha 4beta 2 AChRs in a permanently transfected cell line were upregulated by chronic nicotine exposure, but the amount of ACh-induced ion flux per AChR was decreased (Gopalakrishnan et al., 1996). The alpha 7 AChRs and the mixture of alpha 3 AChRs expressed by the human neuroblastoma cell line SH-SY5Y increased by 30% and 600%, respectively, in response to chronic exposure to nicotine but only when extremely high concentrations were used (Peng et al., 1997). In a comparison of the electrophysiological responses to a 48-hr exposure to nicotine of rat alpha 4beta 2 AChRs expressed in X. laevis oocytes, it was found that nanomolar concentrations of nicotine eliminated most alpha 4beta 2 AChR function, whereas micromolar concentrations of nicotine blocked only 50% to 60% of rat alpha 3beta 2 AChR responses (Hsu et al., 1996a).

This study compares both the short- and long-term effects of chronic nicotine treatment on electrophysiological function of cloned human alpha 4beta 2, alpha 3beta 2, alpha 3beta 2alpha 5, alpha 3beta 4, alpha 3beta 4alpha 5, alpha 3beta 2beta 4alpha 5, and alpha 7 subunit combinations expressed in X. laevis oocytes. It examines the concentration and time dependence of the responses of these AChR subtypes to acute activation by nicotine and both reversible desensitization and permanent inactivation caused by chronic exposure to nicotine.

    Methods
Top
Abstract
Introduction
Methods
Results
Discussion
References

Cloning of human alpha 4 subunit cDNA. The cDNA encoding the human neuronal AChR alpha4 subunit was obtained by PCR amplification of cDNA synthesized from human brain poly(A)+ RNA (Clontech, Palo Alto, CA) with StrataScript RNase H- Reverse Transcriptase (Strategene, La Jolla, CA) using two sets of primers (forward, GCCAGCAGCCATGTGGAG; reverse, GCCATCTTATGCATGGACTCGATG) and (forward, TGGGTACGCAGGGTCTTC; reverse, AGCAGGCTCCCGGTCCCTTCC TAG). For subsequent recloning into vector, the product obtained with the first primer set was digested with BsaI and NsiI endonucleases. The product obtained with the second set of primers was digested with only NsiI. The 5' end of this subunit was amplified from 5'-RACE-Ready cDNA (Clontech) using Anchor Primer supplied with the kit (CTGGTTCGGCCCACCTCTGAAGGTTCCAGAATCGATAG) and specific 5' reverse primer (GCCACGGGTCGGGACCAC). The 5'-end PCR fragment was digested with ClaI and BsaI restrictions enzymes. All PCR fragments were purified by agarose gel electrophoresis using the Geneclean II kit (BIO 101, Vista, CA). The PCR products were ligated together via BsaI and NsiI sites and cloned into the Cla I and EcoRV blunt end sites of the pBluescript II SK(-) phagemid. The construct was sequenced according to the Sanger method (Sequenase Version 2.0 DNA Sequencing Kit; United States Biochemicals, Cleveland, Ohio) to verify the published sequence of the human alpha 4 AChR subunit (Gopalakrishnan et al., 1996).

In vitro transcription, oocyte isolation and cRNA injection. cDNAs encoding the human alpha 4 and alpha 7 subunits were cloned into a modified SP64T expression vector, alpha 3 and beta 4 in pcDNAI vector, and alpha 5 and beta 2 in pSP64A vector, using standard DNA cloning procedures (Melton et al., 1984). cRNA was synthesized in vitro using the Megascript kit (Ambion, Austin, TX).

Oocytes were obtained from X. laevis (Xenopus I, Ann Arbor, MI). The oocytes were surgically removed and placed in oocyte physiological saline containing 96 mM NaCl, 2 mM KCl, 1.8 mM CaCl2, 1 mM MgCl2 and 10 mM HEPES, pH 7.5, to which was added 50 units/ml penicillin and 50 µg/ml streptomycin. Oocytes were dispersed in this buffer minus Ca++, containing 2 mg/ml collagenase A (Sigma Chemical, St. Louis, MO) for 2 hr.

Stage V-VI oocytes were selected and injected with combinations of alpha 4beta 2, alpha 3beta 2 beta 4alpha 5, and alpha 7 subunit cRNAs (equal weights of 5-12 ng of each subunit per AChR subtype in a total volume of 55 nl). After injections, oocytes were maintained under semisterile conditions at 18°C in Liebovitz L-15 medium (Life Technologies, Grand Island, NY) diluted by half in 10 mM HEPES buffer, pH 7.5.

Purification and immunoabsorption of AChRs from oocytes and solid-phase radioimmunoassays. The purification and immunoabsorption of AChRs from X. laevis oocytes as well as solid-phase radioimmunoassays were used to compare the relative amounts of AChR subunits expressed in oocytes injected with equal amounts of alpha 3, beta 2, beta 4 and alpha 5 subunit cRNAs. The procedures for these experiments were as previously described (Peng et al., 1994).

Nicotine treatment and electrophysiological recordings. Currents were measured using a standard two-microelectrode voltage-clamp amplifier (Oocyte Clamp OC-725; Warner Instrument Corp., Hamden, CT) as previously described (Gerzanich et al., 1995). All recordings were digitized using MacLab software and hardware (AD Instruments, Castle Hill, Australia) and stored on an Apple Macintosh IIcx computer. Data were analyzed using KALEIDAGRAPH (Synergy Software, Reading, PA).

The recording chamber was continually perfused at a flow rate of 10 ml/min with the physiological saline solution containing 0.5 µM atropine. Application of the agonists was performed using a set of eight glass tubes to provide rapid application as previously described (Gerzanich et al., 1995). In all cases, 100 µM ACh was used to evoke responses. ACh was used rather than nicotine to mimic physiological conditions. The concentration of 100 µM was chosen because it is higher than the EC50 values of all of the three AChR subtypes yet low enough that a comparable repeat response could be obtained within 4 to 6 min after the first ACh application.

For nicotine incubations of <60 min, the oocytes remained in the recording chamber after the initial peak current recording. They were perfused with saline solution containing the appropriate concentration of nicotine. For incubations of 60 min to 48 hr, the oocytes were removed from the chamber and incubated in a separate well with 50% L-15 medium and 10 mM HEPES buffer (pH 7.5), also containing the appropriate concentration of nicotine. At various times, the oocytes were removed from the wells and returned to the chamber for responses to be measured.

    Results
Top
Abstract
Introduction
Methods
Results
Discussion
References

Acute activation by nicotine. For each AChR type, the concentration-response curves for activation by nicotine and ACh were compared, as shown in figure 1. Table 1 summarizes some of the pharmacological properties of alpha 4beta 2, alpha 3 and alpha 7 AChRs.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1.   Concentration dependence of acute activation of human AChR subtypes expressed in X. laevis oocytes. Oocytes were exposed to consecutive, increasing concentrations of nicotine for 2 to 4 sec while continuously perfusing the recording chamber with saline. Left, inward currents for some representative concentrations; right, concentration-response curves. Concentration-response curves were fitted using a modified Hill equation. Each point represents responses from 4 to 6 oocytes clamped at -70 mV for alpha 4beta 2 AChR and -50 mV for both alpha 3 AChRs and alpha 7 AChRs. Peak current responses for each concentration were determined.


                              
View this table:
[in this window]
[in a new window]
 
TABLE 1
Activation, inactivation, equilibrium binding and upregulation of human AChRs by nicotine

alpha 4beta 2 AChRs were activated by the lowest concentrations of nicotine of the three subtypes investigated. The concentration of nicotine that produced the half-maximal activation (EC50) was 0.30 ± 0.04 µM. This value is particularly significant because it is close to the 0.2 µM steady-state concentration of nicotine typical of the serum of smokers (Benowitz et al., 1990). Nicotine was a full agonist compared with ACh.

Injection of equal amounts of cRNA for alpha 3, beta 2, beta 4 and alpha 5 subunits to model autonomic neurons and characterized neuroblastoma cell lines (Conroy and Berg, 1995; Lukas et al., 1993; Peng et al., 1993; Wang et al., 1996) resulted in the expression of a mixture of alpha 3 AChRs. These alpha 3 AChRs had an EC50 for activation by nicotine of 3.0 ± 0.3 µM, indicating a 10-fold lower sensitivity to nicotine than that exhibited by alpha 4beta 2 AChRs. The maximal current elicited by a saturating concentration of nicotine was approximately half of that elicited by ACh. Previously, we showed that nicotine is a partial agonist for human alpha 3beta 2alpha 5 AChRs but a full agonist for human alpha 3beta 4alpha 5 AChRs (Wang et al., 1996). Thus, in a mixture of these two subtypes, nicotine should behave as a partial agonist. Immunoisolation from oocytes injected with equal amounts of alpha 3, beta 2, beta 4 and alpha 5 AChR subunits showed that 55% of the AChRs expressed contained the beta 4 subunit, whereas 35% contained the beta 2 subunit (fig. 2). The sum of alpha 3 AChRs containing beta 2 subunits with those containing beta 4 subunits accounts for the total, indicating that few contain both beta 2 and beta 4 subunits. As shown in detail previously (Wang et al., 1996), under those conditions all of the 3H-epibatidine-labeled AChRs immunoisolated contain alpha 3 subunits and >60% contain alpha 5 subunits. These results imply that with this mixture of alpha 3, beta 2, beta 4 and alpha 5 cRNAs in X. laevis oocytes, most of the alpha 3 AChRs consist of either alpha 3beta 2alpha 5 or alpha 3beta 4alpha 5 AChRs but not alpha 3beta 2beta 4alpha 5 AChRs.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 2.   Relative amounts of AChR subunits expressed by injection of equal amounts of alpha 3, beta 2, beta 4 and alpha 5 cRNAs. Equal amounts (10 ng) of each subunit cRNA were injected into oocytes. After 3 days, the AChRs were solubilized using Triton X-100. After immunoisolation using large excesses of specific monoclonal antibodies for alpha 3 and alpha 5 subunits (mAb 210), beta 2 subunit (mAb 290), mouse antiserum to bacterially expressed human beta 4 or a combination of antibodies to both beta 2 and beta 4 subunits, the relative amounts of isolated AChRs were determined using 3H-epibatidine binding.

The alpha 7 AChRs have the lowest sensitivity to nicotine of the three subtypes investigated. The alpha 7 homomers have been shown to have an EC50 for activation by nicotine of 40 ± 2 µM (Peng et al., 1993). Nicotine was a full agonist. The responses of alpha 7 homomers desensitize much faster than those of the other two AChRs subtypes. This is a characteristic property of alpha 7 AChRs (Couturier et al., 1990; Peng et al., 1993; Seguela, 1993).

Long-term inhibition by nicotine. To determine the effects of long-term exposure to nicotine, oocytes were incubated for 48 hr in various concentrations of nicotine. Then, responses from the oocytes were tested using 100 µM ACh as agonist in a perfusing solution that also contained nicotine at the concentration used for incubation. Figure 3 compares the nicotine concentration dependence of chronic inhibition with that for acute activation.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3.   Comparison of nicotine concentration dependence of chronic desensitization and acute activation. Activation concentration-response curves are the same as in figure 1. For nicotine inhibition, control responses were elicited 3 days after oocyte injection, and oocytes were then incubated for 48 hr at 18°C in concentrations of nicotine varying from 0 to 10 µM. Then, responses were again evoked with 100 µM ACh from each oocyte. The perfusion solution contained nicotine at a concentration equal to the one used for preincubation. Each point represents responses obtained from 4 to 8 oocytes. Current responses were normalized to the maximum response on that day for oocytes not incubated in nicotine.

The alpha 7 AChRs were the most sensitive of the three AChR subtypes investigated to inhibition by chronic exposure to nicotine. Complete attenuation of response was obtained for concentrations of nicotine of >0.2 µM. The IC50 value for nicotine-induced loss of response was 2.8 ± 0.41 nM.

alpha 4beta 2 AChRs also decreased their response to a saturating concentration of ACh after incubation with nanomolar concentrations of nicotine. A total loss of response to ACh occurred after incubation with nicotine concentrations of >2 µM. The IC50 value for nicotine-induced loss of responsiveness was 17 ± 3.1 nM.

In contrast, for alpha 3 AChRs responses to ACh were not completely inhibited even after incubation with 10 µM nicotine. The IC50 value for nicotine-induced loss of responsiveness in this case was 870 ± 330 nM.

Time course of nicotine-induced inhibition. Initial control currents were evoked with 100 µM ACh 3 days after injection of cRNA. After incubation of the oocytes in 0.2 µM nicotine, the responses to 100 µM ACh were determined initially in 0.2 µM nicotine and again after a 1-hr rinse in nicotine-free saline to permit recovery from reversible desensitization. At each time point, responses were compared with those of control oocytes that were incubated without nicotine. At all prolonged times of incubation in nicotine, ACh-evoked responses were decreased with respect to control oocytes. Results from these experiments are shown in figure 4.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 4.   Time course of nicotine-induced functional inactivation. Three days after injection of cRNA, initial control currents were evoked with 100 µM ACh. The oocytes were then incubated for various times in 0.2 µM nicotine. Test responses were measured immediately after incubation in nicotine and again after 1 hr of washout. Currents obtained for both inhibition and recovery were normalized to those of oocytes incubated without nicotine. Each bar represents the mean of responses obtained from 3 to 5 oocytes.

The alpha 4beta 2 AChRs exposed to 0.2 µM nicotine lost their response to 100 µM ACh rapidly on prolonged exposure. After 10 sec in nicotine, the response to 100 µM ACh was reduced only 10%, and this reduction was completely reversed within 1 hr after removal of the nicotine. However, after 100 sec in nicotine, the response decreased 50%, and even after 1 hr of rinsing, 30% of the alpha 4beta 2 AChRs appeared to be permanently inactivated. After 2.8 hr in 0.2 µM nicotine, essentially all of the alpha 4beta 2 AChRs were desensitized to a state that required >1 hr to recover from and were presumed to be permanently inactivated.

In the case of alpha 7 AChRs, the response to ACh decreased by 50% within the first 100 sec of nicotine exposure. About 90% inhibition occurred within 3 hr. This occurred despite the fact that the nicotine concentration used was 35 times less than the EC50 value for activation of alpha 7 AChRs by nicotine. At any incubation time in nicotine longer than 10 sec, the extent of recovery of the response to ACh after washing was very small.

In contrast, alpha 3 AChRs were relatively unaffected by prolonged exposure to 0.2 µM nicotine. After 28 hr, the response was less than the control value by only 25%. Furthermore, these AChRs exhibited almost full recovery within 1 hr, even after a 28-hr incubation in nicotine. The inactivation caused by 3 hr in 0.2 µM nicotine was determined with each of the four alpha 3 AChR subtypes (fig. 5). The alpha 3 AChRs containing beta 2 subunits were inhibited ~50%, whereas alpha 3 AChRs containing beta 4 subunits were not inhibited. This indicated that the 25% inhibition observed for the alpha 3beta 2beta 4alpha 5 mixture (fig. 4) resulted from the beta 2-containing AChRs in the mixture.


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 5.   Nicotine-induced inactivation of separate alpha 3 AChR subtypes. Recordings were performed after 3-hr incubation in 0.2 µM nicotine. Each bar represents the mean of the responses to 100 µM ACh normalized to the initial responses before incubation (n = 7 for each).

Time course of recovery after long-term incubation in nicotine. We also considered the time course of recovery of response after a 28-hr incubation in 0.2 µM nicotine, as shown in figure 6. At this point, 72 hr had elapsed since the oocytes were injected with cRNA, and their ability to synthesize new AChRs was probably substantially reduced due to decay of this cRNA. The limited recoveries observed after prolonged washing suggest that in these oocytes, most of the desensitization observed after 24-hr incubation reflects permanent inactivation and there was little synthesis of new AChRs.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 6.   Time course of recovery from functional inactivation after 24-hr incubation in nicotine. Injected oocytes were incubated in 0.2 µM nicotine at 18°C for 24 hr after control responses were obtained with 100 µM ACh. At the end of the 24-hr period, responses were tested again. After this, oocytes were incubated in saline, and the recovery from inactivation was recorded at various times for up to 24 hr. Responses obtained in the oocytes after incubation in nicotine were normalized to averaged control responses from oocytes (n = 6) incubated in nicotine-free medium. Each response shown represents recordings from 3 to 6 oocytes.

The alpha 7 AChRs exhibited little recovery of response to 100 µM ACh after a 28-hr incubation in 0.2 µM nicotine, despite 24 hr of washing.

The alpha 4beta 2 AChRs were also substantially irreversibly inhibited by a 28-hr incubation in 0.2 µM nicotine. These AChRs were inhibited to ~10% of the control response. This response recovered to as much as 40% of the control response within 6 hr, but then the responses began to decrease, possibly reflecting AChR turnover in the absence of new synthesis.

By contrast, alpha 3 AChRs were inhibited by only 25% after 28 hr in 0.2 µM nicotine, and the results show a recovery rate of >95% within 1 hr after washout.

    Discussion
Top
Abstract
Introduction
Methods
Results
Discussion
References

We found that prolonged exposure to nicotine affects three major human neuronal nicotinic AChR subtypes differently; alpha 4beta 2 AChRs and alpha 7 AChRs were substantially inactivated by prolonged exposure to nicotine, but alpha 3 AChR subtypes were not.

The alpha 4beta 2 AChRs exhibited the highest sensitivity for acute activation by nicotine (EC50 = 300 nM) and, correspondingly, were efficiently desensitized by 48-hr incubation in low concentrations of nicotine. The much lower concentrations of nicotine required for chronic inactivation than acute activation presumably reflect the gradual accumulation of AChRs in a high affinity desensitized conformation, which can occur without necessarily gating the AChRs. After 3 hr in 0.2 µM nicotine, the response of alpha 4beta 2 AChRs to a saturating concentration of ACh was virtually eliminated, and it recovered negligibly after washing for 1 hr, suggesting that irreversible desensitization had occurred. Hsu et al. (1996a) agree that chronic exposure to nM concentrations of nicotine inhibits the response of alpha 4beta 2 AChRs but not alpha 3beta 2 AChRs and that micromolar concentrations of nicotine eliminate the response of alpha 4beta 2 AChRs. Differences in species and methods make quantitative comparisons with their IC50 values difficult. We incubated with nicotine for 48 hr starting 48 hr after injection of oocytes with human alpha 4beta 2 cRNAs and found that 17 nM nicotine caused a 50% reduction in the response to 100 µM ACh compared with untreated oocytes. They reported that after incubation with nicotine for 48 hr starting 48 hr after injection with rat alpha 4beta 2 cRNAs, 0.11 nM nicotine caused a 50% reduction in the response to 0.7 µM nicotine compared with the initial responses of these oocytes. Their reported IC50 value changed to 1.9 nM if the oocytes were incubated with nicotine starting 24 hr after cRNA injection.

Oocytes injected with equal amounts of cRNAs for alpha 3, beta 2, beta 4 and alpha 5 subunits to model the mix of alpha 3 AChRs found in chick ciliary ganglia (Conroy and Berg, 1995) and several rat or human neuroblastoma cell lines (Lukas et al., 1993; Wang et al., 1996) were found to express a mixture of beta 2 and beta 4 subunit-containing alpha 3 AChRs rather than a homogeneous population of AChRs containing all four subunits. The alpha 3 AChRs exhibited 10-fold lower sensitivity for acute activation by nicotine and were 50-fold less efficiently desensitized by 48-hr incubation in low concentrations of nicotine (IC50 = 870 nM) than were alpha 4beta 2 AChRs. In the presence of 0.2 µM nicotine, alpha 3beta 2 AChRs and alpha 3beta 2alpha 5 AChRs were inhibited by ~50% in their response to 100 µM ACh, whereas alpha 3beta 4 AChRs and alpha 3beta 4alpha 5 AChRs were not significantly inhibited. This probably reflects the higher sensitivity for activation by nicotine for alpha 3beta 2 AChRs (EC50 = 6.8 µM) and alpha 3beta 2alpha 5 AChRs (EC50 = 1.9 µM) than for alpha 3beta 4 AChRs (EC50 = 106 µM) and alpha 3beta 4alpha 5 AChRs (EC50 = 105 µM) (27). Even after 3 hr in 0.2 µM nicotine, the response of alpha 3 AChRs to a saturating concentration of ACh recovered completely after 1 hr of washing, in contrast with the almost total loss of alpha 4beta 2 AChR response.

The alpha 7 AChRs exhibited the lowest sensitivity for acute activation by nicotine of the three subtypes (EC50 = 40,000 nM), 13-fold lower than alpha 3 AChRs and 133-fold lower than alpha 4beta 2 AChRs. However, alpha 7 AChRs were the most sensitive of the three subtypes to inactivation by 48-hr incubation in low concentrations of nicotine (IC50 = 2.8 nM), probably reflecting the rapid desensitization characteristic of alpha 7 AChRs (Alkondon and Albuquerque, 1993; Couturier et al., 1990; Gerzanich et al., 1994, 1995; Lindstrom, 1996; Peng et al., 1993; Seguela et al., 1993). The alpha 7 AChRs were 6-fold more sensitive than alpha 4beta 2 AChRs and 310-fold more sensitive than alpha 3 AChRs.

EC50 values for activation by ACh and nicotine of cloned human alpha 4beta 2 AChRs and alpha 7 AChRs determined here using a set of glass tubes to ensure rapid application agree well with values obtained for these cloned AChRs by others using a millisecond-resolution multibarrel puffer technique on transfected cells (Buisson et al., 1996; Gopalakrishnan et al., 1995).

Irreversible inactivation may be related to AChR up-regulation, which is another phenomenon associated with chronic exposure of nicotinic AChRs to nicotine. Previously, we showed that the upregulation of alpha 4beta 2 AChRs occurs due to a decrease in AChR turnover that could be associated with a change in AChR conformation not associated with channel opening (Peng et al., 1994). It is not clear whether this conformation is identical to a reversibly desensitized or an irreversibly inactivated conformation. It is clear that despite an increase in the number of AChRs as a result of chronic exposure to nicotine, there is a net decrease in function of alpha 4beta 2 AChRs and alpha 7 AChRs. Recent findings also show that sustained exposure of alpha 4beta 2 AChRs to nicotine increases the phosphorylation of the alpha 4 subunit (Hsu et al., 1996b; Molinari et al., 1996). Further investigations of this mechanism may lead to a clearer picture of the relationship between the AChR conformations and post-translational modifications associated with up-regulation and those associated with functional inactivation.

The tolerance to increased nicotine doses that is characteristic of tobacco users (Benowitz, 1996; Collins and Marks, 1996; Dani and Heinemann, 1996) can be explained by the net decreases in alpha 4beta 2 AChR and alpha 7 AChR function that we have observed after chronic exposure to nicotine. These decreases in function occur despite an increase in the amount, especially of alpha 4beta 2 AChRs, induced by chronic exposure to nicotine (Peng et al., 1994, 1997). Permanent inactivation of alpha 4 or beta 7 AChRs coupled with a slow rate of resynthesis may account for the weeks of benefit reported for Tourette's syndrome patients treated for only 2 days with transdermal nicotine patches (Dursun et al., 1994). A particularly good example of nicotine acting in vivo as a time-averaged antagonist is the effect of nicotine on prolactin release in the rat (Hulihan-Giblin et al., 1990a, 1990b; Sharp and Beyer, 1986). A single intravenous injection of nicotine causes an increase in serum prolactin concentration as a result of activating AChRs in the hypothalamus. This response desensitizes rapidly and for a long duration, resulting in little or no response 1 or 6 hr later. Chronic treatment with nicotine by injections twice a day for 10 days prevented any acute response to nicotine despite provoking an increase in hypothalamic [3H]ACh binding sites. After this chronic nicotine treatment, 8 to 14 days were required for the response to acute nicotine treatment and the amount of AChR to return to normal, presumably as a result of turnover of permanently inactivated AChRs.

Gene knockout experiments also suggest that it is reasonable to think that chronic exposure to nicotine in tobacco users could be associated with the net loss of alpha 4beta 2 AChR and alpha 7 AChR function but not great neurological impairment. Knockout of the beta 2 subunit gene in mice eliminates the high affinity binding of nicotine in the brain that would be expected from the loss of alpha 4beta 2 AChRs (Picciotto et al., 1995). Knockout of the alpha 7 subunit gene in mice eliminates the high-affinity binding of alpha -bungarotoxin in brain that would be expected from alpha 7 AChRs (Orr-Urtreger et al., 1996). In neither case do these knockout mice exhibit gross behavioral or anatomic anomalies.

In a chronic smoker with a typical serum concentration of nicotine of 0.2 µM (Benowitz et al., 1990), virtually all alpha 4beta 2 AChRs would be inactivated, as would 90% of their alpha 7 AChRs, but only 20% of their alpha 3 AChRs would be inactivated, and only these could quickly recover as the serum nicotine concentration dropped after a few hours without smoking. Thus, the behavioral effects and reward of smoking are likely to depend on the inactivation of alpha 4alpha 2 AChRs and alpha 7 AChRs while leaving alpha 3 AChRs available to respond to the micromolar boluses of nicotine available quickly after inhalation of smoke (Benowitz, 1996). The first cigarette of the morning is generally regarded as the most rewarding (Benowitz, 1996), which might result either from increased sensitivity or resynthesis of alpha 4beta 2 AChRs and alpha 7 AChRs after overnight abstinence or as a relief from withdrawal symptoms as these two AChR subtypes are quickly returned to their chronically inactivated states. Neuronal synaptic mechanisms can be complex. In ciliary ganglia, postsynaptic alpha 3 AChRs combine with perisynaptic alpha 7 AChRs to contribute to a high safety factor for neurotransmission, and neurotransmission can occur even if the alpha 7 AChRs are blocked with alpha -bungarotoxin (Zhang et al., 1996). At this type of synapse, the alpha 7 AChR component of the postsynaptic current would be blocked by the chronic presence of nicotine, but transmission could still occur through alpha 3 AChRs.

The alpha 4 (Wada et al., 1989) and alpha 7 AChRs (Cimino et al., 1992; Del Toro et al., 1994; Seguela et al., 1993) are expressed in many areas of the brain, whereas alpha 3 AChRs can be found mostly in the peripheral nervous system (McGehee and Role, 1995; Orr-Urtreger et al., 1996; Wada et al., 1989; Whiting et al., 1991). In the brain, alpha 3 AChRs have been thought to be localized to areas known to be directly involved in the reward mechanisms of drug abuse, including the locus ceruleus, ventral tegmental area and substantia nigra (Wada et al., 1989). Recent evidence, however, suggests that many of the dopamine-containing regions of the brain associated with addiction or Parkinson's disease may in fact contain alpha 6 rather than alpha 3 (LeNovere et al., 1996). The alpha 6 subunits are closely related to alpha 3 subunits in sequence. Their ability to function as parts of AChRs has only recently been demonstrated (Gerzanich et al., 1997). The alpha 6beta 4 AChRs were found to differ pharmacologically from alpha 3beta 4 AChRs, with nicotine behaving as an 18% partial agonist with a prolonged inhibitory effect. Therefore, investigations of the acute and chronic effects of nicotine on alpha 6 AChRs will be important in the future. It remains to be determined which AChR subtypes are associated with particular components of the behavioral responses to chronic exposure to nicotine and how these AChR subtypes act by presynaptic and postsynaptic mechanisms in various circuits to produce these behavioral effects.

    Acknowledgments

We thank Drs. Mark Nelson and Gregg Wells for useful comments on the manuscript.

    Footnotes

Accepted for publication July 25, 1997.

Received for publication May 30, 1997.

1   This work was supported by grants to J.L. from the National Institutes of Health, The Smokeless Tobacco Research Council and the Muscular Dystrophy Association.

2   These two authors contributed equally to this work.

Send reprint requests to: Dr. Jon Lindstrom, Department of Neuroscience, 217 Stemmler Hall, University of Pennsylvania Medical School, Philadelphia, PA 19104-6074.

    Abbreviations

ACh, acetylcholine; AChR, acetylcholine receptor.

    References
Top
Abstract
Introduction
Methods
Results
Discussion
References


0022-3565/97/2832-0675$03.00/0
THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS
Copyright © 1997 by The American Society for Pharmacology and Experimental Therapeutics



This article has been cited by other articles:


Home page
J. Appl. Physiol.Home page
A. A. Steiner, D. L. Oliveira, J. L. Roberts, S. R. Petersen, and A. A. Romanovsky
Nicotine administration and withdrawal affect survival in systemic inflammation models
J Appl Physiol, October 1, 2008; 105(4): 1028 - 1034.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. R. Laviolette, N. M. Lauzon, S. F. Bishop, N. Sun, and H. Tan
Dopamine Signaling through D1-Like versus D2-Like Receptors in the Nucleus Accumbens Core versus Shell Differentially Modulates Nicotine Reward Sensitivity
J. Neurosci., August 6, 2008; 28(32): 8025 - 8033.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
J. Arredondo, A. I. Chernyavsky, D. L. Jolkovsky, K. E. Pinkerton, and S. A. Grando
Receptor-mediated tobacco toxicity: acceleration of sequential expression of {alpha}5 and {alpha}7 nicotinic receptor subunits in oral keratinocytes exposed to cigarette smoke
FASEB J, May 1, 2008; 22(5): 1356 - 1368.
[Abstract] [Full Text] [PDF]


Home page
JNMHome page
M. Mamede, K. Ishizu, M. Ueda, T. Mukai, Y. Iida, H. Kawashima, H. Fukuyama, K. Togashi, and H. Saji
Temporal Change in Human Nicotinic Acetylcholine Receptor After Smoking Cessation: 5IA SPECT Study
J. Nucl. Med., November 1, 2007; 48(11): 1829 - 1835.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
C. A. Briggs, E. J. Gubbins, M. J. Marks, C. B. Putman, R. Thimmapaya, M. D. Meyer, and C. S. Surowy
Untranslated Region-Dependent Exclusive Expression of High-Sensitivity Subforms of {alpha}4beta2 and {alpha}3beta2 Nicotinic Acetylcholine Receptors
Mol. Pharmacol., July 1, 2006; 70(1): 227 - 240.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J.-M. Tournier, K. Maouche, C. Coraux, J.-M. Zahm, I. Cloez-Tayarani, B. Nawrocki-Raby, A. Bonnomet, H. Burlet, F. Lebargy, M. Polette, et al.
{alpha}3{alpha}5{beta}2-Nicotinic Acetylcholine Receptor Contributes to the Wound Repair of the Respiratory Epithelium by Modulating Intracellular Calcium in Migrating Cells
Am. J. Pathol., January 1, 2006; 168(1): 55 - 68.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
A. Kuryatov, J. Luo, J. Cooper, and J. Lindstrom
Nicotine Acts as a Pharmacological Chaperone to Up-Regulate Human {alpha}4{beta}2 Acetylcholine Receptors
Mol. Pharmacol., December 1, 2005; 68(6): 1839 - 1851.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
Y.-H. Jo, D. Wiedl, and L. W. Role
Cholinergic Modulation of Appetite-Related Synapses in Mouse Lateral Hypothalamic Slice
J. Neurosci., November 30, 2005; 25(48): 11133 - 11144.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. A. Davis, J. R. James, S. J. Siegel, and T. J. Gould
Withdrawal from Chronic Nicotine Administration Impairs Contextual Fear Conditioning in C57BL/6 Mice
J. Neurosci., September 21, 2005; 25(38): 8708 - 8713.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. R. Reynolds and J. R. Hoidal
Temporal-Spatial Expression and Transcriptional Regulation of {alpha}7 Nicotinic Acetylcholine Receptor by Thyroid Transcription Factor-1 and Early Growth Response Factor-1 during Murine Lung Development
J. Biol. Chem., September 16, 2005; 280(37): 32548 - 32554.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
R. B. Free, S. B. McKay, P. D. Gottlieb, R. T. Boyd, and D. B. McKay
Expression of Native {alpha}3{beta}4* Neuronal Nicotinic Receptors: Binding and Functional Studies Investigating Turnover of Surface and Intracellular Receptor Populations
Mol. Pharmacol., June 1, 2005; 67(6): 2040 - 2048.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
K. K. Rau, R. D. Johnson, and B. Y. Cooper
Nicotinic AChR in Subclassified Capsaicin-Sensitive and -Insensitive Nociceptors of the Rat DRG
J Neurophysiol, March 1, 2005; 93(3): 1358 - 1371.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. J. Proskocil, H. S. Sekhon, Y. Jia, V. Savchenko, R. D. Blakely, J. Lindstrom, and E. R. Spindel
Acetylcholine Is an Autocrine or Paracrine Hormone Synthesized and Secreted by Airway Bronchial Epithelial Cells
Endocrinology, May 1, 2004; 145(5): 2498 - 2506.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
H. N. Nguyen, B. A. Rasmussen, and D. C. Perry
Subtype-Selective Up-Regulation by Chronic Nicotine of High-Affinity Nicotinic Receptors in Rat Brain Demonstrated by Receptor Autoradiography
J. Pharmacol. Exp. Ther., December 1, 2003; 307(3): 1090 - 1097.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. R. A. Wooltorton, V. I. Pidoplichko, R. S. Broide, and J. A. Dani
Differential Desensitization and Distribution of Nicotinic Acetylcholine Receptor Subtypes in Midbrain Dopamine Areas
J. Neurosci., April 15, 2003; 23(8): 3176 - 3185.
[Abstract] [Full Text] [PDF]


Home page
QJMHome page
C.E. Richardson, J.M. Morgan, B. Jasani, J.T. Green, J. Rhodes, G.T. Williams, J. Lindstrom, S. Wonnacott, S. Peel, and G.A.O. Thomas
Effect of smoking and transdermal nicotine on colonic nicotinic acetylcholine receptors in ulcerative colitis
QJM, January 1, 2003; 96(1): 57 - 65.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
C. L. Gentry, L. H. Wilkins Jr., and R. J. Lukas
Effects of Prolonged Nicotinic Ligand Exposure on Function of Heterologously Expressed, Human alpha 4beta 2- and alpha 4beta 4-Nicotinic Acetylcholine Receptors
J. Pharmacol. Exp. Ther., January 1, 2003; 304(1): 206 - 216.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
R. Rush, A. Kuryatov, M. E. Nelson, and J. Lindstrom
First and Second Transmembrane Segments of alpha 3, alpha 4, beta 2, and beta 4 Nicotinic Acetylcholine Receptor Subunits Influence the Efficacy and Potency of Nicotine
Mol. Pharmacol., June 1, 2002; 61(6): 1416 - 1422.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. L. Meyer, L. C. Gahring, and S. W. Rogers
Nicotine Preconditioning Antagonizes Activity-dependent Caspase Proteolysis of a Glutamate Receptor
J. Biol. Chem., March 22, 2002; 277(13): 10869 - 10875.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
H. S. Sekhon, J. A. Keller, B. J. Proskocil, E. L. Martin, and E. R. Spindel
Maternal Nicotine Exposure Upregulates Collagen Gene Expression in Fetal Monkey Lung . Association with alpha 7 Nicotinic Acetylcholine Receptors
Am. J. Respir. Cell Mol. Biol., January 1, 2002; 26(1): 31 - 41.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
R. Girod and L. W. Role
Long-Lasting Enhancement of Glutamatergic Synaptic Transmission by Acetylcholine Contrasts with Response Adaptation after Exposure to Low-Level Nicotine
J. Neurosci., July 15, 2001; 21(14): 5182 - 5190.
[Abstract] [Full Text] [PDF]


Home page
Alcohol AlcoholHome page
Y. Tizabi, B. Getachew, M. Davila-Garcia, and R. E. Taylor
Alcohol preference: association with reduced striatal nicotinic receptors
Alcohol Alcohol., July 1, 2001; 36(4): 318 - 322.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
A. Köfalvi, B. Sperlágh, T. Zelles, and E. S. Vizi
Long-Lasting Facilitation of 4-Amino-n-[2,3-3H]butyric Acid ([3H]GABA) Release from Rat Hippocampal Slices by Nicotinic Receptor Activation
J. Pharmacol. Exp. Ther., November 1, 2000; 295(2): 453 - 462.
[Abstract] [Full Text]


Home page
J. Pharmacol. Exp. Ther.Home page
M. Ferreira, A. Singh, K. L. Dretchen, K. J. Kellar, and R. A. Gillis
Brainstem Nicotinic Receptor Subtypes That Influence Intragastric and Arterial Blood Pressures
J. Pharmacol. Exp. Ther., July 1, 2000; 294(1): 230 - 238.
[Abstract] [Full Text]


Home page
J. Pharmacol. Exp. Ther.Home page
D. C. Perry, M. I. Dávila-García, C. A. Stockmeier, and K. J. Kellar
Increased Nicotinic Receptors in Brains from Smokers: Membrane Binding and Autoradiography Studies
J. Pharmacol. Exp. Ther., June 1, 1999; 289(3): 1545 - 1552.
[Abstract] [Full Text]


Home page
J. Neurosci.Home page
A. L. Obaid, T. Koyano, J. Lindstrom, T. Sakai, and B. M. Salzberg
Spatiotemporal Patterns of Activity in an Intact Mammalian Network with Single-Cell Resolution: Optical Studies of Nicotinic Activity in an Enteric Plexus
J. Neurosci., April 15, 1999; 19(8): 3073 - 3093.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
Y. Fu, S. G. Matta, and B. M. Sharp
Local alpha -Bungarotoxin-Sensitive Nicotinic Receptors Modulate Hippocampal Norepinephrine Release by Systemic Nicotine
J. Pharmacol. Exp. Ther., April 1, 1999; 289(1): 133 - 139.
[Abstract] [Full Text]


Home page
Mol. Pharmacol.Home page
A. D. J. Maus, E. F. R. Pereira, P. I. Karachunski, R. M. Horton, D. Navaneetham, K. Macklin, W. S. Cortes, E. X. Albuquerque, and B. M. Conti-Fine
Human and Rodent Bronchial Epithelial Cells Express Functional Nicotinic Acetylcholine Receptors
Mol. Pharmacol., November 1, 1998; 54(5): 779 - 788.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
F. Wang, M. E. Nelson, A. Kuryatov, F. Olale, J. Cooper, K. Keyser, and J. Lindstrom
Chronic Nicotine Treatment Up-regulates Human alpha 3beta 2 but Not alpha 3beta 4 Acetylcholine Receptors Stably Transfected in Human Embryonic Kidney Cells
J. Biol. Chem., October 30, 1998; 273(44): 28721 - 28732.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Olale, F.
Right arrow Articles by Lindstrom, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Olale, F.
Right arrow Articles by Lindstrom, J.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*NICOTINE
*NICOTINE TARTRATE


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition