Introduction

Top Abstract Introduction Methods Results Discussion References

Chronic hypertension is associated with structural changes of the vasculature (Owens, 1985, 1987; Scott-Burden et al., 1992). These changes, either secondary or not to the hypertensive stimulus, contribute to the increase and maintenance of the enhanced vascular resistance (Hollander, 1976; Ross and Glomset, 1973; McBride et al. 1988; Fisman et al. 1975).

It is well known that AII plays an important role in the pathogenesis of hypertension (Sreeten et al., 1975; Rebuffat et al., 1979). At the cellular level, AII induces hypertrophy, hyperplasia and changes in phenotype of VSMC (Owens, 1989; Chamley-Campbell et al., 1979). These effects are suggested to be mediated mainly via the AT1 receptor (Chiu et al., 1989; Whitebread et al., 1989; Viswanathan et al., 1991; Hahn et al., 1993a). AT1 antagonists so far tested have significant hemodynamic effects in vivo. Therefore it is difficult to distinguish between direct AT1-mediated effects on the VSMC or indirect effects triggered via mechanical factors (Owens and Reidy, 1985; Bevan, 1976). The in vitro effect of AII is observed by change in phenotype (Wissler, 1968; Campbell et al., 1988; Stadler et al., 1989), increase in cell volume (Berk et al., 1989; Millet et al., 1992) and/or cell growth (Scott-Burden et al., 1988; Geisterfer et al., 1988), as well as a change in ECM production by aortic smooth muscle cells (Scott-Burden et al., 1989, 1990; Kato et al., 1991; Hahn et al., 1993b), which suggests a direct effect of the peptide on VSMC. These in vitro effects, however, were only demonstrated in the presence of nonphysiological concentrations of AII (10⁷ M and above) and most often in the presence of serum or various growth factors.

FN, an important component of the ECM exists in several forms as a result of the alternative splicing of a single gene. The different isoforms are distinguished by the presence or absence of exon products and are designated in the rat as EIIIA, EIIIB and V (Schwarzbauer et al., 1987). Changes in FN biosynthesis by VSMC may have a causative role in hypertension and atherosclerosis (Takasaki et al., 1991). Indeed a selective and rapid induction of the isoform containing the EIIIA insert has been shown to occur during development of hypertrophy of both aorta and heart in response to hypertension (Takasaki et al., 1992; Mamuya and Brecher, 1992; Mamuya et al., 1992). The pressure overload induced in 25-day-old rats by stenosis of the thoracic aorta also led to a reexpression of fetal gene transcripts (FN-EIIIA⁺, FN-EIIIB⁺) during the process of cardiac hypertrophy (Samuel et al., 1991). Additionally, continuous infusion of AII induced FN expression associated with cardiac fibrosis in the rat (Crawford et al., 1994). AII also induced an increase in the alternatively spliced form of FN (EIIIA) in isolated aortic rings (Hosoi et al., 1993). FN synthesis and release in culture medium by VSMC has also been observed after AII stimulation (Hahn et al., 1993b).

The aim of this study was first to determine the direct trophic effect of AII on VSMC as indicated by increase in cell volume, protein synthesis, FN release and FN-EIIIA⁺ expression and, second, to analyze the inhibitory effect of HR 720, a novel nontetrazole AII antagonist (Deprez et al., 1995). It should be emphasized that the studies where performed with subcultures of only one VSMC isolate and that AII was used at a closer physiological concentration range than mentioned above without any serum or growth factor supplementation. The effect of HR 720 was compared with that of EXP 3174 (Sachinidis et al; 1993), the active metabolite of losartan (DuP 753). Both compounds presented similar AT1 receptor affinities in the subnanomolar range, whereas the AT2 receptor affinity of EXP 3174 was 50-fold lower than that of HR 720 (Deprez et al., 1995).

	Methods

Top Abstract Introduction Methods Results Discussion References

Culture of Rat Aortic VSMC

VSMC were cultured from the thoracic aortae of 5- to 6-week-old male Sprague-Dawley (CD) rats (150-200 g) (Charles River, France). The animals were sacrificed by CO₂ inhalation and the thoracic aortae aseptically excised and immersed in Dulbecco's modified Eagle's medium containing 5% penicillin-streptomycin solution (Gibco, Grand Island, NY), Life Technologies Sarl, Eragny, France and cleaned of connective tissue and adherent fat. The adventitia was removed by stripping the aortae with two dissecting forceps. Isolated arteries were cut open, and the endothelium was removed by scraping the intimal surface with a curved forceps (Wolinsky and Daly, 1970). Adventitia- and endothelium-denuded aortae were then finely minced into small 2-mm pieces before enzymatic dissociation with a mixture of elastase (EC3.4.21.36, Serva, Westbury, NY) and collagenase (Worthington CLS IV, Seromed, Berlin Germany) (Owens et al., 1981). The first 60-min digest at room temperature in the presence of a magnetic stirrer was discarded to avoid any non-VSMC contamination. VSMC from the second and third digests at 37°C for 30 and 20 min, respectively, were centrifuged, and the cell pellet was resuspended in culture medium and subsequently seeded into 25-cm² flasks. The medium was changed every 2 or 3 days.

Cells from a single isolate were subcultured by treatment with trypsin-EDTA (Gibco) and used between the 6th and 30th passage in 24-well cluster plates (Nunc, Denmark). They were grown to subconfluency in a 1:1 mixture of Dulbecco's modified Eagle's medium and HAM-F10 supplemented with 10% FCS (Gibco), 2% glutamine, 1% penicillin-streptomycin solution (Gibco) in a 95% air, 5% CO₂ humidified atmosphere at 37°C. Then cells were rendered quiescent by 48-h serum deprivation and subsequently stimulated by an AII analog [(Sar¹)-angiotensin II purchased from BALE Biochimie SARL (France)] diluted in culture medium devoid of FCS. This analog AII was used because it is more stable during prolonged in vitro incubation (Hall et al., 1974). Maximum effects were observed at 10⁹ M AII. Therefore, this concentration was chosen to test the inhibitory effect of the above-mentioned AII antagonists which were added simultaneously with AII to the culture medium. Cell volume, amino acid incorporation, FN release in culture medium and FN-EIII-A⁺ synthesis were measured after 48 h AII stimulation. Under our experimental conditions, AII-induced cell volume increase, which was measured in each of our cell preparations used for the trophic analysis of AII, did not significantly vary from the 6th to the 30th passage (data not shown).

Cell Volume Measurement

Cells were harvested after trypsin treatment and the cell volume was determined for each cell suspension with a Coulter counter (ZM model, Coulter counter, Coultronics Inc., Coultronics France S.A., Margency, France) coupled to a cell sizer (Multisizer II model, Coulter counter, Coultronics Inc., Coultronics France S.A., Margency, France) and equipped with a 100-µm-aperture orifice tube for determination of cell volume ranging from 800 to 2100 µm³. Cell volume for each well of a 24-well cluster plate was obtained by comparison with latex microspheres of known diameters (3.14 and 9.81 µm ± 1%; Coulter Corp., Hialeah, FL). For each single analysis, determinations were performed in triplicate and a control was included for each plate to avoid plate-to-plate variations. Mean volumes of each cell suspension were automatically determined and the values reported in the text are means ± S.E.M.

Protein Synthesis

Cell cultures were treated in the same manner as for cell volume measurement except that [³H]leucine (168 Ci/mmol, New England Nuclear, Boston, MA) was added when the cells were challenged with AII in the presence or absence of AII antagonists. Protein synthesis was estimated according to the methods described previously (Berk et al., 1989; Chiu et al., 1991). After a 48-h incubation period, equivalent to the time required for maximum increase in cell volume, the medium was aspirated, and the cells were rinsed three times with cold phosphate-buffered saline. Then 1 ml of cold 10% trichloroacetic acid was added and the cells were incubated at 4°C for 30 min. The trichloroacetic acid-insoluble material was washed three times with cold 95% ethanol, and the fixed cellular material was solubilized in 1 ml of 0.1 N NaOH at room temperature for 2 h or kept at 4°C overnight before further processing. Triplicate wells were used to determine each sample point and a control was included for each plate. Aliquots were counted in 4 ml Optiphase `HiSafe' (Wallac Oy, Turku, Finland) with use of a Rackbeta 1219 liquid scintillation counter (LKB Wallac Oy, Turku, Finland).

FN Analysis

FN levels in culture medium were determined under the same culture conditions as for cell volume analysis, by an enzyme-linked immunosorbent assay ("sandwich") technique according to the manufacturer's instructions (Asserachrom Fibronectin test kit, Diagnostica Stago, Asnières, France). Because of the high sensitivity of the assay, culture media were always diluted 1:50 before analysis. Optical density was measured at 492 nm with a microplate reader (THERMO max, Molecular Devices Corporation, Menlo Park, CA). The results are given in nanograms per milliliter and are not normalized to cell number because AII did not induce any cell proliferation under the culture conditions used (results not shown).

Immunohistochemistry

Cultured cells were fixed in cold methanol for 10 min, washed twice in phosphate-buffered saline before immunolabeling. The immunolabeling conditions have been described previously (Samuel et al., 1994).

The antibodies for immunolabeling were monoclonal antibodies specific for the cellular isoform of FN (Sigma Chemical Co., St. Louis, MO) and immunoglobulin directed against mouse immunoglobulin coupled to Texas red (Amersham Corp., Arlington Heights, IL). Sections were mounted and observed with a Dialux microscope (Leica, Deerfield, IL) equipped with epifluorescence optics.

PCR Analysis of FN-EIIIA mRNA Expression

RNA preparation. Total RNA was prepared from the different cell culture flasks according to Chomczynski and Sacchi (1987).

Quantification of the isoforms of FN mRNA by RT and cDNA amplification by PCR. RT/PCR with total RNA was performed as described previously (Farhadian et al., 1994). Two milligrams of smooth muscle cell RNA were reversed transcribed at 42°C for 1 h in the presence of 200 ng of antisense primer (⁵ GGGTGACACCTGAGTGAACT ³) with or without 10 U of MuLV reverse transcriptase (Gibco/BRL, Gaithersburg, MD). The reaction media were then diluted and a series of 20 cycle-amplifications was performed in the presence of 100 ng of unlabeled antisense primer, 100 ng of sense primer (⁵CAGAAATGACCATTGAAGGTTTGC³) and 5-end-labeled to a specific activity of 1000 cpm/ng and 5 U of Taq polymerase. The PCR products were separated by electrophoresis on denaturing gels, the dried gels exposed to phosphor imager (Fugi, Raytest, Paris, France) and the appropriate bands quantitated by use of MacBas software. Because a 5-end-labeled primer was used during amplification, the radioactivity in each band was directly proportional to the number of molecules amplified and the percentage of each FN mRNA isoform was calculated directly. Each RNA was tested in triplicate in independent experiments and the mean values used to determine the percentage of each FN mRNA isoform.

Materials

The AII antagonists HR 720 and EXP 3174 were synthesized by Roussel Uclaf chemistry department. The compounds were dissolved in water and used at final concentrations ranging from 10¹² to 10⁷ M. (Sar¹)-angiotensin II was purchased from Bale Biochimie SARL France.

Analysis of Data

The IC₅₀ values of the AII antagonists were determined by use of an IBM PC program (EBDA, Elsevier Biosoft 1987, United Kingdom) (Mc Pherson, 1985). Results are expressed as the mean ± S.E.M. The inhibitory effects of both compounds HR 720 and EXP 3174 are expressed as a percentage of the difference, taken as 100%, between either cell volume, leucine incorporation or FN release observed in the absence (control) and in the presence of AII 10⁹ M. Statistical comparisons were made by using a one-way analysis of variance and Fisher test with a P value < .05 considered as significant.

	Results

Top Abstract Introduction Methods Results Discussion References

Effect of AII on rat VSMC volume and inhibition by HR 720 and EXP 3174. Under our experimental conditions, the increase in cell volume induced by AII was concentration dependent (fig. 1A). The maximum response was reached in the presence of 10⁹ M AII. This concentration was therefore chosen to determine the inhibitory effect of AII antagonists.

View larger version (11K): [in this window] [in a new window]   Fig. 1.   (A) Concentration-response curve for AII-induced increase in rat VSMC volume after 48-h incubation period in the absence of FCS. The results are expressed as mean ± S.E.M. from a typical experiment performed in triplicate. (B) Concentration-dependent effects of HR 720 and EXP 3174 on AII-induced increase in cell volume of rat VSMC. The inhibitory effects after a 48-h treatment with HR 720 and EXP 3174 are expressed as the percentage of the difference between cell volume observed in the absence (control) and in the presence of 109 M AII (taken as 100%). Results are expressed as mean ± S.E.M. of six individual experiments, each performed in triplicate.

9

9

Effect of AII on leucine incorporation in rat VSMC and inhibition by HR 720 and EXP 3174. Maximum [³H]leucine incorporation was reached at the same concentration of AII as that required for the maximum volume increase (fig. 2A). Therefore AII was again used at a 10⁹ M concentration to determine the inhibitory effect of AII antagonists.

View larger version (12K): [in this window] [in a new window]   Fig. 2.   (A) Concentration-response curve for AII-induced increase in [3H]leucine incorporation in VSMC after 48-h incubation in the absence of FCS. The results are expressed as mean ± S.E.M. from a typical experiment performed in triplicate. (B) Concentration-dependent effects of HR 720 and EXP 3174 on AII-induced increase in leucine incorporation of VSMC. The inhibitory effects after a 48-h treatment with HR 720 and EXP 3174 are expressed as the percentage of the difference between leucine incorporation observed in the absence (control) and in the presence of 109 M AII (taken as 100%). Results are expressed as mean ± S.E.M. of seven individual experiments, each performed in triplicate.

9

9

Effect of AII on FN release in culture medium by rat VSMC and inhibition by HR 720 and EXP 3174. AII also induced a concentration-dependent increase in FN release by VSMC into culture medium (fig. 3A). Here again, the maximum effect was observed in the presence of 10⁹ M AII. The increased secretion of FN by VSMC was confirmed by an immunochemical approach. As shown in figure 4, both 10⁹ and 10⁷ M AII dramatically increased the amount of insoluble cFN in the pericellular space of VSMC.

View larger version (11K): [in this window] [in a new window]   Fig. 3.   (A) Concentration-response curve for AII-induced increase in FN release in culture supernatants of rat VSMC after 48-h incubation in the absence of FCS. The results are expressed as mean ± S.E.M. from a typical experiment performed in triplicate. (B) Concentration-dependent effects of HR 720 and EXP 3174 on AII-induced FN release of rat VSMC. The inhibitory effects after a 48-h treatment with HR 720 and EXP 3174 are expressed as the percentage of the difference between FN release observed in the absence (control) and in the presence of 109 M AII (taken as 100%). Results are expressed as mean ± S.E.M. of four individual experiments for HR 720 and three individual experiments for EXP 3174, each performed in triplicate.

View larger version (93K): [in this window] [in a new window]   Fig. 4.   Effect of AII on the accumulation of cFN in the pericellular space of VSMC. In both control conditions (a) and in the presence of 1012 M angiotensin II (b), very little FN was detectable in the pericellular space, whereas, in the presence of either 109 M (c) or 107 M (d) angiotensin II, the amount of cFN was clearly increased.

8

Increase in FN-EIIIA mRNA induced by AII and inhibition by HR 720 and EXP 3174. The expression of FN-EIIIA⁺ mRNA in VSMC was equally enhanced by 10⁹ and 10⁷ M AII (fig. 5A). In contrast the percentage of FN-EIIIB⁺ mRNA expressed by VSMC was not altered in the presence of AII (data not shown). The 2-fold increase in the percentage of FN containing EIIIA sequence was completely inhibited by both angiotensin receptor antagonists at a concentration of 10¹⁰ M (fig. 5B).

View larger version (55K): [in this window] [in a new window]   Fig. 5.   Expression of FN-EIIIA+ mRNA in cultured VSMC. Typical RT-PCR shows that the FN-EIIIA+ transcripts (427n) increased in the presence of 107 M AII (A). Cells were cultured without AII (lane 1) or with 109 M AII (lanes 2 and 3) or with 109 M AII in the presence of 1010 M HR 720 (lane 4) or 1010 M EXP 3174 (lane 5), respectively. The percentage of FN-EIIIA+ mRNA measured after RT-PCR by image analysis system was evaluated in different culture conditions (B). Each column represents the mean data of three to four RNA preparations from independent culture flasks. * P < .05 versus control; + and ++, P < .05 and 0.01 versus 109 M AII, respectively (analysis of variance, Fisher test).

	Discussion

Top Abstract Introduction Methods Results Discussion References

These results show that in vitro AII has long-lasting, concentration-dependent trophic effects on rat aortic VSMC because the cells were challenged with only one single peptide application throughout the 48-h incubation time. Because in the present study all the quantitative and qualitative analyses have been performed in parallel on the subcultures of the same cellular isolate, it emerged that AII stimulated protein synthesis and FN release in parallel to cell volume. It should be emphasized that in the present study maximum AII-induced VSMC stimulation was achieved at a 100-fold lower concentration, closer to the physiological range, than that used in previous studies to demonstrate an increase in cell volume (Geisterfer et al., 1988; Berk et al., 1989; Millet et al., 1992; Koh et al., 1994) and/or protein synthesis (Berk et al., 1989; Scott-Burden et al., 1988; Geisterfer et al., 1988; Kato et al., 1991; Sachinidis et al., 1993; Koh et al., 1994). In contrast to some investigators (Sung et al., 1994; Briand et al., 1994), AII-induced stimulation was performed in the absence of FCS or any growth factor supplementation. Therefore, under our conditions, AII-induced responses may be considered as a direct hypertrophic effect of AII without any proliferative activity. This direct concentration-dependent effect of AII on VSMC is shown at both the cellular level and in the ECM.

The cellular hypertrophy as measured by the direct analysis of cell volume correlates perfectly with the analysis of de novo protein synthesis as measured by leucine incorporation. In addition the present work extended previous data related to the AII-induced FN synthesis by VSMC in vitro or in vivo (Saouaf et al., 1991; Hahn et al., 1993b; Takasaki et al., 1990; Crawford et al., 1994). Indeed, although it has been shown that AII preferentially stimulated synthesis of soluble FN by VSMC (Hahn et al., 1993b), our results clearly indicate that AII not only enhanced the release of soluble FN in the medium but also increased the amount of insoluble cFN attached to the cell membranes. This in fact suggests that FN secreted in response to AII exhibited all the properties required for a polymerization in the pericellular space. The increase in FN release has been previously shown to be correlated with an increase in the FN mRNA level, which suggests that AII stimulates FN gene transcription (Farhadian et al., 1995; Kim et al., 1994; Hosoi et al., 1993). Therefore, the AII-induced hypertrophic effect appeared to parallel changes in VSMC gene expression toward a synthetic phenotype as indicated by the concentration-dependent increase in FN release produced by AII. Furthermore the changes in VSMC phenotype in response to AII were confirmed by the increased expression of fetal gene transcript FN-EIIIA⁺. This indicates that AII per se is able to modulate posttranscriptional events such as the FN alternative splicing. The nature of either extracellular or intracellular mechanisms controlling FN splicing are quite far from being understood (Kornblihtt et al., 1996). FN alternative splicing has also been observed in several cell lines when exposed to growth factors such as transforming growth factor, , vitamin D and vitamin D₃. It is worth noting that under our experimental conditions FN alternative splicing in VSMC seems to result from a direct effect of AII. The consequences of EIIIA inclusion in FN molecule by VSMC in response to AII stimulation are still unknown, but both in vitro and in vivo studies suggest that the presence of EIIIA might promote cell adhesion and/or ECM assembly (French-Constant, 1995; fig. 4).

In vitro, AII-induced protein synthesis has been shown to be antagonized by AII antagonists such as EXP 3174 (Sachinidis et al., 1993) and CV-11974 (Koh et al., 1994), both compounds being classified as selective AT1 receptor antagonists (Bumpus et al., 1991). It has been suggested, however, that VSMC in vitro do not express the AT1 receptor subtype exclusively (Hahn et al., 1993a; Viswanathan et al., 1991). Both HR 720 and EXP 3174 compounds have an identical affinity for the AT1 receptor, whereas HR 720 presents a 50-fold higher affinity for AT2 receptor subtype (Deprez et al., 1995). In our studies EXP 3174 is at least as potent as HR 720 to inhibit the 10⁹ M AII-induced cellular hypertrophy, leucine incorporation, FN release into culture medium and FN-EIIIA⁺ mRNA expression in cultured VSMC. These results therefore seem to indicate that under our experimental conditions and according to the parameters measured, the in vitro AII-induced hypertrophic effects on VSMC are mediated mainly, if not exclusively, via the AT1 receptor.

These results corroborate the fact that in vitro VSMC activation induced by AII per se is essentially mediated via the AT1 receptor subtype (Wong et al., 1990; Sachinidis et al., 1993; Bunkenburg et al., 1992). The present study demonstrating that both selective and less selective AT1 antagonists are equally potent in inhibiting in vitro effects of AII on VSMC suggest that these types of compounds may exert a certain beneficial impact on the vasculature in addition to their in vivo hemodynamic effects. Further in vivo studies would be required, however, to sustain this hypothesis.