Introduction

Top Abstract Introduction Methods Results Discussion References

Neuronal nAChRs belong to the family of ligand-gated multisubunit ion channels (Deneris et al., 1991; Luetje and Patrick, 1991), members of which include receptors for -amino-n-butyric acid, glutamate, glycine and serotonin (Karlin and Akabas, 1995). A variety of nAChR subtypes have been described in the brain, autonomic ganglia and sensory tissues (McGehee and Role, 1995). In recent years, it has become increasingly clear that such molecular diversity arises as a consequence of homomeric or heteromeric assembly of at least 11 gene products, namely, ₂-₉ and ₂-₄. The ₂-₆ subunits in conjunction with ₂-₄ subunits form heteromeric ion channels, whereas the ₇-₉ subunits form homooligomeric channels when expressed in Xenopus oocytes (Couturier et al., 1990; Séguéla et al., 1993; Peng et al., 1994) or mammalian cell lines (Gopalakrishnan et al., 1995). Some  and  subunits may have a modulatory action on other nAChRs. Most of the reports have failed to show that ₅ and ₆ as well as ₃ subunits form functional receptors in conjunction with complimentary beta or alpha receptors, respectively (Boulter et al., 1987; Wada et al., 1990). It has been shown that these subunits may modify the physiology and pharmacology of functional recombinant receptors (Ramirez-Latorre et al., 1996).

In the central nervous system, a major class of nicotinic receptors defined by the high-affinity binding of -[¹²⁵I]bungarotoxin comprises predominantly, if not exclusively, the ₇ subtype. Unlike other nAChR subtypes, the homomeric ₇ subunit expressed in Xenopus oocytes exhibits a higher Ca⁺⁺ permeability relative to monovalent cations (p_Ca/p_monovalent ratio: 20, Séguéla et al., 1993; 10, Bertrand et al., 1993; p_Ba/p_monovalent ratio: 17, Sands et al., 1993). These values are in the same order of magnitude, if not higher, than those reported for the NMDA class of glutamate receptors where p_Ca⁺⁺/p_Na⁺ ratio values ranging from 10.3 to 14.3 have been reported (Zarei and Dani, 1994; Castro and Albuquerque, 1995). The permeability ratios are also much higher than those determined for the muscle (₁)₂₁ nAChRs (ratio values ranging from 0.1 to 1.0; Vernino et al., 1992; Costa et al., 1994) and the ganglionic ₃-containing nAChRs (1.5, Vernino et al., 1992; Fieber and Adams, 1991) and other non-NMDA glutamate receptors (Dingeldine et al., 1992).

The physiological role(s) of Ca⁺⁺ entering mammalian cells via the homomeric ₇ nAChRs remains to be elucidated. Influx of Ca⁺⁺ through the ₇ nAChR subtype has been suggested to be of particular importance in activating several Ca⁺⁺-dependent processes including neurite growth, synaptic transmission and neurotrophic effects. Recent studies have demonstrated the involvement of -bungarotoxin-sensitive nAChRs in ()-nicotine-evoked Ca⁺⁺ influx in ciliary ganglion neurons (Vijayaraghavan et al., 1992; Zhang et al., 1994), hippocampal neurons (Alkondon and Albuquerque, 1993) and at the synaptic junctions of the medial habenula and interpeduncular nuclei (McGehee et al., 1995). A role for this nAChR in neuromodulation/neuroprotection emerges from the observation that ligands that interact with this subtype have neuroprotective properties (De Fiebre et al., 1995; Meyer et al., 1994; Donnelly-Roberts et al., 1996). In vivo, ₇ nAChR may coexist with other -bungarotoxin-sensitive subunits (Anand et al., 1993) and this limits a direct analysis of the precise functional properties of the homomeric combination. Although the Ca⁺⁺ permeability of the ₇ homomer has been convincingly demonstrated by permeability ratio studies (i.e., by evaluating Ca⁺⁺-dependent shift in the reversal potential with the extended Goldman-Hodgkin-Katz equation) (Séguéla et al., 1993; Bertrand et al., 1993; Sands et al., 1993), these measurements do not necessarily indicate whether the receptors can significantly elevate intracellular Ca⁺⁺ levels in mammalian cells (Vernino et al., 1994). Accordingly, the actual amount of Ca⁺⁺ influx in mammalian cells and the kinetics of such events remain to be defined.

The human ₇ nAChR has recently been stably expressed in a mammalian cell line and shown to function as a -bungarotoxin-sensitive ion channel exhibiting rapid kinetics of activation and inactivation (Gopalakrishnan et al., 1995). In this study, we have measured simultaneously membrane current and intracellular Ca⁺⁺ kinetics with a combination of whole-cell patch-clamp and fura-2 imaging techniques. Our studies provide direct evidence that the recombinant homomeric ₇ nAChR subtype promotes a significant and sustained increase in [Ca⁺⁺]_i in mammalian cells upon activation by nAChR agonists including ()-nicotine, acetylcholine, (±)-epibatidine and 1,1-dimethyl-4-phenylpiperazinium.

	Methods

Top Abstract Introduction Methods Results Discussion References

Cell culture. A stable cell line of human embryonic kidney 293 cells transfected with an expression vector containing the human ₇ nAChR cDNA was used in the present study. Because the human ₇ cDNA originally cloned by Doucette-Stamm et al. (1993) lacked a signal sequence, a rat signal sequence was included with a synthetic oligonucleotide (5-GCAGCACTCGAGCCATGTGCGGCGGGCGGGGAGGCATCTGGCTGGCTTGGCCGCGGCGCTGCTGCACGTGTCCCTGCAAGGCGAGTTCCAGAGGAAGCTTTACAAGGA-3) containing internal XhoI and HindIII sites (underlined). The forward and reverse complement of the oligo were annealed, digested with XhoI/HindIII and ligated into the HindIII/XhoI sites of the plasmid (pBluescript) containing the human ₇ sequence. The entire cDNA was then cut with XhoI/NotI and the 5-overhang filled in with Klenow polymerase, linked with BstXI adapters and ligated into the BstXI site of the expression vector pRcCMV (Invitrogen, San Diego, CA) containing the constitutive human cytomegalovirus promoter to obtain the plasmid pRcCMV₇. HEK293s were transfected with this plasmid by lipofectamine, and individual antibiotic-resistant colonies were picked and propagated as previously described (Gopalakrishnan et al., 1995). The cell line, referred to as K28, expresses a high density of -[¹²⁵I]bungarotoxin binding sites (B_max, ~970 fmol/mg protein) and has been employed in this study. Cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and 0.25 mg/ml geneticin and maintained in a cell incubator at 37°C with 5% CO₂. Untransfected cells were grown in the same media, without geneticin. Cells were plated in poly-L-lysine-coated ultrathin Fisher coverslips at 10⁵ cells/ml in 35-mm Petri dishes (Falcon 1008, Becton Dickinson, IL). Nonconfluent cells were studied for 4 to 5 days after plating.

Intracellular Ca⁺⁺ imaging and electrophysiological recordings. Coverslips were mounted in a small flowthrough Lucite chamber positioned on the stage of an Axiovert 135 microscope (Zeiss, Germany). The recording chamber was provided with a central hole to allow a direct access to the plated cells. A coverslip was fixed to the recording chamber by means of a Vaseline ring in such a way that only one coverslip was interposed between the cells and the microscope objective (100 ×, NA 1.3, Fluar, Zeiss). Continuous cell perfusion with the bathing-external solution (see below) was done with a push-pull syringe pump (WPI, Saratoga, FL).

Fast agonist delivery and solution exchange. Agonists were delivered by puffing the content of a reservoir with a Harvard syringe pump through one barrel of a theta tube micropipette (Sutter). Theta tubes were pulled and carved with a diamond pencil until a sharp pipette tip of about 30 µm was obtained. The bathing solution was puffed through the other barrel of the theta tube. Both solutions were delivered at the same flux rate, and a very clear edge separated both solution streams. A Newport (Novato, CA) manipulator was used for theta glass tubes positioning. The sharpness of the interface between flowing solutions was assessed by perfusing the two barrels with solutions with different ionic strength such as phosphate-buffered saline and 10% phosphate-buffered saline solution, respectively. Theta tubes were mounted in a piezoelectric device (Burleigh, Fishers, NY) and activated by a voltage pulse. The activation of the drug-delivering system was synchronized with the current and intracellular Ca⁺⁺ transients recordings. The reliability of solution exchange was measured as an open-tip pipette (filled with 3 M KCl) response to displacements of the theta tube interface. The time for 100% solution exchange was 1 ms when the open tip was positioned 100 µm from the theta tube tip. The latency between pulse and solution exchange is attributable mainly to the solution diffusion time from the perfusion to the recording pipette (Jonas, 1995).

Intracellular Ca⁺⁺ kinetics. Intracellular Ca⁺⁺ kinetics was measured under whole-cell voltage-clamp with fura-2 pentapotassium salt (Molecular Probes, Eugene, OR) as a Ca⁺⁺-sensitive dye. However, concentration-response curves to different nAChR agonists were done at resting membrane potential. Membrane potential was determined in a separated group of cells in current-clamp mode. The AM form of fura-2 (2 µM) was used for experiments in intact cells. Fura-2 salt was dissolved in the pipette solution at concentrations ranging from 400 to 500 µM. Fura-2 as a ratiometric dye allowed absolute determinations of the intracellular Ca⁺⁺ concentration ([Ca⁺⁺]_i). Fura-2 was not saturated at the concentrations used in our studies because 1 µM ionomycin induced further increase in fluorescence at 350 nm excitation wavelength. Ionomycin has been used previously to induce a massive influx of extracellular Ca⁺⁺ to the cell without affecting intracellular stores (Delbono and Stefani, 1993).

Calculation of intracellular Ca⁺⁺ concentration. For [Ca⁺⁺]_i calculations R = F₃₄₀/F₃₅₀, R_min (0% saturation of the dye by Ca⁺⁺) and R_max (100% saturation with Ca⁺⁺) were determined. R_max was obtained by adding a low dilution of saponin (0.001%) to the bathing solution at the end of the experiments. R_min was measured in cells preincubated for 30 min in 2 mM EGTA. [Ca⁺⁺]_i was calculated with the following equation: [Ca⁺⁺] = K_D[(R  R_min)/(R_max  R)], where R is the fluorescent ratio, R_max is the maximum ratio value measured at high [Ca⁺⁺]_i and R_min is the minimum ratio value measured at low [Ca⁺⁺]_i, K_D is the dissociation constant of the Ca⁺⁺ binding to fura-2 (224 nM; Grynkiewicz et al., 1985). The values for R_min and R_max determined by calibration were 0.2 and 3.5, respectively. For computer simulation of intracellular Ca⁺⁺ transients Matlab software (MathWorks, Inc., MA) was used. As the basal [Ca⁺⁺]_i varied in a range from 65 to 350 nM (207 ± 82; n = 50) in transfected HEK293, only cells with a resting cytosolic Ca⁺⁺ less than 100 nM were included in this study. The reason for this selection is that the effect of high intracellular [Ca⁺⁺] on ₇ nAChR kinetics has not yet been explored.

Concentration-response curves. Concentration-response curves were performed for four different nAChR agonist (()-nicotine, acetylcholine, DMPP iodide, DMPP and (±)-epibatidine) in intact cells (see above). An average of four different increasing concentrations were used in the same cell. The time course of changes in [Ca⁺⁺], including the mean time for complete return to prestimulating levels, was determined. Drugs were applied for 50 ms with 1-min intervals. This interval assured a complete development of the desensitizing phase even at lower (or less desensitizing) concentrations and for a complete return of cytosolic [Ca⁺⁺] to prestimulating levels. A saturating concentration of the agonist was included in each experiment. Thus, responses to lower agonist concentrations were normalized to a maximum elicited by the agonist. Six to eight cells were used for each group of experiments. Intracellular Ca⁺⁺ responses were corrected for run-down according to procedures described below. Comparative efficacies were evaluated by measuring absolute maximal increase in [Ca⁺⁺]. Lower concentrations of the agonists induced Ca⁺⁺ signals that were a fraction of the maximum response. For plotting, Ca⁺⁺ responses were normalized to the maximum at the saturating concentration of the agonist.

Materials. Cell culture media, fetal bovine serum and geneticin were purchased from Life Technologies, Inc. (Grand Island, NY). The following materials were purchased from sources indicated: acetylcholine chloride, ()-nicotine hydrogen tartrate, atropine sulfate and 1,1-dimethyl-4-phenyl-piperazinium iodide were obtained from Sigma Chemical Co. (St. Louis, MO), -bungarotoxin, MLA citrate and (±)-epibatidine dihydrochloride were purchased from Research Biochemicals International (Natick, MA). Fura-2 pentapotassium salt, fura-2 AM and Mag-fura-2 AM were purchased from Molecular Probes (Eugene, OR). Fura-2 pentapotassium salt was dissolved in the pipette solution at concentrations ranging from 400 to 500 µM. Fura-2 AM stock was prepared in 10% dimethyl sulfoxide. With acetylcholine as the agonist, atropine (2 µM) was used to block endogenous muscarinic receptors.

	Results

Top Abstract Introduction Methods Results Discussion References

Whole-cell inward current and intracellular Ca⁺⁺ transients were recorded simultaneously in HEK293 stably expressing the human ₇ nAChR. A short pulse (50 ms) of 100 µM ()-nicotine induces a fast inward current (activation time constant, _a = 1.1 ± 0.23 ms) that rapidly desensitizes (desensitization time constant, _d = 12.2 ± 2.6 ms; n = 5) in a cell voltage-clamped at 100 mV (fig. 1). The ()-nicotine-induced inward current was completely abolished by 3 nM -bungarotoxin and 2 nM MLA (n = 7 for both antagonists). These results are in agreement with those previously reported for this cell line (Gopalakrishnan et al., 1995).

View larger version (K): [in this window] [in a new window]   Fig. 1.   Simultaneous whole-cell inward current and intracellular Ca++ transient recorded from HEK293 stably expressing the human 7 nAChR. A short pulse (50 ms) of 100 µM ()-nicotine elicits a fast inward current (activation time constant, Ta = 1.1 ms) that rapidly desensitizes (desensitization time constant, Td = 12 ms) in a cell voltage-clamped at 100 mV. Shown is a representative inward current trace and selected fura-2 Ca++ ratio (340/350 nm) images at various time intervals (indicated by arrows). The inward current elicits an intracellular Ca++ transient as monitored with fura-2 pentapotassium salt. Pseudocolor (100 × 100 pixels) calcium ratio (340/350 nm) images (2-ms exposure) processed off-line illustrate changes in calcium concentrations at them times indicated by arrows. The maximum [Ca++]i are 69, 104, 142, 305 (peak), 223 and 192 nM for images (a-f) respectively.

Time course and magnitude of ()-nicotine-evoked Ca⁺⁺ transient. Figure 1 also shows selected fura-2 Ca⁺⁺ ratio (340/350 nm) images at various time intervals. The pattern of ()-nicotine-evoked Ca⁺⁺ transient was recorded simultaneously with inward current responses from the same cell. Previous studies with the adrenal chromaffin cells have shown that the amplitude of the peak Ca⁺⁺ transient increases in the negative voltage range (Zhou and Neher, 1993). Thus, hyperpolarizing holding potentials were used to better define the Ca⁺⁺ responses in the present study. The intracellular Ca⁺⁺ rises from within the first 10 ms after exposure to 100 µM ()-nicotine and further elevations were observed during the desensitization phase of the current. The ()-nicotine-evoked maximal increase in [Ca⁺⁺]_i was observed at the time during which the desensitization of the current was complete. The mean peak [Ca⁺⁺]_i observed with 100 µM ()-nicotine was 356 ± 48 nM (n = 8). The mean peak [Ca⁺⁺]_i corresponded throughout the drug pulse to the cell outermost shells. Thereafter, [Ca⁺⁺]_i starts to decline slowly reaching 50% of the peak response within 20 ± 6 s (n = 8) after beginning of the nicotine pulse. The time course of the peak [Ca⁺⁺]_i changes after application of 100 µM nicotine is depicted in figure 2A. A longer time was required for returning [Ca⁺⁺]_i to prestimulation values (range, 0.5-1 min; n = 8). No inward current (n = 8) or intracellular Ca⁺⁺ changes (n = 25) were detected in the presence of 300 to 1000 µM ()-nicotine in untransfected cells, consistent with previous reports showing lack of nAChR-mediated responses in HEK293 (Gopalakrishanan et al., 1995). As a control for potential effects of geneticin on the kinetics of Ca⁺⁺ influx, transfected cells grown in the absence of geneticin for 24 to 48 h before testing were identical in response to experiments done in the presence of geneticin (n = 15).

View larger version (10K): [in this window] [in a new window]   Fig. 2.   Relation between intracellular Ca++ transient and inward current. (A) Time course of peak intracellular [Ca++] sampled every 10 ms in whole-cell voltage-clamped HEK293 expressing the human 7 nAChRs and stained with 500 µM fura-2 via the patch pipette. The horizontal bar at the bottom indicates the exposure to 100 µM ()-nicotine application (50-ms duration). Only the first 500 ms of the recording is shown. (B) Total charge measured as the integral of the current trace (shaded area). (C) Simulation of intracellular Ca++ transient assuming that influx through plasma membrane is the Ca++ source (see text).

17

Source of agonist-evoked intracellular Ca⁺⁺. The [Ca⁺⁺]_i distribution showed a nonuniform pattern across the cell stimulated with 100 µM ()-nicotine (fig. 3). Pixel intensity profile analysis along one vector across the cell shows a Ca⁺⁺ gradient with higher concentrations near the cells periphery. This gradient is an indication of Ca⁺⁺ influx through channels expressed on the external membrane. The expression of endogenous voltage-gated calcium channels was assessed in whole-cell voltage clamp in transfected (n = 15) and untransfected HEK293 (n = 25). No inward current was detected in cells pulsed from three different holding potentials (50, 70 and 100 mV) to +60 mV with 10-mV increments. Cell hyperpolarization together with the lack of expression of voltage-gated calcium channels in HEK293 (n = 25) also support the cationic influx through expressed human ₇ nAChRs.

View larger version (K): [in this window] [in a new window]   Fig. 3.   Distribution of [Ca++]i in a HEK293 expressing the human 7 nAChRs. Nonuniform distribution of [Ca++]i in a HEK293 expressing the 7 nAChRs exposed to 100 µM ()-nicotine. A three-dimensional representation of the pixel intensity distribution corresponding to image a and figure 1 (image d) is shown in b. The pixel intensity profile analysis along one vector across the cell (indicated by arrow in image a) shows the maximal pixel intensity around the cell periphery.

Pharmacology of agonist-evoked Ca⁺⁺ responses. To examine whether antagonists with reported selectivity toward the ₇ nAChR relative to the ₄₂ and ganglionic type nAChRs (Gopalakrishnan et al., 1995; Wonnacott et al., 1993) could block ()-nicotine-evoked rise in [Ca⁺⁺]_i, cells were preincubated with either -bungarotoxin (3 nM) or MLA (2 nM) for 10 min. As in whole-cell voltage clamp the run-down was fast (0.5 ± 0.08 of the first response at 5 min after accessing into the intracellular compartment, n = 32), cells were preincubated in -bungarotoxin and MLA before getting into whole-cell patch-clamp configuration. Subsequent application of 100 µM ()-nicotine did not show statistically significant elevations in [Ca⁺⁺]_i was compared with control (n = 7 for both antagonists tested; fig. 4). The abolishment of intracellular Ca⁺⁺ responses in the presence of these nAChR antagonists is further supported by the complete suppression of single-channel activity recorded in outside-out patches from transfected cells (Messi et al., 1996).

View larger version (46K): [in this window] [in a new window]   Fig. 4.   Blockade of intracellular Ca++ responses by nAChR antagonists. Blockade of intracellular Ca++ mobilization elicited by 100 µM ()-nicotine by -bungarotoxin and MLA. Shown are mean (±S.E.M.) values of [Ca++]i in control cells (no exposure to nicotine), and in cells exposed to ()-nicotine before (N) and after pretreatment with 3 nM -bungarotoxin or 2 nM MLA (N + MLA). The difference between the peak [Ca++]i in nicotine-treated (100 µM) and control cells was significant (P < .001) (n = 6-8 cells for each group of experiments).

View larger version (K): [in this window] [in a new window]   Fig. 5.   Comparison of the effect of ()-nicotine and (±)-epibatidine on intracellular Ca++ responses. Intracellular Ca++ responses to nAChR agonists in HEK293 stably expressing 7 nAChRs. Fura-2 fluorescent digital images were recorded after application of varying concentrations of the two nAChR agonists, ()-nicotine (left panel) and (±)-epibatidine (right panel) to the same cell (n = 5 for each agonist).

View larger version (22K): [in this window] [in a new window]   Fig. 6.   Concentration dependence of agonist-evoked Ca++ responses. (A) Shown are concentration-response curves to acetylcholine, ()-nicotine, (±)-epibatidine and 1,1-dimethyl-4-piperazinium iodide in HEK293 stably expressing the human 7 nAChRs. Various concentrations were tested in individual intact cells and responses plotted as a fraction of the maximal intracellular Ca++ response. Intracellular Ca++ signals were normalized to maximal responses for each agonist. Data (mean ± S.E.M.; n = 4-6) were fitted to a Hill equation. The EC50 values for evoking Ca++ influx by (±)-epibatidine, ()-nicotine, DMPP and acetylcholine were 3.5, 51, 75 and 108 µM respectively. (B) Correlation between the EC50 values for current activation and intracellular Ca++ responses.

	Discussion

Top Abstract Introduction Methods Results Discussion References

The definition of the physiological role(s) of various neuronal nAChR subtypes has, in recent years, been aided by the molecular cloning and expression of the various nAChR subunits and/or subunit combinations in mammalian cells (Whiting et al., 1991; Pereira et al., 1994; Puchacz et al., 1994). The human ₇ nAChR has recently been stably expressed in a mammalian cell line, HEK-293, and shown to function as a homo-oligomeric ion channel exhibiting rapid kinetics of activation and inactivation of channel current, sensitive to -bungarotoxin (Gopalakrishnan et al., 1995). This study documents, for the first time, that Ca⁺⁺ permeation through the recombinant human ₇ nAChRs promotes a significant transient rise in intracellular Ca⁺⁺ concentration in mammalian cells. The dynamics of ₇ nAChR-evoked Ca⁺⁺ response has also been characterized and directly correlated with the pharmacological profile previously defined for this nAChR subtype (Gopalakrishnan et al., 1995).

Time course of intracellular Ca⁺⁺ transients. Simultaneous cationic inward current and intracellular Ca⁺⁺ recordings under whole-cell voltage-clamp conditions demonstrated a fast Ca⁺⁺ transient that reaches a peak at the end of the desensitizing phase of the current. Such Ca⁺⁺ transient and current kinetic values are similar to those reported previously in neurons expressing a diversity of nAChR subtypes (Zhou and Neher, 1993; Rathouz and Berg, 1994; Vernino et al., 1994). The decline of the [Ca⁺⁺]_i to base-line values is a relatively slow process in this expression. This kinetics probably differs from neurons which exhibit cell-to-cell variation in Ca⁺⁺ buffer capacity. Our present studies confirm, as previously suggested, that -bungarotoxin-sensitive nicotinic receptors elevate intracellular free Ca⁺⁺ in mammalian cells (Vijayaraghavan et al., 1992). Studies with the recombinant human ₇ subunit stably expressed in HEK293 differ from those observed in chick ganglion neurons in terms of a much higher sensitivity of the latter to nicotine (0.1-1.0 µM), slower time course for the Ca⁺⁺ response (2-4 s after nicotine application, although current duration was less than 500 ms) and diminished sensitivity to -bungarotoxin blockade at higher nicotine concentrations. Whether these differences reflect the presence of other subunits contributing to the effects found in chick ganglion neurons, as recently reported by Pugh et al. (1995), or caused by differences in the amino acid sequences of the chick and human ₇ subunit remain to be determined.

Magnitude of intracellular Ca⁺⁺ elevations. Our study demonstrates that Ca⁺⁺ permeation through the recombinant ₇ nAChRs elicits a significant rise in [Ca⁺⁺]_i in HEK293. The relative increase is the same order of magnitude as observed for the _3x nAChR subtype (expressed in chromaffin cells; [Ca⁺⁺]_i = 50-100 nM at 50 mV), ATP and NMDA receptors (Zhou and Neher, 1993; Schneggenburger et al., 1993; Rogers and Dani, 1995). However, the increase in [Ca⁺⁺]_i is much lower than those reported for glutamate receptors expressed in HEK293 (Burnashev et al., 1995). The ()-nicotine-evoked intracellular Ca⁺⁺ transient measured in this work is consistent with theoretical predictions based on the fraction of the inward current carried by Ca⁺⁺ ions and simulations of intracellular Ca⁺⁺ transients resulting from Ca⁺⁺ influx through the plasma membrane. A 20% fractional current carried by Ca⁺⁺ ions is also consistent with direct measurements of Ca⁺⁺ flux with use of pure Ca⁺⁺ extracellular solution.

Pharmacology of intracellular Ca⁺⁺ responses. An excellent correlation was observed between the pharmacological profiles of ()-nicotine, acetylcholine, DMPP and (±)-epibatidine, obtained by measuring whole-cell currents and intracellular Ca⁺⁺ responses (fig. 6B). The 1:1 correlation between agonist-induced intracellular Ca⁺⁺ responses and whole-cell currents indicates that the measured intracellular Ca⁺⁺ transient is a result of agonist-induced activation of the channel and is not influenced by mechanisms of Ca⁺⁺-induced Ca⁺⁺ release from internal stores or Ca⁺⁺-activated secondary conductance. Ca⁺⁺-induced Ca⁺⁺ release was ruled out by using ryanodine receptor and IP₃ receptor antagonists. In these experiments ()-nicotine induced similar intracellular Ca⁺⁺ responses than in the absence of the antagonists. A low electrochemical gradient for Cl (F is the main internal anion) rules out the possibility to elicit an outward Ca⁺⁺-dependent Cl current. Obviously, this mechanism can not contribute to measured intracellular Ca⁺⁺ signals. Further, the blockade of both current and [Ca⁺⁺]_i responses by nanomolar concentrations of -bungarotoxin and MLA provides conclusive evidence that ()-nicotine-evoked responses are mediated via an interaction with ₇ nAChRs.

Source of ()-nicotine-evoked intracellular Ca⁺⁺ transient. Further support for the conclusion that ()-nicotine-evoked rise in [Ca⁺⁺]_i in transfected HEK293 is mediated primarily via the ₇ nAChRs arises from the following set of observations. The spatial [Ca⁺⁺]_i distribution within the cell revealed by pixel intensity profile analysis (fig. 3) indicates that the Ca⁺⁺ concentration is higher at the cell periphery than in central areas and that the gradient between outer and inner regions is maintained during Ca⁺⁺ influx which subsequently dissipates. Second, the lack of effects of heparin and ryanodine, blockers of inositol (Deneris et al., 1991; McGehee and Role, 1995; Lindstrom et al., 1995) triphosphate receptor and ryanodine receptor, respectively, on ()-nicotine-evoked Ca⁺⁺ transients, indicates that these intracellular Ca⁺⁺-mobilizing pathways do not contribute directly to the observed responses (Thayer and Miller, 1990; Zhou and Neher, 1993; Schneggenburger et al., 1993). Third, the lack of endogenous expression of NMDA and voltage-gated Ca⁺⁺ channels in HEK293 (Burnashev et al., 1995; Williams et al., 1992), together with the fact that intracellular Ca⁺⁺ transients were recorded at a hyperpolarizing potential (100 mV), eliminates any potential contribution of voltage-gated or other Ca⁺⁺-permeable ion channels to nAChR agonist-evoked Ca⁺⁺ response.

Relevance to cellular function. It is known that alterations in [Ca⁺⁺]_i play a pivotal role in modulating cell-to-cell and intracellular signaling mechanisms in neurons of the central and peripheral nervous system (Kater et al., 1988; Kyrozis et al., 1995). Neuronal Ca⁺⁺ transients resulting from activation of voltage-gated Ca⁺⁺ channels and NMDA class of glutamate receptors have been widely studied (Burnashev et al., 1995; Kyrozis et al., 1995). More recently, Ca⁺⁺ permeability of acetylcholine-activated currents in regions of the central nervous system have received considerable attention and it has become increasingly clear that such responses are mediated by distinct nAChR subtypes. Studies in cultured hippocampal neurons and ciliary ganglion neurons have demonstrated the existence of -bungarotoxin-sensitive nAChRs with high Ca⁺⁺ permeability, whose activation elicits a rapidly activating and rapidly desensitizing current to nAChR agonists (Vijayaraghavan et al., 1992; Castro and Albuquerque, 1995; Zhang et al., 1994). In hippocampal neurons, the relative Ca⁺⁺ permeability values of the -bungarotoxin-sensitive nAChR are similar to those of the NMDA class of glutamate receptors [pCa⁺⁺/pCs⁺ of 6 vs. 10 for the NMDA channel (Castro and Albuquerque, 1995)] and much higher than those reported for the muscle-type nAChRs expressed in BC³H1 cells (0.2; Vernino et al., 1992) and other -bungarotoxin-insensitive nAChRs expressed in parasympathetic ganglia (1.5; Fieber and Adams, 1991); PC12 cells (2.5; Sands and Barish, 1991) or adrenal chromaffin cells (1.5; Vernino et al., 1992). Studies with the recombinant rat or chick ₇ subunit transiently expressed in Xenopus oocytes also reveal a remarkably high relative permeability to Ca⁺⁺ ions with p_Ca/p_monovalent values ranging from 10 to 20 (Séguéla et al., 1993; Bertrand et al., 1993; Sands et al., 1993). This high Ca⁺⁺/Na⁺ permeability of the ₇ homo-oligomeric channel compared with the muscle (₁)₂ or other neuronal subtypes, including the widely distributed ₄₂, is suggestive of a role for the ₇ nAChR in mediating a variety of neuronal Ca⁺⁺-dependent processes.