![]() |
|
|
Vol. 280, Issue 1, 428-438, 1997
7 Nicotinic
Acetylcholine Receptor Significantly Raises Intracellular Free Calcium
Departments of Physiology and Pharmacology (O.D., M.L.M.) and Internal Medicine (Gerontology) (O.D., M.R.), Bowman Gray School of Medicine of the Wake Forest University, Winston-Salem, North Carolina and Neuroscience Research (D-47W) (M.G., L.M.M., J.P.S.), Abbott Laboratories, Abbott Park, Illinois
| |
Abstract |
|---|
|
|
|---|
The
7 nicotinic acetylcholine receptor (nAChR) subtype,
unlike other neuronal nicotinic receptors, exhibits a relatively high
permeability to Ca++ ions. Although Ca++ entry
through this receptor subtype has been implicated in various Ca++-dependent processes in the central nervous system,
little is known about how this receptor modulates mammalian
intracellular Ca++ dynamics. Intracellular Ca++
responses evoked by activation of the human
7 nAChRs
stably expressed in HEK-293 (human embryonic kidney) cells were
studied. Inward current and intracellular Ca++ transients
were recorded simultaneously in response to a fast drug application
system. Current recordings under whole-cell voltage-clamp and fast
ratiometric intracellular Ca++ imaging acquisition were
synchronized to drug pulses. The mean peak
[Ca++]i observed with 100 µM (
)-nicotine
was 356 ± 48 nM (n = 8). The magnitude of the
intracellular Ca++ elevation corresponds to a 20%
fractional current carried by Ca++ ions. The
EC50 of the intracellular Ca++ responses for
(
)-nicotine, (±)-epibatidine, 1,1 dimethyl-4-phenyl-piperazinium and
acetylcholine were 51, 3.5, 75 and 108 µM, respectively. These EC50 values strongly correlate with those recorded for the
cationic inward current through
7 nAChR.
-Bungarotoxin, methyllcaconitine or extracellular Ca++
chelation ablated (
)-nicotine-evoked increase in intracellular Ca++ concentration. This study provides evidence that
cation influx through the human
7 nAChR is sufficient to
mediate a significant, transient, rise in intracellular
Ca++ concentration.
| |
Introduction |
|---|
|
|
|---|
Neuronal nAChRs belong to the
family of ligand-gated multisubunit ion channels (Deneris et
al., 1991
; Luetje and Patrick, 1991
), members of which include
receptors for
-amino-n-butyric acid, glutamate, glycine
and serotonin (Karlin and Akabas, 1995
). A variety of nAChR subtypes
have been described in the brain, autonomic ganglia and sensory tissues
(McGehee and Role, 1995
). In recent years, it has become increasingly
clear that such molecular diversity arises as a consequence of
homomeric or heteromeric assembly of at least 11 gene products, namely,
2-
9 and
2-
4. The
2-
6 subunits in conjunction with
2-
4 subunits form heteromeric ion
channels, whereas the
7-
9 subunits form
homooligomeric channels when expressed in Xenopus
oocytes (Couturier et al., 1990
; Séguéla et al., 1993
; Peng et al., 1994
) or mammalian
cell lines (Gopalakrishnan et al., 1995
). Some
and
subunits may have a modulatory action on other nAChRs. Most of the
reports have failed to show that
5 and
6
as well as
3 subunits form functional receptors in conjunction with complimentary beta or alpha
receptors, respectively (Boulter et al., 1987
; Wada et
al., 1990
). It has been shown that these subunits may modify the
physiology and pharmacology of functional recombinant receptors
(Ramirez-Latorre et al., 1996
).
In the central nervous system, a major class of nicotinic receptors
defined by the high-affinity binding of
-[125I]bungarotoxin comprises predominantly, if not
exclusively, the
7 subtype. Unlike other nAChR subtypes,
the homomeric
7 subunit expressed in Xenopus
oocytes exhibits a higher Ca++ permeability relative to
monovalent cations (pCa/pmonovalent ratio: 20, Séguéla et al., 1993
; 10, Bertrand et
al., 1993
; pBa/pmonovalent ratio: 17, Sands et al., 1993
). These values are in the same order of
magnitude, if not higher, than those reported for the NMDA class of
glutamate receptors where
pCa++/pNa+ ratio values
ranging from 10.3 to 14.3 have been reported (Zarei and Dani, 1994
;
Castro and Albuquerque, 1995
). The permeability ratios are also much
higher than those determined for the muscle (
1)2
1
nAChRs (ratio
values ranging from 0.1 to 1.0; Vernino et al., 1992
; Costa
et al., 1994
) and the ganglionic
3-containing nAChRs (1.5, Vernino et al., 1992
; Fieber and Adams, 1991
)
and other non-NMDA glutamate receptors (Dingeldine et al.,
1992
).
The physiological role(s) of Ca++ entering mammalian cells
via the homomeric
7 nAChRs remains to be
elucidated. Influx of Ca++ through the
7
nAChR subtype has been suggested to be of particular importance in
activating several Ca++-dependent processes including
neurite growth, synaptic transmission and neurotrophic effects. Recent
studies have demonstrated the involvement of
-bungarotoxin-sensitive
nAChRs in (
)-nicotine-evoked Ca++ influx in ciliary
ganglion neurons (Vijayaraghavan et al., 1992
; Zhang
et al., 1994
), hippocampal neurons (Alkondon and
Albuquerque, 1993
) and at the synaptic junctions of the medial habenula
and interpeduncular nuclei (McGehee et al., 1995
). A role
for this nAChR in neuromodulation/neuroprotection emerges from the
observation that ligands that interact with this subtype have
neuroprotective properties (De Fiebre et al., 1995
; Meyer
et al., 1994
; Donnelly-Roberts et al., 1996
).
In vivo,
7 nAChR may coexist with other
-bungarotoxin-sensitive subunits (Anand et al., 1993
) and
this limits a direct analysis of the precise functional properties of
the homomeric combination. Although the Ca++ permeability
of the
7 homomer has been convincingly demonstrated by
permeability ratio studies (i.e., by evaluating
Ca++-dependent shift in the reversal potential with the
extended Goldman-Hodgkin-Katz equation) (Séguéla et
al., 1993
; Bertrand et al., 1993
; Sands et
al., 1993
), these measurements do not necessarily indicate whether
the receptors can significantly elevate intracellular Ca++
levels in mammalian cells (Vernino et al., 1994
).
Accordingly, the actual amount of Ca++ influx in mammalian
cells and the kinetics of such events remain to be defined.
The human
7 nAChR has recently been stably expressed in
a mammalian cell line and shown to function as a
-bungarotoxin-sensitive ion channel exhibiting rapid kinetics of
activation and inactivation (Gopalakrishnan et al., 1995
).
In this study, we have measured simultaneously membrane current and
intracellular Ca++ kinetics with a combination of
whole-cell patch-clamp and fura-2 imaging techniques. Our studies
provide direct evidence that the recombinant homomeric
7
nAChR subtype promotes a significant and sustained increase in
[Ca++]i in mammalian cells upon activation by
nAChR agonists including (
)-nicotine, acetylcholine, (±)-epibatidine
and 1,1-dimethyl-4-phenylpiperazinium.
| |
Methods |
|---|
|
|
|---|
Cell culture.
A stable cell line of human embryonic kidney
293 cells transfected with an expression vector containing the human
7 nAChR cDNA was used in the present study. Because the
human
7 cDNA originally cloned by Doucette-Stamm
et al. (1993)
lacked a signal sequence, a rat signal
sequence was included with a synthetic oligonucleotide
(5
-GCAGCACTCGAGCCATGTGCGGCGGGCGGGGAGGCATCTGGCTGGCTTGGCCGCGGCGCTGCTGCACGTGTCCCTGCAAGGCGAGTTCCAGAGGAAGCTTTACAAGGA-3
) containing internal XhoI and HindIII sites
(underlined). The forward and reverse complement of the oligo were
annealed, digested with XhoI/HindIII and ligated
into the HindIII/XhoI sites of the plasmid (pBluescript) containing the human
7 sequence. The
entire cDNA was then cut with XhoI/NotI and the
5
-overhang filled in with Klenow polymerase, linked with
BstXI adapters and ligated into the BstXI site of
the expression vector pRcCMV (Invitrogen, San Diego, CA) containing the
constitutive human cytomegalovirus promoter to obtain the plasmid
pRcCMV
7. HEK293s were transfected with this plasmid by
lipofectamine, and individual antibiotic-resistant colonies were picked
and propagated as previously described (Gopalakrishnan et
al., 1995
). The cell line, referred to as K28, expresses a high
density of
-[125I]bungarotoxin binding sites
(Bmax, ~970 fmol/mg protein) and has been
employed in this study. Cells were cultured in Dulbecco's modified
Eagle's medium supplemented with 10% fetal bovine serum and 0.25 mg/ml geneticin and maintained in a cell incubator at 37°C with 5%
CO2. Untransfected cells were grown in the same media, without geneticin. Cells were plated in
poly-L-lysine-coated ultrathin Fisher coverslips at
105 cells/ml in 35-mm Petri dishes (Falcon 1008, Becton
Dickinson, IL). Nonconfluent cells were studied for 4 to 5 days after
plating.
Intracellular Ca++ imaging and electrophysiological recordings. Coverslips were mounted in a small flowthrough Lucite chamber positioned on the stage of an Axiovert 135 microscope (Zeiss, Germany). The recording chamber was provided with a central hole to allow a direct access to the plated cells. A coverslip was fixed to the recording chamber by means of a Vaseline ring in such a way that only one coverslip was interposed between the cells and the microscope objective (100 ×, NA 1.3, Fluar, Zeiss). Continuous cell perfusion with the bathing-external solution (see below) was done with a push-pull syringe pump (WPI, Saratoga, FL).
Cells were voltage-clamped by use of the whole-cell configuration of the patch-clamp with an Axopatch-200A amplifier (Axon Instruments, Foster City, CA) by standard techniques (Hamill et al., 1981
was included
in the internal solution. F
improved the seal formation
and stability compared with other anions. Experiments using
F
or Cl
as the main internal cation did not
show differences on inward current kinetics and intracellular
Ca++ responses. In addition, two external solutions were
used. Most of the experiments were performed in a solution containing a
mixture of various cations, briefly named "Na+ and
Ca++ solution" (mM): NaCl, 120; KCl, 5;
CaCl2, 2; MgCl2, 2; HEPES, 10;
D-glucose, 25; pH adjusted to 7.4 with OHNa. For
Ca++ "calibration" an extracellular solution containing
75 mM CaCl2 and 10 mM HEPES was used (Vernino et
al., 1994Fast agonist delivery and solution exchange.
Agonists were
delivered by puffing the content of a reservoir with a Harvard syringe
pump through one barrel of a theta tube micropipette (Sutter). Theta
tubes were pulled and carved with a diamond pencil until a sharp
pipette tip of about 30 µm was obtained. The bathing solution was
puffed through the other barrel of the theta tube. Both solutions were
delivered at the same flux rate, and a very clear edge separated both
solution streams. A Newport (Novato, CA) manipulator was used for theta
glass tubes positioning. The sharpness of the interface between flowing
solutions was assessed by perfusing the two barrels with solutions with different ionic strength such as phosphate-buffered saline and 10%
phosphate-buffered saline solution, respectively. Theta tubes were
mounted in a piezoelectric device (Burleigh, Fishers, NY) and activated
by a voltage pulse. The activation of the drug-delivering system was
synchronized with the current and intracellular Ca++
transients recordings. The reliability of solution exchange was measured as an open-tip pipette (filled with 3 M KCl) response to
displacements of the theta tube interface. The time for 100% solution
exchange was 1 ms when the open tip was positioned 100 µm from the
theta tube tip. The latency between pulse and solution exchange is
attributable mainly to the solution diffusion time from the perfusion
to the recording pipette (Jonas, 1995
).
Intracellular Ca++ kinetics.
Intracellular Ca++ kinetics was measured under whole-cell
voltage-clamp with fura-2 pentapotassium salt (Molecular Probes,
Eugene, OR) as a Ca++-sensitive dye. However,
concentration-response curves to different nAChR agonists were done at
resting membrane potential. Membrane potential was determined in a
separated group of cells in current-clamp mode. The AM form of fura-2
(2 µM) was used for experiments in intact cells. Fura-2 salt was
dissolved in the pipette solution at concentrations ranging from 400 to
500 µM. Fura-2 as a ratiometric dye allowed absolute determinations
of the intracellular Ca++ concentration
([Ca++]i). Fura-2 was not saturated at the
concentrations used in our studies because 1 µM ionomycin induced
further increase in fluorescence at 350 nm excitation wavelength.
Ionomycin has been used previously to induce a massive influx of
extracellular Ca++ to the cell without affecting
intracellular stores (Delbono and Stefani, 1993
).
Calculation of intracellular Ca++
concentration.
For [Ca++]i calculations
R = F340/F350,
Rmin (0% saturation of the dye by
Ca++) and Rmax (100% saturation
with Ca++) were determined. Rmax was
obtained by adding a low dilution of saponin (0.001%) to the bathing
solution at the end of the experiments. Rmin was
measured in cells preincubated for 30 min in 2 mM EGTA.
[Ca++]i was calculated with the following
equation: [Ca++] = KD[(R
Rmin)/(Rmax
R)], where R is the fluorescent ratio, Rmax is the maximum ratio value measured at high
[Ca++]i and Rmin is
the minimum ratio value measured at low
[Ca++]i, KD is
the dissociation constant of the Ca++ binding to
fura-2 (224 nM; Grynkiewicz et al., 1985
). The values for
Rmin and Rmax determined
by calibration were 0.2 and 3.5, respectively. For computer simulation
of intracellular Ca++ transients Matlab software
(MathWorks, Inc., MA) was used. As the basal
[Ca++]i varied in a range from 65 to 350 nM
(207 ± 82; n = 50) in transfected HEK293, only
cells with a resting cytosolic Ca++ less than 100 nM were
included in this study. The reason for this selection is that the
effect of high intracellular [Ca++] on
7
nAChR kinetics has not yet been explored.
Concentration-response curves.
Concentration-response curves
were performed for four different nAChR agonist ((
)-nicotine,
acetylcholine, DMPP iodide, DMPP and (±)-epibatidine) in intact cells
(see above). An average of four different increasing concentrations
were used in the same cell. The time course of changes in
[Ca++], including the mean time for complete return to
prestimulating levels, was determined. Drugs were applied for 50 ms
with 1-min intervals. This interval assured a complete development of
the desensitizing phase even at lower (or less desensitizing)
concentrations and for a complete return of cytosolic
[Ca++] to prestimulating levels. A saturating
concentration of the agonist was included in each experiment. Thus,
responses to lower agonist concentrations were normalized to a maximum
elicited by the agonist. Six to eight cells were used for each group of
experiments. Intracellular Ca++ responses were corrected
for run-down according to procedures described below. Comparative
efficacies were evaluated by measuring absolute maximal increase in
[Ca++]. Lower concentrations of the agonists induced
Ca++ signals that were a fraction of the maximum response.
For plotting, Ca++ responses were normalized to the maximum
at the saturating concentration of the agonist.
Materials.
Cell culture media, fetal bovine serum and
geneticin were purchased from Life Technologies, Inc. (Grand Island,
NY). The following materials were purchased from sources indicated:
acetylcholine chloride, (
)-nicotine hydrogen tartrate, atropine
sulfate and 1,1-dimethyl-4-phenyl-piperazinium iodide were obtained
from Sigma Chemical Co. (St. Louis, MO),
-bungarotoxin, MLA citrate
and (±)-epibatidine dihydrochloride were purchased from Research
Biochemicals International (Natick, MA). Fura-2 pentapotassium salt,
fura-2 AM and Mag-fura-2 AM were purchased from Molecular Probes
(Eugene, OR). Fura-2 pentapotassium salt was dissolved in the pipette
solution at concentrations ranging from 400 to 500 µM. Fura-2 AM
stock was prepared in 10% dimethyl sulfoxide. With acetylcholine as the agonist, atropine (2 µM) was used to block endogenous muscarinic receptors.
| |
Results |
|---|
|
|
|---|
Whole-cell inward current and intracellular Ca++
transients were recorded simultaneously in HEK293 stably expressing the
human
7 nAChR. A short pulse (50 ms) of 100 µM
(
)-nicotine induces a fast inward current (activation time constant,
a = 1.1 ± 0.23 ms) that rapidly desensitizes
(desensitization time constant,
d = 12.2 ± 2.6 ms;
n = 5) in a cell voltage-clamped at
100 mV (fig.
1). The (
)-nicotine-induced inward current was
completely abolished by 3 nM
-bungarotoxin and 2 nM MLA
(n = 7 for both antagonists). These results are in
agreement with those previously reported for this cell line
(Gopalakrishnan et al., 1995
).
|
Time course and magnitude of (
)-nicotine-evoked
Ca++ transient.
Figure 1 also shows
selected fura-2 Ca++ ratio (340/350 nm) images at various
time intervals. The pattern of (
)-nicotine-evoked Ca++
transient was recorded simultaneously with inward current responses from the same cell. Previous studies with the adrenal chromaffin cells
have shown that the amplitude of the peak Ca++ transient
increases in the negative voltage range (Zhou and Neher, 1993
). Thus,
hyperpolarizing holding potentials were used to better define the
Ca++ responses in the present study. The intracellular
Ca++ rises from within the first 10 ms after exposure to
100 µM (
)-nicotine and further elevations were observed during the
desensitization phase of the current. The (
)-nicotine-evoked maximal
increase in [Ca++]i was observed at the time
during which the desensitization of the current was complete. The mean
peak [Ca++]i observed with 100 µM
(
)-nicotine was 356 ± 48 nM (n = 8). The mean
peak [Ca++]i corresponded throughout the drug
pulse to the cell outermost shells. Thereafter,
[Ca++]i starts to decline slowly reaching
50% of the peak response within 20 ± 6 s (n = 8) after beginning of the nicotine pulse. The time course of the peak
[Ca++]i changes after application of 100 µM
nicotine is depicted in figure 2A. A longer time was
required for returning [Ca++]i to
prestimulation values (range, 0.5-1 min; n = 8). No
inward current (n = 8) or intracellular
Ca++ changes (n = 25) were detected in the
presence of 300 to 1000 µM (
)-nicotine in untransfected cells,
consistent with previous reports showing lack of nAChR-mediated
responses in HEK293 (Gopalakrishanan et al., 1995). As a
control for potential effects of geneticin on the kinetics of
Ca++ influx, transfected cells grown in the absence of
geneticin for 24 to 48 h before testing were identical in response
to experiments done in the presence of geneticin (n = 15).
|
)-nicotine-evoked current flow is completed in about 100 ms, the
effect of Ca++ pumping/sequestration on Ca++
influx calculations is negligible. In this way, fluorescent emission at
510 nm is directly proportional to the rate of Ca++ influx:
[Ca++] (t) =
ICa
t/(2FV) (Sala and
Hernandez-Cruz, 1990
[Ca++]i is 300 nM (fig. 2C), which
corresponds with experimental records (fig. 2A). Another way to verify
this prediction, is through the calculation that 20% of the total
charges (633 nC) is carried by Ca++ ions. Because a flow of
140 pA is equivalent to 3.5 × 10
17 mol of
Ca++ for a cell of 10 to 20 µm diameter, 85% accessible
volume fraction and a value of Ks (binding
capacity of the endogenous buffer) (Neher and Augustine, 1992
[Ca++]i increase of 300 to 400 nM. Mathematical predictions were corroborated by use of pure
extracellular Ca++ solution (Vernino et al.,
1994
)-nicotine pulses.
The nicotine-induced current in pure Ca++ was reduced to
21 ± 2.7% (n = 7) of the control current
amplitude. Control was the (
)-nicotine-induced current recorded in
the same cell in the presence of the extracellular Na+ and
Ca++ solution (see "Methods").
Source of agonist-evoked intracellular Ca++.
The
[Ca++]i distribution showed a nonuniform
pattern across the cell stimulated with 100 µM (
)-nicotine (fig.
3). Pixel intensity profile analysis
along one vector across the cell shows a Ca++ gradient with
higher concentrations near the cells periphery. This gradient is an
indication of Ca++ influx through channels expressed on the
external membrane. The expression of endogenous voltage-gated calcium
channels was assessed in whole-cell voltage clamp in transfected
(n = 15) and untransfected HEK293 (n = 25). No inward current was detected in cells pulsed from three
different holding potentials (
50,
70 and
100 mV) to +60 mV with
10-mV increments. Cell hyperpolarization together with the lack of
expression of voltage-gated calcium channels in HEK293
(n = 25) also support the cationic influx through
expressed human
7 nAChRs.
|
)-nicotine-evoked increase in [Ca++]i in
transfected cells. In the presence of EGTA,
[Ca++]i values in response to 100 µM
(
)-nicotine were 63.7 ± 12.8 nM (n = 6). These
values were not significantly different with respect to control
(58.3 ± 14.6 nM; n = 6) where the cells were perfused with bathing solution, but were statistically significant with
respect to cells perfused with 100 µM (
)-nicotine (356 ± 48;
n = 8). These experiments demonstrate the requirement
for extracellular Ca++ in mediating (
)-nicotine-evoked
responses.
It was then investigated whether any contribution to
(
)-nicotine-evoked Ca++ transient arose from
intracellular organelles. Preincubation of the cells for 10 min in
heparin (20 mg/ml) or ryanodine (5 µM) blockers of IP3
and endoplasmic reticulum Ca++ release channel-ryanodine
receptor, respectively, did not change the time course and distribution
of the Ca++ response. Ryanodine exerts a direct effect by
directly activating, locking a subconductance state and finally
blocking the ryanodine receptor. The ryanodine effect takes about 3 min
to be completed when used at a concentration of 5 µM (Rousseau
et al., 1987
)-nicotine pulse after the ryanodine blockade of
the ryanodine receptor was completed. After incubation in ryanodine or
heparin [Ca++]i was 372 ± 39 nM
(n = 5) and 385 ± 63 (n = 5),
respectively. This demonstrates that ryanodine receptor and
IP3 receptor do not participate in the (
)-nicotine-evoked
Ca++ transient response.
Pharmacology of agonist-evoked Ca++
responses.
To examine whether antagonists with reported
selectivity toward the
7 nAChR relative to the
4
2 and ganglionic type nAChRs (Gopalakrishnan et al., 1995
; Wonnacott et al.,
1993
) could block (
)-nicotine-evoked rise in
[Ca++]i, cells were preincubated with either
-bungarotoxin (3 nM) or MLA (2 nM) for 10 min. As in whole-cell
voltage clamp the run-down was fast (0.5 ± 0.08 of the first
response at 5 min after accessing into the intracellular compartment,
n = 32), cells were preincubated in
-bungarotoxin
and MLA before getting into whole-cell patch-clamp configuration.
Subsequent application of 100 µM (
)-nicotine did not show
statistically significant elevations in
[Ca++]i was compared with control
(n = 7 for both antagonists tested; fig.
4). The abolishment of intracellular Ca++
responses in the presence of these nAChR antagonists is further supported by the complete suppression of single-channel activity recorded in outside-out patches from transfected cells (Messi et
al., 1996
).
|
50 ± 3.8 mV
(n = 25). The magnitude of the run-down of the intracellular Ca++ responses greatly differed in
voltage-clamped whole-cells and in intact cells. In the latter, paired
stimulations with 100 µM (
)-nicotine with variable intervals were
used to determine the magnitude of the run-down of the Ca++
signal. In dose-response studies the intervals between agonist applications were 2 min. Thus, controls applying the same (
)-nicotine concentration three to four times with 2-min intervals were performed. The ratio between the amplitudes of the second peak Ca++
response over the first response after four (
)-nicotine applications, or 10 min after the first drug application, was 0.79 ± 0.07 (n = 18). Because run-down was linear as a function of
time and independent of the agonist type (n = 10) and
concentration (n = 16), corrections of Ca++
signals were applied according to the time at which the response was
elicited. It has been suggested that the addition of ATP, phosphocreatine and creatine phosphokinase to the pipette solution minimizes run-down in whole-cell voltage-clamp recordings (Alkondon et al., 1994
)-nicotine and (±)-epibatidine in HEK293 stably
expressing the
7 nAChR. Both (
)-nicotine and
(±)-epibatidine elicited a concentration-dependent increase in
[Ca++]i. The half-effective concentration
(EC50) for (
)-nicotine was 51 ± 4 µM
(n = 8) with maximal response observed at 100 µM
(
)-nicotine (fig. 6A). Although the EC50
value for (±)-epibatidine (3.5 ± 0.2 µM; n = 5) was approximately 14-fold lower than that of (
)-nicotine, the
efficacy of these compounds did not differ significantly. Two other
agonists tested for Ca++ influx responses were
acetylcholine and 1,1 dimethyl-4-phenyl-piperazinium (fig. 6A).
Comparative efficacies of nAChR agonists were evaluated by measuring
absolute maximal increase in [Ca++]. Lower concentrations
of the agonists induced Ca++ signals that were a fraction
of the maximum. For plotting, Ca++ responses were
normalized to a maximum or saturating concentration of the agonist.
Intracellular Ca++ values in intact cells were lower than
in whole-cell voltage-clamp recordings which can be attributed to
differences in membrane potential. Maximum responses to (
)-nicotine,
acetylcholine, DMPP and (±)-epibatidine were (mean ± S.E.M., in
nM): 308 ± 27, 294 ± 32, 317 ± 33 and 311 ± 28 (n = 4-6 cells), respectively. The EC50
values for acetylcholine (108 µM) and DMPP (75 µM) closely correlate with the EC50 values for evoking whole-cell
current responses (fig. 6B). For the analysis included in figure 6B,
EC50 for current activation are from Gopalakrishnan
et al. (1995)
)-nicotine. In
these conditions the EC50 for (±)-epibatidine was 3 µM.
|
|
| |
Discussion |
|---|
|
|
|---|
The definition of the physiological role(s) of various neuronal
nAChR subtypes has, in recent years, been aided by the molecular cloning and expression of the various nAChR subunits and/or subunit combinations in mammalian cells (Whiting et al., 1991
;
Pereira et al., 1994
; Puchacz et al., 1994
). The
human
7 nAChR has recently been stably expressed in a
mammalian cell line, HEK-293, and shown to function as a
homo-oligomeric ion channel exhibiting rapid kinetics of activation and
inactivation of channel current, sensitive to
-bungarotoxin
(Gopalakrishnan et al., 1995
). This study documents, for the
first time, that Ca++ permeation through the recombinant
human
7 nAChRs promotes a significant transient rise in
intracellular Ca++ concentration in mammalian cells. The
dynamics of
7 nAChR-evoked Ca++ response has
also been characterized and directly correlated with the
pharmacological profile previously defined for this nAChR subtype
(Gopalakrishnan et al., 1995
).
Time course of intracellular Ca++
transients.
Simultaneous cationic inward current and intracellular
Ca++ recordings under whole-cell voltage-clamp conditions
demonstrated a fast Ca++ transient that reaches a peak at
the end of the desensitizing phase of the current. Such
Ca++ transient and current kinetic values are similar to
those reported previously in neurons expressing a diversity of nAChR
subtypes (Zhou and Neher, 1993
; Rathouz and Berg, 1994
; Vernino
et al., 1994
). The decline of the
[Ca++]i to base-line values is a relatively
slow process in this expression. This kinetics probably differs from
neurons which exhibit cell-to-cell variation in Ca++ buffer
capacity. Our present studies confirm, as previously suggested, that
-bungarotoxin-sensitive nicotinic receptors elevate intracellular free Ca++ in mammalian cells (Vijayaraghavan et
al., 1992
). Studies with the recombinant human
7
subunit stably expressed in HEK293 differ from those observed in chick
ganglion neurons in terms of a much higher sensitivity of the latter to
nicotine (0.1-1.0 µM), slower time course for the Ca++
response (2-4 s after nicotine application, although current duration
was less than 500 ms) and diminished sensitivity to
-bungarotoxin blockade at higher nicotine concentrations. Whether these differences reflect the presence of other subunits contributing to the effects found in chick ganglion neurons, as recently reported by Pugh et
al. (1995)
, or caused by differences in the amino acid sequences of the chick and human
7 subunit remain to be
determined.
)-nicotine-evoked
intracellular Ca++ response was reported. This could be
attributed to a slower desensitization of the response and lower
Ca++ permeability of the various nAChR subtypes expressed
in these cells. Although the duration between agonist-evoked activation and desensitization of the current was no longer than 100 ms in our
study, the higher permeability of the
7 nAChR for
Ca++ than for monovalent cations is sufficient to elicit a
significant increase in [Ca++]i. Further
experiments determining Ca++ transients in different
extracellular Ca++ concentrations will allow estimation of
the fraction of current carried by Ca++ ions and the
significance of the extracellular space in determining the magnitude of
intracellular Ca++ elevations (Vernino et al.,
1992Magnitude of intracellular Ca++
elevations.
Our study demonstrates that Ca++
permeation through the recombinant
7 nAChRs elicits a
significant rise in [Ca++]i in HEK293. The
relative increase is the same order of magnitude as observed for the
3
x nAChR subtype (expressed in chromaffin cells;
[Ca++]i = 50-100 nM at
50 mV),
ATP and NMDA receptors (Zhou and Neher, 1993
; Schneggenburger et
al., 1993
; Rogers and Dani, 1995
). However, the increase in
[Ca++]i is much lower than those reported for
glutamate receptors expressed in HEK293 (Burnashev et al.,
1995
). The (
)-nicotine-evoked intracellular Ca++
transient measured in this work is consistent with theoretical predictions based on the fraction of the inward current carried by
Ca++ ions and simulations of intracellular Ca++
transients resulting from Ca++ influx through the plasma
membrane. A 20% fractional current carried by Ca++ ions is
also consistent with direct measurements of Ca++ flux with
use of pure Ca++ extracellular solution.
Pharmacology of intracellular Ca++
responses.
An excellent correlation was observed between the
pharmacological profiles of (
)-nicotine, acetylcholine, DMPP and
(±)-epibatidine, obtained by measuring whole-cell currents and
intracellular Ca++ responses (fig. 6B). The 1:1 correlation
between agonist-induced intracellular Ca++ responses and
whole-cell currents indicates that the measured intracellular
Ca++ transient is a result of agonist-induced activation of
the channel and is not influenced by mechanisms of
Ca++-induced Ca++ release from internal stores
or Ca++-activated secondary conductance.
Ca++-induced Ca++ release was ruled out by
using ryanodine receptor and IP3 receptor antagonists. In
these experiments (
)-nicotine induced similar intracellular
Ca++ responses than in the absence of the antagonists. A
low electrochemical gradient for Cl
(F
is
the main internal anion) rules out the possibility to elicit an outward
Ca++-dependent Cl
current. Obviously, this
mechanism can not contribute to measured intracellular Ca++
signals. Further, the blockade of both current and
[Ca++]i responses by nanomolar concentrations
of
-bungarotoxin and MLA provides conclusive evidence that
(
)-nicotine-evoked responses are mediated via an
interaction with
7 nAChRs.
Source of (
)-nicotine-evoked intracellular
Ca++ transient.
Further support for the
conclusion that (
)-nicotine-evoked rise in
[Ca++]i in transfected HEK293 is mediated
primarily via the
7 nAChRs arises from the
following set of observations. The spatial
[Ca++]i distribution within the cell revealed
by pixel intensity profile analysis (fig. 3) indicates that the
Ca++ concentration is higher at the cell periphery than in
central areas and that the gradient between outer and inner regions is maintained during Ca++ influx which subsequently
dissipates. Second, the lack of effects of heparin and ryanodine,
blockers of inositol (Deneris et al., 1991
; McGehee and
Role, 1995
; Lindstrom et al., 1995
) triphosphate receptor
and ryanodine receptor, respectively, on (
)-nicotine-evoked Ca++ transients, indicates that these intracellular
Ca++-mobilizing pathways do not contribute directly to the
observed responses (Thayer and Miller, 1990
; Zhou and Neher, 1993
;
Schneggenburger et al., 1993
). Third, the lack of endogenous
expression of NMDA and voltage-gated Ca++ channels in
HEK293 (Burnashev et al., 1995
; Williams et al., 1992
), together with the fact that intracellular Ca++
transients were recorded at a hyperpolarizing potential (
100 mV),
eliminates any potential contribution of voltage-gated or other
Ca++-permeable ion channels to nAChR agonist-evoked
Ca++ response.
7 nAChR which has been shown to increase steeply at
negative voltages by whole-cell measurements (Galzi et al., 1992
150 to +50 mV) in outside-out and cell-attached patch-clamp
configurations (Messi et al., 1996Relevance to cellular function.
It is known that alterations
in [Ca++]i play a pivotal role in modulating
cell-to-cell and intracellular signaling mechanisms in neurons of the
central and peripheral nervous system (Kater et al., 1988
;
Kyrozis et al., 1995
). Neuronal Ca++ transients
resulting from activation of voltage-gated Ca++ channels
and NMDA class of glutamate receptors have been widely studied
(Burnashev et al., 1995
; Kyrozis et al., 1995
).
More recently, Ca++ permeability of acetylcholine-activated
currents in regions of the central nervous system have received
considerable attention and it has become increasingly clear that such
responses are mediated by distinct nAChR subtypes. Studies in cultured
hippocampal neurons and ciliary ganglion neurons have demonstrated the
existence of
-bungarotoxin-sensitive nAChRs with high
Ca++ permeability, whose activation elicits a rapidly
activating and rapidly desensitizing current to nAChR agonists
(Vijayaraghavan et al., 1992
; Castro and Albuquerque, 1995
;
Zhang et al., 1994
). In hippocampal neurons, the relative
Ca++ permeability values of the
-bungarotoxin-sensitive
nAChR are similar to those of the NMDA class of glutamate receptors
[pCa++/pCs+ of 6 vs. 10 for the
NMDA channel (Castro and Albuquerque, 1995
)] and much higher than
those reported for the muscle-type nAChRs expressed in
BC3H1 cells (0.2; Vernino et al., 1992
) and
other
-bungarotoxin-insensitive nAChRs expressed in parasympathetic
ganglia (1.5; Fieber and Adams, 1991
); PC12 cells (2.5; Sands and
Barish, 1991
) or adrenal chromaffin cells (1.5; Vernino et
al., 1992
). Studies with the recombinant rat or chick
7 subunit transiently expressed in Xenopus
oocytes also reveal a remarkably high relative permeability to
Ca++ ions with pCa/pmonovalent
values ranging from 10 to 20 (Séguéla et al.,
1993
; Bertrand et al., 1993
; Sands et al., 1993
).
This high Ca++/Na+ permeability of the
7 homo-oligomeric channel compared with the muscle
(
1)2

or other neuronal subtypes,
including the widely distributed
4
2, is
suggestive of a role for the
7 nAChR in mediating a
variety of neuronal Ca++-dependent processes.
)-nicotine and ABT-418
are neuroprotective in in vitro models of cytotoxicity
(Akaike, 1994
)-nicotine are blocked by
-bungarotoxin
which suggests the participation of
-bungarotoxin-sensitive nAChRs
in mediating such effects.
The relatively high Ca++ permeability, the widespread
distribution of
7-containing nAChRs in the central
nervous system especially in hippocampus, limbic cortex and thalamus,
the pre- and postsynaptic localization and the ability to be activated
at potentials more negative than those required for activation of
voltage-gated and other ligand-gated Ca++-permeable
channels are notable features that endow distinctive functional role(s)
for the
7 nAChR subtype (Wong and Gallagher, 1991
)-nicotine in these
cells is to a level (~350 nM) that is not excitotoxic under normal
conditions, but rather promotes neuronal growth and survival even in
the absence of neurotrophic factors.
The activation of the
7 nAChR and resultant
Ca++ influx at resting or hyperpolarizing conditions may
play a role in neuronal plasticity and in mediating the cellular
responses to excessive glutamate stimulation (McGehee et
al., 1995
7 nAChR-activated current
density suffice to depolarize the extrasynaptic membrane (Horch and
Sargent, 1995
7 nAChR has significant effects on intracellular
Ca++ dynamics which could modulate unique cellular
signaling processes.
| |
Acknowledgments |
|---|
We are grateful to Dr. Stephen Arneric for critically reading the manuscript and for helpful suggestions.
| |
Footnotes |
|---|
Accepted for publication September 3, 1996.
Received for publication May 2, 1996.
1 Research in the laboratory of O.D. was supported by grants from the National Institutes of Health 2-P60AG10484, T-32-AG00182 and K01 AG00692 and from the Muscular Dystrophy Association (U.S.A.).
Send reprint requests to: Dr. Osvaldo Delbono, Dept. of Physiology and Pharmacology, Bowman Gray School of Medicine, Medical Center Boulevard, Winston-Salem, NC 27157.
| |
Abbreviations |
|---|
HEK293, human embryonic kidney 293 cells;
nAChR, nicotinic acetylcholine receptor;
EGTA, ethylene
glycol-bis(
-aminoethyl ether)-N,N,N
,N
-tetraacetic acid;
NMDA, N-methyl-D-aspartate;
IP3, inositol
1,4,5-triphosphate;
MLA, methyllycaconitine;
DMPP, 1,1
dimethyl-4-phenyl-piperazinium;
ABT-418, (S)-3-methyl-5-(1-methyl-2-pyrrolidinyl) isoxazole;
HEPES, N-[2-hydroxyethyl]piperazine-N
-[2-ethanesulfonic acid];
PBS, phosphate-buffered saline.
| |
References |
|---|
|
|
|---|
1 subunit of the nicotinic acetylcholine receptor.
Biochemistry
32: 9975-9984, 1993[Medline].
7 nicotinic receptor.
Proc. Natl. Acad. Sci. U.S.A.
90: 6971-6975, 1993
-Bungarotoxin-sensitive hippocampal nicotinic receptor channel has a high calcium permeability.
Biophys. J.
68: 516-524, 1995[Medline].
7) is developmentally regulated and forms a homo-oligomeric channel blocked by
-BTX.
Neuron
5: 847-856, 1990[Medline].
7/[125I]
-bungarotoxin receptor subtypes.
Mol. Pharmacol.
47: 164-171, 1995[Abstract].
7 nicotinic acetylcholine receptor.
Drug Dev. Res.
30: 252-256, 1993.
7 nicotinic acetylcholine receptor.
Eur. J. Pharmacol. (Mol. Pharmacol.)
290: 237-246, 1995[Medline].
7-nicotinic acetylcholine receptor (nAChR) stably expressed in K28 cells.
Biophys. J.
70: A252, 1996.
7 subunit from the SH-SY5Y cell line and determination of pharmacological properties of native receptors and functional homomers expressed in Xenopus oocytes.
Mol. Pharmacol.
45: 546-554, 1994[Abstract].
4
2 subtype of neuronal nicotinic acetylcholine receptors stably expressed in fibroblast cells.
J. Pharmacol. Exp. Ther.
270: 768-778, 1994
7 subunits in human SH-SY5Y neuroblastoma cells.
FEBS Lett.
354: 155-159, 1994[Medline].
-bungarotoxin mediates neurite retraction in a calcium-dependent manner.
J. Neurosci.
14: 889, 1994[Abstract].
-bungarotoxin.
Mol. Pharmacol.
47: 717-725, 1995[Abstract].
5 subunit to neuronal acetylcholine receptor channels.
Nature
380: 347-351, 1996[Medline].
7 expressed in Xenopus oocytes.
Biophys. J.
65: 2614-2621, 1993[Medline].
7: A nicotinic cation channel highly permeable to calcium.
J. Neurosci.
13: 596-604, 1993[Abstract].
-Bungarotoxin on neurons raise intracellular free Ca2+.
Neuron
8: 353-362, 1992[Medline].
-conotoxin-sensitive human N-type Ca2+ channel.
Science
257: 389-395, 1992
-bungarotoxin with high affinity function as ligand-gated ion channels.
Neuron.
12: 167-177, 1994[Medline].This article has been cited by other articles:
![]() |
J. Arredondo, A. I. Chernyavsky, D. L. Jolkovsky, K. E. Pinkerton, and S. A. Grando Receptor-mediated tobacco toxicity: acceleration of sequential expression of {alpha}5 and {alpha}7 nicotinic receptor subunits in oral keratinocytes exposed to cigarette smoke FASEB J, May 1, 2008; 22(5): 1356 - 1368. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Guo and R. A. J. Lester Ca2+ Flux and Signaling Implications by Nicotinic Acetylcholine Receptors in Rat Medial Habenula J Neurophysiol, January 1, 2007; 97(1): 83 - 92. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Razani-Boroujerdi and M. L. Sopori Early Manifestations of NNK-Induced Lung Cancer: Role of Lung Immunity in Tumor Susceptibility Am. J. Respir. Cell Mol. Biol., January 1, 2007; 36(1): 13 - 19. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Arredondo, A. I. Chernyavsky, D. L. Jolkovsky, K. E. Pinkerton, and S. A. Grando Receptor-mediated tobacco toxicity: cooperation of the Ras/Raf-1/MEK1/ERK and JAK-2/STAT-3 pathways downstream of {alpha}7 nicotinic receptor in oral keratinocytes FASEB J, October 1, 2006; 20(12): 2093 - 2101. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Tournier, K. Maouche, C. Coraux, J.-M. Zahm, I. Cloez-Tayarani, B. Nawrocki-Raby, A. Bonnomet, H. Burlet, F. Lebargy, M. Polette, et al. {alpha}3{alpha}5{beta}2-Nicotinic Acetylcholine Receptor Contributes to the Wound Repair of the Respiratory Epithelium by Modulating Intracellular Calcium in Migrating Cells Am. J. Pathol., January 1, 2006; 168(1): 55 - 68. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bray, J.-H. Son, P. Kumar, and S. Meizel Mice Deficient in CHRNA7, a Subunit of the Nicotinic Acetylcholine Receptor, Produce Sperm with Impaired Motility Biol Reprod, October 1, 2005; 73(4): 807 - 814. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Diaz-Hernandez, J. Sanchez-Nogueiro, J. Pintor, and M. T. Miras-Portugal Interaction between Dinucleotide and Nicotinic Receptors in Individual Cholinergic Terminals J. Pharmacol. Exp. Ther., December 1, 2004; 311(3): 954 - 967. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-H. Son and S. Meizel Evidence Suggesting That the Mouse Sperm Acrosome Reaction Initiated by the Zona Pellucida Involves an {alpha}7 Nicotinic Acetylcholine Receptor Biol Reprod, April 1, 2003; 68(4): 1348 - 1353. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bray, J.-H. Son, and S. Meizel A Nicotinic Acetylcholine Receptor Is Involved in the Acrosome Reaction of Human Sperm Initiated by Recombinant Human ZP3 Biol Reprod, September 1, 2002; 67(3): 782 - 788. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Francis, E. Y. Cheng, G. A. Weiland, and R. E. Oswald Specific Activation of the alpha 7 Nicotinic Acetylcholine Receptor by a Quaternary Analog of Cocaine Mol. Pharmacol., July 1, 2001; 60(1): 71 - 79. [Abstract] [Full Text] |
||||
![]() |
V. Nguyen, A Ndoye, L. Hall, S Zia, J Arredondo, A. Chernyavsky, D. Kist, B. Zelickson, M. Lawry, and S. Grando Programmed cell death of keratinocytes culminates in apoptotic secretion of a humectant upon secretagogue action of acetylcholine J. Cell Sci., January 3, 2001; 114(6): 1189 - 1204. [Abstract] [PDF] |
||||
![]() |
S. Zia, A. Ndoye, T. X. Lee, R. J. Webber, and S. A. Grando Receptor-Mediated Inhibition of Keratinocyte Migration by Nicotine Involves Modulations of Calcium Influx and Intracellular Concentration J. Pharmacol. Exp. Ther., June 1, 2000; 293(3): 973 - 981. [Abstract] [Full Text] |
||||
![]() |
V. Gerzanich, F. Wang, A. Kuryatov, and J. Lindstrom alpha 5 Subunit Alters Desensitization, Pharmacology, Ca++ Permeability and Ca++ Modulation of Human Neuronal alpha 3 Nicotinic Receptors J. Pharmacol. Exp. Ther., July 1, 1998; 286(1): 311 - 320. [Abstract] [Full Text] |
||||
![]() |
D. Ragozzino, B. Barabino, S. Fucile, and F. Eusebi Ca2+ permeability of mouse and chick nicotinic acetylcholine receptors expressed in transiently transfected human cells J. Physiol., March 15, 1998; 507(3): 749 - 757. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Krause, B. Buisson, S. Bertrand, P.-J. Corringer, J.-L. Galzi, J.-P. Changeux, and D. Bertrand Ivermectin: A Positive Allosteric Effector of the alpha 7 Neuronal Nicotinic Acetylcholine Receptor Mol. Pharmacol., February 1, 1998; 53(2): 283 - 294. [Abstract] [Full Text] |
||||
![]() |
E. Palma, L. Maggi, F. Eusebi, and R. Miledi Neuronal nicotinic threonine-for-leucine 247 alpha 7 mutant receptors show different gating kinetics when activated by acetylcholine or by the noncompetitive agonist 5-hydroxytryptamine PNAS, September 2, 1997; 94(18): 9915 - 9919. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Fucile, E. Palma, A. M. Mileo, R. Miledi, and F. Eusebi Human neuronal threonine-for-leucine-248 alpha 7 mutant nicotinic acetylcholine receptors are highly Ca2+ permeable PNAS, March 28, 2000; 97(7): 3643 - 3648. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||